The RecQ DNA helicase Rqh1 constrains Exonuclease 1-dependent recombination at stalled replication forks

Osman, Fekret; Ahn, Jong Sook; Lorenz, Alexander; Whitby, Matthew C.

doi:10.1038/srep22837

Download PDF

Article
Open access
Published: 09 March 2016

The RecQ DNA helicase Rqh1 constrains Exonuclease 1-dependent recombination at stalled replication forks

Fekret Osman¹^na1,
Jong Sook Ahn¹^na1,
Alexander Lorenz¹^nAff3 &
…
Matthew C. Whitby¹

Scientific Reports volume 6, Article number: 22837 (2016) Cite this article

2490 Accesses
8 Citations
2 Altmetric
Metrics details

Subjects

Abstract

DNA double-strand break (DSB) repair by homologous recombination (HR) involves resection of the break to expose a 3′ single-stranded DNA tail. In budding yeast, resection occurs in two steps: initial short-range resection, performed by Mre11-Rad50-Xrs2 and Sae2; and long-range resection catalysed by either Exo1 or Sgs1-Dna2. Here we use genetic assays to investigate the importance of Exo1 and the Sgs1 homologue Rqh1 for DNA repair and promotion of direct repeat recombination in the fission yeast Schizosaccharomyces pombe. We find that Exo1 and Rqh1 function in alternative redundant pathways for promoting survival following replication fork breakage. Exo1 promotes replication fork barrier-induced direct repeat recombination but intriguingly limits recombination induced by fork breakage. Direct repeat recombination induced by ultraviolet light depends on either Exo1 or Rqh1. Finally, we show that Rqh1 plays a major role in limiting Exo1-dependent direct repeat recombination induced by replication fork stalling but only a minor role in constraining recombination induced by fork breakage. The implications of our findings are discussed in the context of the benefits that long-range resection may bring to processing perturbed replication forks.

The Rad51 paralogs facilitate a novel DNA strand specific damage tolerance pathway

Article Open access 05 August 2019

Non-enzymatic roles of human RAD51 at stalled replication forks

Article Open access 27 September 2019

The Bloom syndrome complex senses RPA-coated single-stranded DNA to restart stalled replication forks

Article Open access 26 January 2021

Introduction

Homologous recombination (HR) is a central mechanism for the repair of DNA double-strand breaks (DSBs)¹, and also plays a key role in processing perturbed replication forks, including promoting the restart of blocked and broken forks². It is typically initiated from an exposed DNA end (e.g. a DSB or an extruded DNA arm at a reversed replication fork) that has been resected to form a 3′ single-strand tail. This tail acts as a nucleation site for the Rad51 recombinase, which then uses the tail to search for and invade an intact homologous duplex sequence. Strand invasion forms a displacement (D) loop, with the end of the invading strand acting as a primer for a DNA polymerase. From this point HR can progress via several different paths depending on the context of the initiating lesion/perturbed replication fork. In the case of DSBs in G2-phase cells, the D-loop would typically be extended by the polymerase catalysing new DNA synthesis and then unwound by a DNA helicase so the extended strand can anneal to the other side of the break. This mode of DSB repair is called Synthesis-Dependent Strand Annealing (SDSA)³. If the D-loop is not unwound, then the single-strand on the other end of the break can anneal to it, ultimately leading to the covalent attachment of the two recombining DNAs via a double Holliday junction. This structure is later resolved so that the DNAs can segregate during mitosis/meiosis^1,3. DSB resection can also promote a Rad51-independent mode of repair called single-strand annealing (SSA), which involves base-pairing between repetitive sequences that flank the break, resulting in the deletion of one of the repeats, as well as the DNA between them³.

DNA resection is the key step that assigns repair to HR rather than the alternative mechanism of non-homologous end-joining, which is inherently more mutagenic^4,5. In budding yeast the Mre11-Rad50-Xrs2 (MRX) complex, in conjunction with Sae2, catalyses initial “short-range” DNA resection by cutting the 5′-ended strand up to ~300 nucleotides away from the DNA end, and then degrading it from its point of incision in a 3′ to 5′ direction^6,7. This mode of resection not only generates a short 3′ tail but also removes any protein blocks from the DNA end that could impede exonucleases⁸. The homologous proteins in fission yeast and human, Mre11-Rad50-Nbs1 (MRN) and Ctp1/CtIP, are thought to catalyse short-range resection in a similar manner^7,9,10.

Whilst the short 3′ single-strand tails generated by MRX and Sae2 can be sufficient to promote DSB repair, in most instances resection is continued by either of two alternative pathways that generate much longer tails (typically ~2000–6000 nucleotides, but in some instances >50,000 nucleotides)^{10,11,12,13,14,15}. The first pathway depends on Exonuclease 1 (Exo1), which degrades the 5′ ended strand within duplex DNA to generate the requisite 3′ tail¹⁶. The second pathway utilises the single-strand specific exonuclease activity of Dna2, together with a RecQ-type DNA helicase (Sgs1 in budding yeast; BLM and/or WRN in human)^17,18,19. The “long-range” resection catalysed by these pathways is not strictly needed for Rad51-mediated HR, albeit it does improve DSB repair efficiency by 30–50% in budding yeast vegetative cells, leading to speculation as to what its true importance is^11,12,13.

Analysis of DSB processing in fission yeast has shown that Exo1 is the primary factor needed for long-range DNA resection in this organism, with the RecQ-type helicase Rqh1 being required for the residual levels of resection in an exo1∆ mutant¹⁰. However, the importance of long-range resection for processing DSBs and perturbed replication forks in fission yeast has not been assessed, and therefore we have conducted a genetic analysis of exo1 and rqh1 single and double mutants, measuring genotoxin sensitivity, meiotic recombination, and direct repeat recombination induced by different agents. Both Exo1 and Rqh1 have roles in addition to catalysing long-range resection, for example Exo1 can promote DNA mismatch repair by excising the daughter strand following recognition of the mispaired bases^20,21, and Rqh1 promotes crossover avoidance during DSB repair²², most likely by catalysing double Holliday junction dissolution²³. These additional functions complicate the interpretation of data obtained from genetic assays, limiting what one can conclude about the role of long-range resection. Nevertheless, as an exo1∆ rqh1∆ double mutant exhibits little or no long-range resection¹⁰, an absence of an additive or synergistic phenotype for this double mutant would suggest that long-range resection is not essential for the process under investigation, whereas a synergistic interaction would suggest an instance where it might be important. With this logic in mind, we present data that suggest an important role for long-range resection, both in the repair of broken replication forks, and in influencing direct repeat recombination at stalled forks.

Results

Cells lacking both Exo1 and Rqh1 exhibit a synergistic increase in sensitivity to camptothecin but not to ionising radiation

Previous studies in budding yeast have shown that an exo1∆ sgs1∆ double mutant exhibits a synergistic increase in sensitivity to a range of DNA damaging agents, including ionising radiation (IR), the IR-mimetic phleomycin, the ribonucleotide reductase inhibitor hydroxyurea (HU), the alkylating agent methyl methanesulphonate (MMS) and the topoisomerase I (Top1) poison camptothecin (CPT)^12,15. Each of these agents can give rise to DSBs either directly, or as a consequence of perturbing DNA replication. Co-depletion of BLM and EXO1 in human cells has also been shown to cause a synergistic increase in CPT sensitivity¹⁵. To establish whether the same interaction is conserved in fission yeast, we compared the genotoxin sensitivities of exo1∆ and rqh1∆ single and double mutants (Fig. 1a). Consistent with data from budding yeast and human cells, we found that the fission yeast double mutant exhibits a synergistic increase in sensitivity to MMS, HU and CPT (Fig. 1a). A synergistic increase in sensitivity to CPT was also noted for exo1∆, when combined with either rqh1^K547A or rqh1^K547R mutant alleles, which express helicase deficient Rqh1 (Fig. 1b)²⁴. However, in contrast to budding yeast, an exo1∆ rqh1∆ double mutant is no more sensitive to IR than a rqh1∆ single mutant. This lack of synergism was also observed for sensitivity to ultraviolet light (UV).

**Figure 1: An *exo1*∆ *rqh1*∆ double mutant exhibits a synergistic increase in sensitivity to MMS, HU and CPT.**

The very strong synergistic interaction between exo1∆ and rqh1∆ for CPT sensitivity suggests that long-range resection is important for the repair of replication-associated DSBs. CPT impedes the religation step in Top1’s reaction cycle, resulting in an accumulation of single-strand DNA breaks (SSBs), with Top1 attached covalently to the 3′ end of the broken strand. These breaks can be converted into DSBs when encountered by a replication fork²⁵. To see whether the requirement for either Exo1 or Rqh1 to repair such lesions was due to the presence of the covalently attached Top1, we made use of strains in which a site-specific SSB without any covalent protein attachment is formed at the fission yeast mating type (MT) locus. Similar to SSBs induced by CPT, the MT locus SSB gives rise to a DSB following its encounter by a replication fork²⁶. In a wild-type this DSB is repaired by recombination using one of two homologous silent donor alleles (mat2P and mat3M), which results in MT switching. However, in the absence of the donors, repair depends on sister chromatid recombination, as it would for the repair of a CPT-induced DSB (Fig. 2a). The data in Fig. 2b show that in the presence of the MT locus SSB, and absence of silent donors, an exo1∆ rqh1∆ double mutant exhibits reduced viability compared to both wild-type and single mutant strains. These data provide further evidence that DSB resection, catalysed by either Exo1 or Rqh1, may generally be required for the repair of broken replication forks.

**Figure 2: An *exo1*∆ *rqh1*∆ double mutant exhibits a synergistic reduction in growth when SSB formation is active at the *mat1* locus in strains lacking the donor cassettes *mat2*P and *mat3*M.**

Neither Rqh1 nor Exo1 are essential for meiotic DSB repair in fission yeast

In budding yeast long-range resection is not needed for efficient formation of D-loops and double Holliday junctions during meiotic DSB repair¹¹. To investigate whether it is needed for the recombinational repair of meiotic DSBs in fission yeast, we used a genetic recombination assay containing intragenic markers (ade6-3083 and ade6-L469), and flanking intergenic markers (his3⁺-aim and ura4⁺-aim2), to determine gene conversion (GC) and crossover (CO) frequencies, as well as the percentage of GCs at ade6-3083 associated with a CO^27,28,29 (Fig. 3a). To assess the overall efficiency of meiotic DSB repair, we first compared the viability of spores generated from wild-type, exo1∆, rqh1∆ and exo1∆ rqh1∆ homozygous crosses (Fig. 3b). Both exo1∆ and rqh1∆ single mutants exhibit reductions in spore viability compared to wild type, but there is no further decrease in the double mutant. Assuming there is no other enzyme capable of catalysing long-range resection during meiosis in fission yeast, these data suggest that long-range resection is not essential for meiotic DSB repair, albeit it might promote its efficiency. The exo1∆ single mutant exhibits the same frequencies of GC and CO as wild-type, and the percentage of GCs associated with a CO is also unchanged (Fig. 3c–e). In contrast, a rqh1∆ mutant exhibits significant reductions in both GC (~12-fold, P = 4.7 × 10⁻¹⁰) and CO (~2.5-fold, P = 1.6 × 10⁻⁴), whilst the percentage of GCs associated with a CO is unchanged (Fig. 3c–e). We suspect that these reductions reflect a loss of Holliday junction branch migration activity, rather than less DNA resection^29,30. The exo1∆ rqh1∆ double mutant exhibits essentially the same CO frequency as a rqh1∆ single mutant (P > 0.05), and, as with both single mutants, shows no change in the percentage of GCs associated with a CO (Fig. 3d,e). However, its frequency of GC is ~6-fold lower than a rqh1∆ single mutant (P = 1.1 × 10⁻¹⁰) (Fig. 3c). Altogether these data suggest that the resection activities of Exo1 and Rqh1, whilst not essential for meiotic DSB repair, might be required for efficient GC in fission yeast, possibly by increasing the frequency of interhomolog recombination relative to intersister recombination.

**Figure 3: Spore viability and meiotic recombination in *exo1*∆ and *rqh1*∆ single and double mutants.**

Replication-associated DSBs are stabilised in an exo1∆ rqh1∆ double mutant

To further study what impact the loss of both Exo1 and Rqh1 has on the recombinational repair of broken replication forks, we established a system for measuring recombination caused by an inducible site-specific SSB at the ade6 locus on chromosome 3 of S. pombe. M13 filamentous bacteriophage gene II protein (gpII) was used to make a nick in the DNA between a direct repeat of ade6⁻ heteroalleles (Fig. 4a). gpII is a site-specific DNA nicking enzyme that has previously been used for studying replication fork breakage on phage λ chromosomes in Escherichia coli³¹. Upon nicking the DNA it forms a covalent complex with the 5′ end of the nick³². The minimal nicking site (40 bp) for gpII was inserted between the ade6⁻ direct repeats (Fig. 4a). Previous studies, using the polar replication fork barrier RTS1 inserted at this site, have shown that replication of this region occurs almost exclusively in the telomere to centromere direction^33,34,35. Two strains were therefore constructed, one for each orientation of the nicking site, so that we could assess the effect of a nick in both the leading and lagging template strands.

**Figure 4: Replication fork breakage at a site-specific SSB.**

In theory, a nick in the leading template strand (top strand) initially gives rise to a one-sided DSB upon encounter by a replication fork, which can be converted into a two-sided DSB during fork convergence, whereas a lagging strand (bottom strand) nick causes a two-sided DSB following encounter by the first fork (Fig. 4b)³⁶. To determine whether a chromosomal nick does indeed give rise to such DSBs, we expressed gpII, with an N-terminal SV40 T-antigen nuclear localisation signal, from the pREP1 thiamine repressible nmt promoter, in strains containing the nicking site, and analysed nick and DSB formation on both alkaline and neutral gels (Fig. 4c,d). In wild-type strains, nicking was clearly detected on alkaline gels for both orientations of the cleavage site (Fig. 4c,d top panels, lanes b and c). In contrast only very faint signals for DSBs were detected on neutral gels (Fig. 4c,d bottom panels, lanes b and c). To see whether the failure to clearly detect DSBs was due to the rapidity of their repair, we repeated our experiments in a rad50S mutant, which is defective for processing DSBs with covalently attached protein⁹. In this mutant, bands indicative of DSBs were clearly detected (Fig. 4c,d, lanes e–h). Furthermore, by synchronizing cells, using the cdc10-V50 thermosensitive mutation, we were able to confirm that DSB formation depended on passage through S-phase (see Supplementary Fig. S1). However, whereas we could detect nicked DNA with probes either side of the nicking site (Fig. 4c,d top panels, lanes e–h), we could only clearly detect DSBs in strains with a bottom strand nick using probe A (Fig. 4c bottom panel, lanes e and f) and in strains with a top strand nick using probe E (Fig. 4d bottom panel, lanes g and h). In other words, only the side of the DSB containing the covalently attached gpII is clearly detected, which is consistent with the known deficiency of a rad50S mutant in processing “dirty” DNA ends⁹.

Having confirmed that our gpII-based system generates nicks that result in DSBs during S-phase, we next assessed whether deletion of exo1 and/or rqh1 resulted in DSB stabilisation. As with wild-type, only faint DSB signals were detected for both single mutants (data not shown), however clear DSB signals were detected in exo1∆ rqh1∆ double mutant strains with either top or bottom strand nicks, albeit, unlike in a rad50S mutant, the signals are smeared (Fig. 4e top and bottom panels, lanes a–d). A similar effect has been seen in a budding yeast exo1∆ sgs1∆ double mutant and likely reflects the fact that short-range resection, dependent on MRN and Ctp1, is still active in these mutants¹⁴. Also, unlike a rad50S mutant, both ends of the DSB are detected, which is consistent with the expected attenuation of 5′- 3′ resection (Fig. 4e, compare lanes a–d with f–i). Altogether these data show that efficient long-range resection of replication-associated DSBs relies on either Exo1 or Rqh1.

GpII-induced nicks stimulate direct repeat recombination

To measure how much recombination gpII nicking induces, we determined the frequency of Ade⁺ recombinants both with and without gpII and/or its cleavage site (Fig. 5). A his3⁺ gene between the ade6⁻ heteroalleles allowed us to determine whether the Ade⁺ recombinants were from a gene conversion or deletion event (Fig. 5a). In preliminary experiments we found that pREP1-levels of gpII generated saturating amounts of recombinants, which made it difficult to obtain an accurate measure of recombination (data not shown). We therefore expressed gpII from the weaker nmt promoter in pREP81. The presence of gpII in the absence of its cleavage site, or a cleavage site without gpII, caused no increase in recombinants over spontaneous levels, whereas the two together resulted in ~15–21 fold increase in gene conversions and ~31–33 fold increase in deletions (Fig. 5b and see Supplementary Table S1). Very little difference was observed in the frequency of recombinants induced by a bottom strand nick compared to a top strand nick (Fig. 5b and see Supplementary Table S1), and therefore we chose to focus on strains with a bottom strand nick for the studies described below.

**Figure 5: GpII-induced direct repeat recombination in wild-type fission yeast.**

Exo1 suppresses deletions and gene conversions caused by replication-associated DSBs

We next determined what effect deleting exo1 and rqh1 has on both spontaneous and gpII-induced direct repeat recombination (Fig. 6 and see Supplementary Table S1). The frequency of spontaneous recombination was unaltered by deleting exo1 (Fig. 6a and see Supplementary Table S1). In contrast, and consistent with previous data³⁷, a rqh1∆ mutant exhibits a ~2 fold increase in gene conversions and ~4-fold increase in deletions (Fig. 6a and see Supplementary Table S1). Analysis of an exo1∆ rqh1∆ double mutant shows that this hyper-recombination is almost entirely dependent on exo1 (Fig. 6a). Unlike spontaneous recombination, the overall frequency of gpII-induced recombinants increases by ~2.9-fold in an exo1∆ mutant (P < 0.001), which is more than the ~1.7-fold increase in a rqh1∆ mutant (P = 0.005) (Fig. 6b and see Supplementary Table S1). Moreover, an exo1∆ rqh1∆ double mutant exhibits a similar overall increase in recombinants as an exo1∆ single mutant (Fig. 6b and see Supplementary Table S1). These data suggest that either Exo1 and Rqh1 function in the same pathway for limiting gpII-induced recombinants or that Exo1 is required for the hyper-recombination in a rqh1∆ mutant.

**Figure 6: Spontaneous and gpII-induced direct repeat recombination in *exo1*∆, *rqh1*∆ and *rad51*∆ single, double and triple mutants.**

Exo1 and/or Rqh1 are required for the hyper-level of deletions in a rad51∆ mutant

In wild-type cells, direct repeat recombination is probably driven mainly by Rad51, giving rise to both gene conversions and deletions (see Supplementary Fig. S2)³⁸. However, when Rad51 is absent recombination can be channelled into Rad52-dependent SSA, which generates solely deletions³⁸. Consistently, we observed a loss of spontaneous gene conversions, together with a ~3.5 fold increase in deletions in a rad51∆ mutant (Fig. 6a and see Supplementary Table S1). Similar levels of deletions are observed in both exo1∆ rad51∆ and rqh1∆ rad51∆ double mutants, but an exo1∆ rqh1∆ rad51∆ triple mutant exhibits a ~24 fold reduction in deletions (Fig. 6a and see Supplementary Table S1). This finding is consistent with the need for either Exo1 or Rqh1 to catalyse the extensive DNA resection required for SSA of the ade6⁻ repeats that are ~5 kb apart, and tallies with previous findings in both budding and fission yeast^12,39.

Similar to spontaneous recombination, Rad51 is also required for limiting deletions induced by gpII, but here the effect is even more striking with deletions increasing ~15 fold in a rad51∆ mutant compared to wild-type (Fig. 6b and see Supplementary Table S1). Unlike the spontaneous deletions in a rad51∆ mutant, the gpII-induced deletions are suppressed ~4 fold by deleting either exo1 or rqh1, and loss of both results in a further ~3 fold reduction (Fig. 6b and see Supplementary Table S1). Together these data indicate that the accuracy of repair of broken replication forks is greatly enhanced by Rad51, which prevents repair being channelled into error-prone mechanisms such as SSA, which likely depend on extensive DNA resection catalysed by Exo1 and Rqh1. Additionally, the heightened level of gpII-induced deletions in an exo1∆ rqh1∆ double mutant is mostly suppressed by rad51∆, suggesting that long-range DNA resection helps promote the accuracy of Rad51-mediated recombination (i.e. accurate sister chromatid recombination instead of ectopic recombination between DNA repeats).

UV-induced deletions and gene conversions depend on either Exo1 or Rqh1

To see whether Exo1 and/or Rqh1 are required for promoting and/or suppressing the formation of recombinants induced by other replication fork perturbing lesions, we measured direct repeat recombination following UV exposure in exo1∆ and rqh1∆ single and double mutants (Fig. 7). As both rqh1∆ single and exo1∆ rqh1∆ double mutants are far more sensitive to UV than either wild type or an exo1∆ single mutant, we chose UV doses that gave similar percentages of cell survival across the four strains (Fig. 7a). Interestingly we observed that the hyper-sensitivity to UV of a rqh1∆ mutant was partially suppressed by deleting exo1. UV strongly induces the frequency of both gene conversion (~22 fold at 160 J/m² UV) and deletions (~9 fold at 160 J/m² UV) in a wild-type strain (Fig. 7b and see Supplementary Table S2). In contrast to what happens with gpII, the frequency of UV-induced recombinants is not affected by deleting exo1, whereas deleting rqh1 results in a dramatic further increase in recombinants (~28 fold increase in gene conversions and ~19 fold increase in deletions at 40 J/m² UV) (Fig. 7b and see Supplementary Table S2). Strikingly, in an exo1∆ rqh1∆ double mutant there was very little or no induction of recombinants by UV (Fig. 7b and see Supplementary Table S2). These data suggest that DNA resection is necessary for UV-induction of both gene conversions and deletions, including the very high level of recombinants in a rqh1∆ mutant.

**Figure 7: UV-induced direct repeat recombination in *exo1*∆ and *rqh1*∆ single and double mutants.**

Exo1 promotes the formation of gene conversions and deletions induced by replication fork blockage at RTS1

As a final comparison to gpII-induced recombination, we analysed what effect exo1∆ and rqh1∆ have on direct repeat recombination induced by the protein-DNA replication fork barrier RTS1. Replication fork blockage at RTS1 results in fork collapse without DNA breakage, followed by the recruitment of recombination proteins within ~10 minutes that restart replication^35,40. Using strains in which RTS1 is positioned at the same site between the ade6⁻ heteroalleles as the gpII cleavage site (Fig. 8a), we found that loss of exo1 results in a reduction in both gene conversions (~3 fold) and deletions (~2 fold) compared to wild-type (Fig. 8b and see Supplementary Table S3). As shown previously, and similar to spontaneous recombination, a rqh1∆ mutant exhibits a modest (~1.7 fold) increase in gene conversions and a large (~25 fold) increase in deletions (Fig. 8b and see Supplementary Table S3)^33,34. Exo1 is required for most of the deletions (~90%) and gene conversions (~84%) in an rqh1∆ mutant (Fig. 8b and see Supplementary Table S3).

**Figure 8: *RTS1*-induced direct repeat recombination in *exo1*∆ and *rqh1*∆ single and double mutants.**

Discussion

There are four main findings in this study: 1) Exo1 and Rqh1 play overlapping roles in the repair of replication-associated DSBs; 2) Depending on the context, Exo1 can either promote or limit direct repeat recombination; 3) In the absence of Exo1, Rqh1 promotes UV-induced direct repeat recombination; and 4) Rqh1, whilst playing a major role in limiting Exo1-dependent spontaneous, UV-induced, and RTS1-induced direct repeat recombination, has at best only a minor role in constraining recombination induced by a broken replication fork. These findings are discussed below.

Based on the known activities of Exo1 and Rqh1 in catalysing DNA resection, we suspect that the strong synergistic increase in sensitivity of an exo1∆ rqh1∆ double mutant, to conditions that generate SSBs, reflects an important role for long-range resection in repairing broken replication forks. Why IR-induced DSBs fail to elicit the same synergistic response is unclear. One possibility is that the importance of long-range resection is masked by another vital role that Rqh1 plays, such as the dissolution of double Holliday junctions²³. Indeed, a rqh1∆ single mutant is already hypersensitive to IR, and further disablement of long-range resection may not appreciably add to its sensitivity. In fact in the case of UV-induced damage, loss of Exo1 appears to slightly suppress rqh1∆ sensitivity (Fig. 7A), which could be explained if long-range resection results in more Holliday junctions that have to be processed by Rqh1.

Alternatively, the method of delivery of IR might underlie the lack of synergistic enhancement in sensitivity in an exo1∆ rqh1∆ double mutant. In our experiments IR is given as an acute dose to an asynchronously growing culture and, therefore, ~90% of the cells experience the DNA damage outside of S-phase and likely repair it before replication starts. In contrast, CPT is delivered as a chronic dose and, therefore, every cell will be exposed to unrepaired SSBs during each S-phase. Interestingly, even in budding yeast, where an increase in sensitivity to IR is observed for an exo1∆ sgs1∆ double mutant⁴¹, the loss of long-range resection reduces the efficiency of gene conversion during DSB repair by only 30–50% in vegetative cells^12,13. Why the repair of IR-induced DSBs, made predominantly outside of S-phase, might be less dependent on long-range resection than replication-associated DSBs is unclear. It has been proposed that one of the main benefits of long-range resection is to promote accurate recombinational repair of DSBs, which it does by providing a longer ssDNA tail for Rad51 to use for its homology search¹³. Without this resection only short ssDNA tails would be produced, and these would be more liable to undergo recombination with short repetitive DNA elements at ectopic sites. It is conceivable that the accuracy of recombination could be more critical when restarting replication than it is for repairing a DSB. The reason is that restarted replication can proceed until it encounters an opposing replication fork^35,42 and, therefore, if initiated by strand invasion at an ectopic site, a genomic rearrangement will be inevitable. In contrast, DSB repair in G2 phase cells occurs mainly by SDSA, which is terminated when the invading strand is unwound and anneals to the other end of the break³. As such, SDSA would be less prone to generating major genome rearrangements, even when the initial strand invasion occurs at an ectopic site.

Whilst long-range resection might promote the fidelity of DSB repair, it could also encourage ectopic recombination by exposing repetitive DNA elements that reside further from a DSB or collapsed replication fork¹³ (see Supplementary Fig. S2). In our study we used direct repeats that are ~5 kb apart (or ~6 kb with RTS1) to measure the frequency of ectopic recombination. In the case of spontaneous direct repeat recombination, the loss of both Exo1 and Rqh1 has relatively little effect on the frequency of both gene conversions and deletions. However, the hyper-recombination seen in a rqh1∆ mutant depends on Exo1. The implication is that spontaneous direct repeat recombination is promoted by long-range resection but at the same time is limited by the action of Rqh1, possibly by means of its putative ability to disrupt D-loops or process double Holliday junctions^23,43 (see Supplementary Fig. S2). The same appears to be true for RTS1-induced recombination, however, in this case, deletion of just exo1 is sufficient to reduce the frequency of recombinants by ~50%, consistent with a previous study⁴⁴. Moreover, no further reduction is seen in an exo1∆ rqh1∆ double mutant, suggesting that long-range resection is not essential for direct repeat recombination. However, it is possible that the true impact of losing long-range resection is masked by the loss of Rqh1’s anti-recombinogenic activity.

In contrast to spontaneous and RTS1-induced recombination, Exo1 appears to be needed to limit gpII-induced direct repeat recombination. As the gpII cleavage site is immediately adjacent to the ade6-M375 allele in the direct repeat, short-range resection would be sufficient to expose the DNA repeat for binding and recombination by Rad51, whereas long-range resection would likely extend beyond the repeat into unique DNA sequence and thereby help promote accurate sister chromatid recombination. Alternatively, Exo1 could directly promote repair of a gpII-induced nick through its ability to initiate DNA degradation from a SSB⁴⁵, and thereby prevent replication fork breakage and recombination from occurring. However, we think that this is unlikely given that members of the RAD2 nuclease family are impeded by chemical modification or protein attachment to the 5′ DNA end⁴⁶. Therefore it is likely that gpII’s covalent attachment to the 5′ DNA end would block Exo1 from directly processing the SSB.

In the absence of Rad51, spontaneous recombination is shunted into the Rad52-dependent SSA pathway that generates deletions³⁸. These deletions depend on either Rqh1 or Exo1, consistent with the proposal that they are formed by SSA, which has been shown to depend on long-range resection in budding yeast¹². Similar to DSB repair by SSA in budding yeast, either Exo1 or Rqh1 is sufficient to deliver rad51∆ mutant levels of deletions when the DNA repeats are ~5 kb apart. However, the same is not true for the very high level of gpII-induced deletions in a rad51∆ mutant, which are reduced ~4-fold by deleting either exo1 or rqh1. Why neither Exo1 nor Rqh1 is sufficient on its own to deliver the full rad51∆ mutant level of deletions under these conditions is unclear, but a similar lack of complete redundancy has been observed in budding yeast¹².

Unlike spontaneous, gpII-induced and RTS1-induced recombination, UV-induced direct repeat recombination is abolished in an exo1∆ rqh1∆ double mutant, which suggests that DNA resection is required to convert UV-induced lesions into recombinogenic lesions. It has long been established that UV induces recombination, however the nature of the actual recombinogenic lesion is still debated⁴⁷. The principle lesions induced by UV-C (~254 nm) are pyrimidine dimers, and in S. pombe these are removed either by nucleotide excision repair (NER) or by an alternative excision repair mechanism dependent on the Uve1 endonuclease⁴⁸. In budding yeast UV lesions were thought to be recombinogenic only in actively dividing cells⁴⁹, consistent with the notion that replication fork blockage by an unrepaired pyrimidine dimer, or fork breakage through encounter with a single-strand DNA gap made during excision repair, is responsible for the stimulus in recombination⁵⁰. However, more recent work, studying allelic recombination in diploid budding yeast, has lead to the proposal that at high UV doses (≥15 J/m²) a significant portion of UV-induced recombinants stem from Exo1-dependent extension of two nearby single-strand gaps, made by NER on opposite DNA strands, so that they overlap and form a DSB^47,51. Our finding that UV-induced direct repeat recombination in fission yeast depends on either Exo1 or Rqh1 could be explained by the same mechanism. However, there are other possibilities, for example studies in human, Xenopus and yeast indicate that activation of the checkpoint kinase ATR depends in part on its recruitment to ssDNA by its partner protein ATRIP interacting with the ssDNA binding protein RPA^52,53. We have shown previously that the intra-S-phase checkpoint is essential for the production of UV-induced recombinants⁵⁴, and therefore it is conceivable that DNA resection is needed to activate and/or maintain the checkpoint, which in turn promotes recombination.

Another finding from our study is that Rqh1 plays little or no role in constraining gpII-induced direct repeat recombination. A contrast with its prominent role in limiting RTS1-induced recombination, and the role of other RecQ-type helicases in suppressing recombination following replication fork perturbation^22,33,55. One way that Rqh1 could selectively limit direct repeat recombination at a stalled fork, but not a broken fork, is by preventing the stalled fork from becoming broken³³. Alternatively Rqh1 could modulate regression of the stalled replication fork. Fork regression involves re-annealing of the template DNA strands and extrusion of a new DNA arm formed by the annealing of the nascent strands, which can act as a recombinogenic substrate⁵⁶. A common ability of RecQ-type helicases is catalysis of fork regression, and at least in the case of human RECQL1 the reverse reaction of fork restoration is also promoted⁵⁷. In theory either fork regression or restoration could limit direct repeat recombination at RTS1. The former could extend the region behind the barrier that is bound by Rad51, thereby allowing DNA beyond the repeat to be used in the homology search, which in turn would promote more accurate sister chromatid recombination. Similarly, limiting fork regression by catalysing restoration could prevent the spread of Rad51 behind RTS1 onto the DNA repeat, which in this case would also promote accurate sister chromatid recombination.

Conclusion

We have highlighted how long-range resection may be especially important for the repair of broken replication forks in fission yeast and documented how it might promote faithful repair by limiting Rad51-mediated recombination between ectopic sites. We have also shown that Rqh1 limits Exo1-dependent ectopic recombination at stalled but not broken replication forks. In future work it will be important to determine whether the repair of replication-associated DSBs is truly more reliant on long-range resection than IR-induced DSBs, and exactly how Rqh1 limits direct repeat recombination.

Methods

Strains, plasmids and probes

S. pombe strains are listed in Supplementary Table S4. The gpII nickase site containing strains were made by targeted integration of BlpI linearised derivatives of pFOX2⁵⁸ (see below) at ade6-M375 in FO126 or FO1236. Southern blotting and diagnostic PCRs were used to determine that the linear plasmid had integrated at the correct site. The top strand nick site-containing derivative, pJS33, was constructed by inserting SmaI - SalI digested annealed oligonucleotides containing the nick site, oMW482 (5′-TTTAAACCCGGGCTCGAGGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACAGTCGACTTTAAA-3′) and oMW483 (5′-TTTAAAGTCGACTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACCTCGAGCCCGGGTTTAAA-3′), into the EcoRV - SalI sites of pFOX2. The bottom strand nick site-containing derivative, pJS34, was similarly constructed using oMW480 (5′-TTTAAAGTCGACCTCGAGGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACCCGGGTTTAAA-3′) and oMW481 (5′- TTTAAACCCGGGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACCTCGAGGTCGACTTTAAA-3′). pREP1-NLS-gpII was constructed by PCR amplification of the gpII gene from pK125³¹ using primers oMW409 (5′-TTTTTCCATATGGGAAGTCCTAAGAAGAAACGAAAGGTGATGATTGACAT GCTAGTTTTAC- 3′) and oMW410 (5′- TTGGATCCTTATGCGATTTTAAGAACTG- 3′), which were designed to introduce a nuclear localisation signal (NLS) and NdeI site at its 5′-end and a BamHI site at its 3′-end. The restriction sites were used to facilitate cloning into pREP1. pREP81-NLS-gpII was derived from pREP1-NLS-gpII by subcloning. All plasmids were sequenced to confirm that no mutations had been introduced during the cloning. Probes A and B have been described previously³³, and probe E is a 915 bp BlpI - NdeI fragment from pFOX2.

Media and genetic methods

Standard protocols were used for the growth and genetic manipulation of S. pombe⁵⁹. The complete and minimal media were yeast extract with supplements (YES) and Edinburgh minimal medium plus 3.7 mg/ml sodium glutamate (EMMG) and appropriate amino acids (0.25 mg/ml), respectively. Ade⁺ recombinants were selected on YES lacking adenine and supplemented with 0.2 mg/ml guanine to prevent uptake of residual adenine. Crosses were performed on malt extract (ME) agar with the required amino acids (concentration 50 μg/ml). Determination of spore viability by random spore analysis has been described previously²⁷.

Spot assays

Cells growing exponentially in YES at 30 °C were harvested, washed, counted using a haemocytometer, and resuspended in water at a density of 1 × 10⁷ cells/ml. Suspensions were serially diluted in 10-fold steps to 1 × 10³ cells/ml, and 10 μl aliquots of each dilution were then spotted onto YES plates with and without genotoxins as indicated. For the spot assay in Fig. 2b, alternating dilutions of 2-fold and 5-fold were used between spots. For ultraviolet light (UV) and ionising radiation (IR), plates were irradiated using a Stratalinker (Stratagene) and a Cesium source, respectively, after spotting. Plates were photographed after 4–5 days incubation at 30 °C. All spot assays were repeated at least once to ensure that results were reproducible.

S. pombe genomic DNA preparation and gel electrophoresis

Yeast cultures were grown in EMMG lacking leucine and thiamine at 30 °C, with aeration for 24 hours. Cells were then harvested, and genomic DNA prepared in 0.75% agarose plugs using a CHEF genomic DNA plug kit (Bio-Rad) according to the manufacturer’s instructions. DNA in plugs was digested over night at 37 °C with 40–100 units of restriction enzyme. Plugs were typically cut in half to allow loading onto neutral and alkaline gels in parallel. Neutral gels were 0.8% agarose and were run in 1× TBE at 60 V for ~16 hours. Alkaline gels were run as described⁶⁰ using a 50 mM NaOH 2 mM EDTA buffer system. All gels were Southern blotted and probed with ³²P-labelled probe as indicated. Blots were analysed by Phosphor Imaging using a Fuji FLA3000 and Image Gauge software.

Recombination assays

Mitotic recombination was assayed using strains containing a non-tandem direct repeat of ade6 heteroalleles flanking a functional his3 gene. Spontaneous, UV, gpII- and RTS1-induced Ade⁺ recombinant frequencies were measured as described previously⁵⁸. To select for plasmids and allow for expression of gpII, cells were grown on EMMG lacking leucine and thiamine for 6–7 days at 30 °C prior to assessing the frequency of Ade⁺ recombinants. Recombinant frequencies represent the mean value from at least 15 colonies for each strain, and for strains containing plasmids at least three independent transformants were tested. The meiotic recombination assay has been described previously²⁷. The statistical significance of differences between recombinant frequencies was calculated with two-sample t-tests.

Additional Information

How to cite this article: Osman, F. et al. The RecQ DNA helicase Rqh1 constrains Exonuclease 1-dependent recombination at stalled replication forks. Sci. Rep. 6, 22837; doi: 10.1038/srep22837 (2016).

References

San Filippo, J., Sung, P. & Klein, H. Mechanism of Eukaryotic Homologous Recombination. Annu. Rev. Biochem. 77, 229–257 (2008).
Article CAS PubMed Google Scholar
Yeeles, J. T., Poli, J., Marians, K. J. & Pasero, P. Rescuing stalled or damaged replication forks. Cold Spring Harb. Perspect. Biol. 5, a012815 (2013).
Article PubMed PubMed Central Google Scholar
Paques, F. & Haber, J. E. Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae . Microbiol. Mol. Biol. Rev. 63, 349–404 (1999).
CAS PubMed PubMed Central Google Scholar
Shibata, A. et al. DNA double-strand break repair pathway choice is directed by distinct MRE11 nuclease activities. Mol. Cell 53, 7–18 (2014).
Article CAS PubMed Google Scholar
Symington, L. S. & Gautier, J. Double-strand break end resection and repair pathway choice. Annu. Rev. Genet. 45, 247–271 (2011).
Article CAS PubMed Google Scholar
Garcia, V., Phelps, S. E., Gray, S. & Neale, M. J. Bidirectional resection of DNA double-strand breaks by Mre11 and Exo1. Nature 479, 241–244 (2011).
Article CAS ADS PubMed PubMed Central Google Scholar
Cejka, P. DNA End Resection: Nucleases Team Up with the Right Partners to Initiate Homologous Recombination. J. Biol. Chem. 290, 22931–22938 (2015).
Article CAS PubMed PubMed Central Google Scholar
Cannavo, E. & Cejka, P. Sae2 promotes dsDNA endonuclease activity within Mre11-Rad50-Xrs2 to resect DNA breaks. Nature 514, 122–125 (2014).
Article CAS ADS PubMed Google Scholar
Hartsuiker, E., Neale, M. J. & Carr, A. M. Distinct requirements for the Rad32 (Mre11) nuclease and Ctp1 (CtIP) in the removal of covalently bound topoisomerase I and II from DNA. Mol. Cell 33, 117–123 (2009).
Article CAS PubMed PubMed Central Google Scholar
Langerak, P., Mejia-Ramirez, E., Limbo, O. & Russell, P. Release of Ku and MRN from DNA ends by Mre11 nuclease activity and Ctp1 is required for homologous recombination repair of double-strand breaks. PLoS Genet. 7, e1002271 (2011).
Article CAS PubMed PubMed Central Google Scholar
Zakharyevich, K. et al. Temporally and biochemically distinct activities of Exo1 during meiosis: double-strand break resection and resolution of double Holliday junctions. Mol. Cell 40, 1001–1015 (2010).
Article CAS PubMed PubMed Central Google Scholar
Zhu, Z., Chung, W. H., Shim, E. Y., Lee, S. E. & Ira, G. Sgs1 helicase and two nucleases Dna2 and Exo1 resect DNA double-strand break ends. Cell 134, 981–994 (2008).
Article CAS PubMed PubMed Central Google Scholar
Chung, W. H., Zhu, Z., Papusha, A., Malkova, A. & Ira, G. Defective resection at DNA double-strand breaks leads to de novo telomere formation and enhances gene targeting. PLoS Genet 6, e1000948 (2010).
Article PubMed PubMed Central Google Scholar
Mimitou, E. P. & Symington, L. S. Sae2, Exo1 and Sgs1 collaborate in DNA double-strand break processing. Nature 455, 770–774 (2008).
Article CAS ADS PubMed Google Scholar
Gravel, S., Chapman, J. R., Magill, C. & Jackson, S. P. DNA helicases Sgs1 and BLM promote DNA double-strand break resection. Genes Dev. 22, 2767–2772 (2008).
Article CAS PubMed PubMed Central Google Scholar
Tran, P. T., Erdeniz, N., Dudley, S. & Liskay, R. M. Characterization of nuclease-dependent functions of Exo1p in Saccharomyces cerevisiae . DNA Repair (Amst) 1, 895–912 (2002).
Article CAS Google Scholar
Cejka, P. et al. DNA end resection by Dna2-Sgs1-RPA and its stimulation by Top3-Rmi1 and Mre11-Rad50-Xrs2. Nature 467, 112–116 (2010).
Article CAS ADS PubMed PubMed Central Google Scholar
Nimonkar, A. V. et al. BLM-DNA2-RPA-MRN and EXO1-BLM-RPA-MRN constitute two DNA end resection machineries for human DNA break repair. Genes Dev. 25, 350–362 (2011).
Article CAS PubMed PubMed Central Google Scholar
Sturzenegger, A. et al. DNA2 cooperates with the WRN and BLM RecQ helicases to mediate long-range DNA end resection in human cells. J. Biol. Chem. 289, 27314–27326 (2014).
Article CAS PubMed PubMed Central Google Scholar
Szankasi, P. & Smith, G. R. A role for exonuclease I from S. pombe in mutation avoidance and mismatch correction. Science 267, 1166–1169 (1995).
Article CAS ADS PubMed Google Scholar
Goellner, E. M., Putnam, C. D. & Kolodner, R. D. Exonuclease 1-dependent and independent mismatch repair. DNA Repair (Amst) 32, 24–32 (2015).
Article CAS Google Scholar
Sun, W. et al. The fission yeast FANCM ortholog Fml1 promotes recombination at stalled replication forks and limits crossing over during double-strand break repair. Mol. Cell 32, 118–128 (2008).
Article CAS PubMed PubMed Central Google Scholar
Bizard, A. H. & Hickson, I. D. The dissolution of double Holliday junctions. Cold Spring Harb. Perspect. Biol. 6, a016477 (2014).
Article PubMed PubMed Central Google Scholar
Ahmad, F., Kaplan, C. D. & Stewart, E. Helicase activity is only partially required for Schizosaccharomyces pombe Rqh1p function. Yeast 19, 1381–1398 (2002).
Article CAS PubMed Google Scholar
Pommier, Y. Topoisomerase I inhibitors: camptothecins and beyond. Nat. Rev. Cancer 6, 789–802 (2006).
Article CAS PubMed Google Scholar
Roseaulin, L. et al. Mus81 is essential for sister chromatid recombination at broken replication forks. EMBO J. 27, 1378–1387 (2008).
Article CAS PubMed PubMed Central Google Scholar
Lorenz, A. et al. The fission yeast FANCM ortholog directs non-crossover recombination during meiosis. Science 336, 1585–1588 (2012).
Article CAS ADS PubMed PubMed Central Google Scholar
Osman, F., Dixon, J., Doe, C. L. & Whitby, M. C. Generating crossovers by resolution of nicked Holliday junctions: a role for Mus81-Eme1 in meiosis. Mol. Cell 12, 761–774 (2003).
Article CAS PubMed Google Scholar
Lorenz, A., Mehats, A., Osman, F. & Whitby, M. C. Rad51/Dmc1 paralogs and mediators oppose DNA helicases to limit hybrid DNA formation and promote crossovers during meiotic recombination. Nucleic Acids Res. 42, 13723–13735 (2014).
Article CAS PubMed PubMed Central Google Scholar
Cromie, G. A., Hyppa, R. W. & Smith, G. R. The Fission Yeast BLM Homolog Rqh1 Promotes Meiotic Recombination. Genetics. 179, 1157–1167 (2008).
Article CAS PubMed PubMed Central Google Scholar
Kuzminov, A. Single-strand interruptions in replicating chromosomes cause double-strand breaks. Proc. Natl. Acad. Sci. USA 98, 8241–8246 (2001).
Article CAS ADS PubMed PubMed Central Google Scholar
Asano, S., Higashitani, A. & Horiuchi, K. Filamentous phage replication initiator protein gpII forms a covalent complex with the 5′ end of the nick it introduced. Nucleic Acids Res. 27, 1882–1889 (1999).
Article CAS PubMed PubMed Central Google Scholar
Ahn, J. S., Osman, F. & Whitby, M. C. Replication fork blockage by RTS1 at an ectopic site promotes recombination in fission yeast. EMBO J 24, 2011–2023 (2005).
Article CAS PubMed PubMed Central Google Scholar
Lorenz, A., Osman, F., Folkyte, V., Sofueva, S. & Whitby, M. C. Fbh1 Limits Rad51-dependent Recombination at Blocked Replication Forks. Mol. Cell. Biol. 29, 4742–4756 (2009).
Article CAS PubMed PubMed Central Google Scholar
Nguyen, M. O., Jalan, M., Morrow, C. A., Osman, F. & Whitby, M. C. Recombination occurs within minutes of replication blockage by RTS1 producing restarted forks that are prone to collapse. Elife 4, doi: 10.7554/eLife.04539 (2015).
Cortes-Ledesma, F. & Aguilera, A. Double-strand breaks arising by replication through a nick are repaired by cohesin-dependent sister-chromatid exchange. EMBO Rep. 7, 919–926 (2006).
Article CAS PubMed PubMed Central Google Scholar
Doe, C. L., Dixon, J., Osman, F. & Whitby, M. C. Partial suppression of the fission yeast rqh1(−) phenotype by expression of a bacterial Holliday junction resolvase. EMBO J. 19, 2751–2762 (2000).
Article CAS PubMed PubMed Central Google Scholar
Doe, C. L., Osman, F., Dixon, J. & Whitby, M. C. DNA repair by a Rad22-Mus81-dependent pathway that is independent of Rhp51. Nucleic Acids Res. 32, 5570–5581 (2004).
Article CAS PubMed PubMed Central Google Scholar
Sofueva, S. et al. Ultrafine anaphase bridges, broken DNA and illegitimate recombination induced by a replication fork barrier. Nucleic Acids Res. 39, 6568–6584 (2011).
Article CAS PubMed PubMed Central Google Scholar
Lambert, S. et al. Homologous recombination restarts blocked replication forks at the expense of genome rearrangements by template exchange. Mol. Cell 39, 346–359 (2010).
Article CAS PubMed Google Scholar
Mimitou, E. P. & Symington, L. S. Ku prevents Exo1 and Sgs1-dependent resection of DNA ends in the absence of a functional MRX complex or Sae2. EMBO J 29, 3358–3369 (2010).
Article CAS PubMed PubMed Central Google Scholar
Mayle, R. et al. Mus81 and converging forks limit the mutagenicity of replication fork breakage. Science 349, 742–747 (2015).
Article CAS PubMed PubMed Central Google Scholar
Bernstein, K. A., Gangloff, S. & Rothstein, R. The RecQ DNA helicases in DNA repair. Annu. Rev. Genet. 44, 393–417 (2010).
Article CAS PubMed PubMed Central Google Scholar
Tsang, E. et al. The extent of error-prone replication restart by homologous recombination is controlled by Exo1 and checkpoint proteins. J. Cell Sci. 127 (2014).
Szankasi, P. & Smith, G. R. A DNA exonuclease induced during meiosis of Schizosaccharomyces pombe . J. Biol. Chem. 267, 3014–3023 (1992).
CAS PubMed Google Scholar
Lee Bi, B. I., Nguyen, L. H., Barsky, D., Fernandes, M. & Wilson, D. M. 3rd . Molecular interactions of human Exo1 with DNA. Nucleic Acids Res. 30, 942–949 (2002).
Article PubMed PubMed Central Google Scholar
Yin, Y. & Petes, T. D. Genome-wide high-resolution mapping of UV-induced mitotic recombination events in Saccharomyces cerevisiae. PLoS Genet. 9, e1003894 (2013).
Article PubMed PubMed Central Google Scholar
Yonemasu, R. et al. Characterization of the alternative excision repair pathway of UV- damaged DNA in Schizosaccharomyces pombe . Nucleic Acids Res. 25, 1553–1558 (1997).
Article CAS PubMed PubMed Central Google Scholar
Galli, A. & Schiestl, R. H. Cell division transforms mutagenic lesions into deletion-recombinagenic lesions in yeast cells. Mutat. Res. 429, 13–26 (1999).
Article CAS PubMed Google Scholar
Aguilera, A., Chavez, S. & Malagon, F. Mitotic recombination in yeast: elements controlling its incidence. Yeast 16, 731–754 (2000).
Article CAS PubMed Google Scholar
Yin, Y. & Petes, T. D. The role of Exo1p exonuclease in DNA end resection to generate gene conversion tracts in Saccharomyces cerevisiae . Genetics 197, 1097–1109 (2014).
Article CAS PubMed PubMed Central Google Scholar
Zou, L. & Elledge, S. J. Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes. Science. 300, 1542–1548 (2003).
Article CAS ADS PubMed Google Scholar
Flynn, R. L. & Zou, L. ATR: a master conductor of cellular responses to DNA replication stress. Trends Biochem. Sci. 36, 133–140 (2011).
Article CAS PubMed Google Scholar
Osman, F., Tsaneva, I. R., Whitby, M. C. & Doe, C. L. UV Irradiation Causes the Loss of Viable Mitotic Recombinants in Schizosaccharomyces pombe Cells Lacking the G(2)/M DNA Damage Checkpoint. Genetics 160, 891–908 (2002).
CAS PubMed PubMed Central Google Scholar
Bachrati, C. Z. & Hickson, I. D. RecQ helicases: guardian angels of the DNA replication fork. Chromosoma. 117, 219–233 (2008).
Article CAS PubMed Google Scholar
Atkinson, J. & McGlynn, P. Replication fork reversal and the maintenance of genome stability. Nucleic Acids Res. 37, 3475–3492 (2009).
Article CAS PubMed PubMed Central Google Scholar
Croteau, D. L., Popuri, V., Opresko, P. L. & Bohr, V. A. Human RecQ helicases in DNA repair, recombination, and replication. Annu. Rev. Biochem. 83, 519–552 (2014).
Article CAS PubMed PubMed Central Google Scholar
Osman, F. & Whitby, M. C. Monitoring homologous recombination following replication fork perturbation in the fission yeast Schizosaccharomyces pombe . Methods Mol. Biol. 521, 535–552 (2009).
Article CAS PubMed Google Scholar
Moreno, S., Klar, A. & Nurse, P. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe . Methods Enzymol. 194, 795–823 (1991).
Article CAS PubMed Google Scholar
Sambrook, J., Fritsch, E. & Maniatis, T. Molecular cloning a laboratory manual. second edn, (Cold Spring Harbour Laboratory Press, 1989).

Download references

Acknowledgements

We thank Benoit Arcangioli, Andrei Kuzminov and Shao-Win Wang for providing strains/plasmids. This work was supported by grants 057586/Z/99/A and 090767/Z/09/Z from the Wellcome Trust.

Author information

Alexander Lorenz
Present address: Present address: Alexander Lorenz, Institute of Medical Sciences (IMS), University of Aberdeen, Foresterhill, Aberdeen AB25 2ZD, UK.,
Fekret Osman and Jong Sook Ahn: These authors contributed equally to this work.

Authors and Affiliations

Department of Biochemistry, University of Oxford, South Parks Road, Oxford, OX1 3QU, UK
Fekret Osman, Jong Sook Ahn, Alexander Lorenz & Matthew C. Whitby

Authors

Fekret Osman
View author publications
You can also search for this author in PubMed Google Scholar
Jong Sook Ahn
View author publications
You can also search for this author in PubMed Google Scholar
Alexander Lorenz
View author publications
You can also search for this author in PubMed Google Scholar
Matthew C. Whitby
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

F.O., J.S.A. and A.L. devised and performed the experiments; M.C.W. was responsible for overall coordination, devised experiments and wrote the manuscript; all authors reviewed and commented on the manuscript.

Corresponding author

Correspondence to Matthew C. Whitby.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Information (PDF 1670 kb)

Rights and permissions

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Reprints and permissions

About this article

Cite this article

Osman, F., Ahn, J., Lorenz, A. et al. The RecQ DNA helicase Rqh1 constrains Exonuclease 1-dependent recombination at stalled replication forks. Sci Rep 6, 22837 (2016). https://doi.org/10.1038/srep22837

Download citation

Received: 12 January 2016
Accepted: 22 February 2016
Published: 09 March 2016
DOI: https://doi.org/10.1038/srep22837

This article is cited by

Intragenic meiotic recombination in Schizosaccharomyces pombe is sensitive to environmental temperature changes
- Simon D. Brown
- Charlotte Audoynaud
- Alexander Lorenz
Chromosome Research (2020)
DNA sequence differences are determinants of meiotic recombination outcome
- Simon D. Brown
- Samantha J. Mpaulo
- Alexander Lorenz
Scientific Reports (2019)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.