Introduction

Adenoid ameloblastoma, also referred to as adenoid ameloblastoma with dentinoid, is a very rare epithelial odontogenic neoplasm. Adenoid ameloblastoma is locally infiltrative, with an aggressive clinical behavior and high recurrence rates after enucleation (approximately 70%)1,2,3. Approximately 40 cases have been published revealing a peak incidence in the 4th decade (range 25–52 years), slight female predominance, and similar demographics to ameloblastoma1,2. It tends to affect the mandible (64.7%) and it is usually characterized by a painless swelling2. Radiographically, at diagnosis the majority (~82%) of tumors have presented as radiolucent lesions, or with occasional radiopaque foci, ill-defined borders, and cortical perforation.

Histologically, adenoid ameloblastoma is characterized by the presence of epithelium resembling conventional ameloblastoma, with additional duct-like structures, epithelial whorls, and cribriform architecture1,2,3,4. Dentinoid deposits, clusters of clear cells, and ghost-cell keratinization may also be present1,2,4. Some of these features resemble ameloblastoma, and adenoid elements resemble adenomatoid odontogenic tumor1. On the basis of the microscopic similarities to ameloblastoma and adenomatoid odontogenic tumor, our group recently screened a convenience sample of adenoid ameloblastoma for BRAF p.Val600Glu and KRAS p.Gly12Val and p.Gly12Arg mutations4, which are hallmarks of ameloblastomas and adenomatoid odontogenic tumors, respectively5,6,7. All nine samples tested were wild-type for both these pathogenic mutations4.

Another histopathological differential diagnosis for adenoid ameloblastoma is dentinogenic ghost cell tumor, and aggressive cases may show overlapping microscopic features with odontogenic carcinoma with dentinoid, for which no clear distinguishing diagnostic criteria have been established1,2. Dentinogenic ghost cell tumors8,9, and odontogenic carcinoma with dentinoid10 harbor CTNNB1 (beta-catenin) exon 3 mutations, similar to other lesions rich in ghost cells such as calcifying odontogenic cysts11.

Given the absence in adenoid ameloblastoma of the signature mutations of adenomatoid odontogenic tumor and ameloblastoma and the presence of CTNNB1 mutation in other microscopic mimics of adenoid ameloblastomas, we assessed CTNNB1 gene mutations in adenoid ameloblastoma.

Materials and Methods

Ethical aspects

This study was approved by The Research Ethics Committee of Universidade Federal de Minas Gerais (protocol number CAAE/approval: 30556120.0.0000.5149/4.228.043) and followed the Declaration of Helsinki. A convenience sample of 16 formalin-fixed paraffin-embedded adenoid ameloblastoma from 14 adenoid ameloblastoma cases was obtained from oral pathology services from the authors’ institutions. From the initial convenience sample (n = 16), 5 cases could not be analyzed due to limited genomic DNA (gDNA) available or poor-quality chromatograms, leaving 11 samples from 9 cases for analysis. Three samples were derived from a single patient who developed 2 recurrent tumors with a 6 year-interval after surgical enucleation of the primary tumor. Hematoxylin-eosin-stained slides of all cases were examined following the criteria used by Loyola et al.1

DNA isolation and Sanger sequencing

gDNA was isolated from formalin-fixed paraffin-embedded (FFPE) samples using the QIAamp® DNA FFPE Tissue Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. A spectrophotometer (Nano-DropTM 2000; Thermo Fisher Scientific, Wilmington, DE, USA) was used to evaluate both the DNA concentration and quality.

Samples were screened by Sanger sequencing for CTNNB1 exon 3 mutations reported previously in the so-called ghost cell lesions and odontogenic carcinoma with dentinoid, which include the residues Asp32, Ser33, Gly34, Ser37, Thr41, and Ser458,9,10,11. Other codons within the amplicon were also inspected for mutations. PCR was performed using MyTaq HS Red Mix, 2x (Bioline Reagents, London, UK). Primers were designed to amplify exon 3 of the CTNNB1 gene using Primer3 (accessed at https://primer3.ut.ee/). The designed primers were F: 5′TTTGATGGAGTTGGACATGG3′ and R: 5′CAGGACTTGGGAGGTATCCA3′. M13 tails were added to the primers in order to facilitate the workflow and data analysis. Positive and negative controls were included in all reactions. Four of the cases included in the current study (cases #1-4) have previously been shown to harbor wild-type sequences for KRAS and BRAF4 mutations (Table 1). We further evaluated such mutations in the remaining cases included herein by using Sanger sequencing. The primers were F: 5′GGCCTGCTGAAAATGACTGAA3′ and R: 5′GGTCCTGCACCAGTAATATGC3′ for KRAS; and F: 5′TCATAATGCTTGCTCTGATAGGA3′ and R: 5′CCAAAAATTTAATCAGTGGA3′ for the BRAF gene.

Table 1 Clinical and molecular information of analysed adenoid ameloblastomas with dentinoid cases.
Full size table

PCR products were analyzed by electrophoresis and purified using ExoSAP‐IT™ PCR Product Cleanup Reagent (Applied Biosystems, Foster City, CA, USA). Bidirectional DNA sequencing was performed using Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and run on an ABI3130 DNA Analyzer (Applied Biosystems). The chromatograms were manually inspected in the SnapGene Viewer software (v. 5.3.2, from GSL Biotech; available at https://snapgene.com) using the reference sequence NM_001904.4 (CTNNB1), NM_004985.5 (KRAS), and NM_001354609.2 (BRAF) for comparison.

Immunohistochemistry

As the nuclear expression of beta-catenin is a surrogate marker for CTNNB1 exon 3 mutations, we also assessed the immunoexpression of beta-catenin in the cohort of adenoid ameloblastoma cases. 4 μm-thick sections of the FFPE samples were stained immunohistochemically using standard procedures as described elsewhere10,12. Immunohistochemistry was performed in all cases but one. Due to the limited amount of tissue, it was not possible to include Case #1.

Results

Microscopically, all samples showed epithelium resembling conventional ameloblastoma, duct-like spaces, and focal whorled cellular condensations reminiscent of morules (Fig. 1A–D), which are diagnostic criteria for this lesion. Clear cells were observed in all but one sample (Fig. 1B–D) and dentinoid matrix in 7/9 samples (Fig. 1E–G) (Table 1). Ghost cells (Fig. 1H) were observed in 4/9 cases (Table 1). Figure 1 shows the main histological findings. Table 1 summarizes the clinicopathological data and molecular status of each of the 11 samples from 9 patients included in the final analysis.

Fig. 1: Representative images of histopathological features of the included adenoid ameloblastoma cases.
figure 1

Cribriform arrangement of the ameloblastoma-like epithelial component, duct-like spaces, whirling or morules structures were observed in all cases (A–D). Clear-cell clusters (B–D) and dentinoid matrix deposits (E–G) were frequently observed. Ghost cells (H) were less often observed. Original magnification: A, C (10×); D, E, F (20×); B (30×); G, H (40×). Hematoxylin-eosin stains.

Full size image

Six of the 11 samples tested positive for CTNNB1 mutation, including the 3 samples of the primary and recurrent tumor from patient #6 that showed concordant molecular results (Table 1). Therefore, tumors of 4 of the 9 patients (44%) harbored exon 3 CTNNB1 mutation, specifically at codons 33 (c.98C > G; p.Ser33Cys), 34 (c.100G > A; p.Gly34Arg) and 37 (c.110C > T; p.Ser37Phe). Chromatograms illustrating the variety of mutations identified and a summary of molecular and clinical data of the analysed samples are shown in Fig. 2. Notably, ghost cells were present in 2/6 samples positive for CTNNB1 mutations, and, conversely, in two cases with ghost cells a wild-type sequence was found (Table 1). There were no microscopic differences between wild-type and CTNNB1 mutation-positive cases. None of the cases harbored either BRAF (p.Val600Glu) or KRAS (codon 12) mutations (Table 1).

Fig. 2: Chromatograms illustrating the CTNNB1 pathogenic mutations detected in adenoid ameloblastomas.
figure 2

p.Ser33Cys (c.98C > G), p.Gly34Arg (c.100G > A), and p.Ser37Phe (c.110C > T) (A, B, and C, respectively). A summary of the main clinical features and mutational status regarding the CTNNB1 gene is presented in D.

Full size image

Samples of all but one case (7/8) showed focal positive nuclear and diffuse cytoplasmic immunoexpression of beta-catenin, irrespective of mutational status (Fig. 4, Table 1). Case #9 showed only cytoplasmic expression.

Discussion

Since its first description in the literature under a variety of names, adenoid ameloblastoma has become accepted as a rare pattern of odontogenic tumor showing histopathologic features resembling ameloblastoma and adenomatoid odontogenic tumor1,3. Although its status is unclear, adenoid ameloblastoma has usually been regarded as a rare variant of ameloblastoma, mainly due to its histopathologic similarities, aggressiveness, and high recurrence rates (~70%) with conservative treatment1,2,3. However, our research group recently assessed the presence of BRAF p.Val600Glu, signature mutations for ameloblastomas, and all tested adenoid ameloblastoma samples showed wild-type status4. Additionally, we screened these samples for KRAS mutations, which occur in 70% of adenomatoid odontogenic tumors6,7. None of the samples showed KRAS p.Gly12Val/Arg mutations4. Herein, we screened additional samples for these mutations, and all revealed wild-type sequences. Taken together, these results point to a different genetic background in adenoid ameloblastoma, ameloblastoma, and adenomatoid odontogenic tumor.

A recent study reported SMO and FGFR2 mutations in a single case of adenoid ameloblastoma13. These mutations have previously been reported in some ameloblastomas12,14, but not all features required for definitive diagnosis as adenoid ameloblastoma were present in this case making interpretation difficult. The incidence of SMO mutations in ameloblastoma ranges from 13 to 39%, occurring in a mutually exclusive pattern with BRAF p.V600E and co-occuring with additional RAS family or FGFR2 mutations12,14,15. Sweeney et al.14 proposed site-specific BRAF and SMO mutations in mandible and maxilla, respectively, which was later supported in a larger cohort15. However, such site-specificity for these mutations has not been confirmed by other groups16,17,18.

Compared to calcifying odontogenic cysts and dentinogenic ghost cell tumors, the diagnosis of adenoid ameloblastoma can be based on the presence of the pseudo-glandular arrangements, epithelial whorls, and the cribriform architecture1,3. Additionally, lower recurrence rates are achieved in calcifying odontogenic cysts upon conservative treatment1,19. Regarding ghost cell odontogenic carcinoma, more abundant ghost cells along with the malignant phenotype exhibited by neoplastic epithelium differentiate adenoid ameloblastoma19.

Odontogenic carcinoma with dentinoid is a further poorly characterized odontogenic tumour with some microscopic overlap with adenoid ameloblastoma. It is a rare malignant, low-grade, odontogenic neoplasm that is histopathologically characterized by the presence of cords and sheets of eosinophilic, pale, or clear epithelial cells associated with dentinoid material and, less commonly, duct-like structures10,20. Variable atypia and perineural invasion are occasionally reported10. The lack of, or minimal epithelium resembling conventional ameloblastoma distinguish it from adenoid ameloblastoma20. Importantly, pathogenic mutations in CTNNB1 and APC genes, components of the Wnt-signaling pathway, have been reported in this tumor10.

It is interesting to note that duct-like structures were previously reported in odontogenic carcinoma with dentinoid10. Despite the variable degrees of pleomorphism and high proliferative index observed in odontogenic carcinoma with dentinoid when compared with adenoid ameloblastoma, both exhibit some histopathological similarities, such as dentinoid material and the presence of clear cells. This finding, together with the fact that both share the same molecular driver, could suggest that they represent the benign and malignant counterparts of the same tumor. It is also interesting to note that the diagnosis of odontogenic carcinoma with dentinoid is based primarily on histologic features, particularly neural involvement by the tumor, but to date, no cases have been reported to metastasize. Additional studies are necessary to clarify any possible relationship between these entities.

The molecular basis and pathogenesis of adenoid ameloblastoma remain poorly explored. Dentinoid material and sometimes ghost cell keratinization are features shared with calcifying odontogenic cysts, dentinogenic ghost cell tumors, ghost cell odontogenic carcinoma, and odontogenic carcinoma with dentinoid, for which CTNNB1 mutations have core importance11,21,22. We screened adenoid ameloblastomas for these gene mutations and report CTNNB1 mutations in 4 of 9 (44%) cases of adenoid ameloblastoma.

CTNNB1 exon 3 mutations occurred at codons 33, 34, and 37. CTNNB1 encodes the beta-catenin protein, an important downstream effector of Wnt signaling, and has been associated with the oncogenesis of different neoplasms23. CTNNB1 exon 3 encodes the N-terminal domain of beta-catenin, where regulatory residues (Asp32, Ser33, Gly34, Ser37, Thr41, and Ser45) are located. Notably, most CTNNB1 exon 3 hotspot mutations culminate in alterations in these regulatory residues (Fig. 3)23,24. It is generally accepted that Ser45 residue is phosphorylated by casein kinase-1 alpha (CK-1α), priming it for glycogen synthase kinase 3 beta (GSK-3β) phosphorylation of Thr41, Ser33, and Ser37 residues. Asp32 and Gly34 residues are required for the interaction of beta-catenin with the ubiquitin E3 ligase beta-transducin repeats containing proteins (β-TrCP)23,24. In addition, Leu46 mutations may affect the phosphorylation efficiency by CK-1α25. Overall, CTNNB1 hotspot mutations disrupt the activity of the beta-catenin destruction complex, leading to beta-catenin nuclear and cytoplasmatic accumulation (Fig. 3).

Fig. 3: Canonical Wnt/beta-catenin signaling pathway under influences of WT and mutated beta-catenin protein.
figure 3

The Wnt/beta-catenin signaling pathway regulates physiological processes including embryonic development, tissue homeostasis, and tissue regeneration. Disturbances in the Wnt/beta‐catenin pathway have been implicated as causes of several human neoplasms. We focused on the major pathway changes elicited by the wild-type and mutated CTNNB1 gene (upper and bottom panels, respectively), which encode for the beta-catenin protein. In the absence of Wnt ligands, cytoplasmic beta-catenin is phosphorylated by GSK-3beta and CK1α at N-terminal serine-threonine residues, leading to its destruction by the ubiquitin-proteasome pathway. Wnt binding to Frizzled and LRP cell-surface receptors prevents the phosphorylation-mediated degradation of the beta-catenin protein, thereby resulting in a significant increase in cytoplasmic levels of beta‐catenin. beta-catenin then translocates to the nucleus, where it can interact as a transcriptional coactivator with TCF/LEF, stimulating the expression of several nuclear targets. Hotspot mutations in the exon 3 (which encodes the N-terminal region of beta-catenin) affecting the phosphorylation/regulatory sites (amino acids Asp32, Ser33, Gly34, Ser37, Thr41, and Ser45) of the protein disrupts the phosphorylation-dependent ubiquitination (red arrows, bottom panel), then leading to beta-catenin accumulation and its protumorigenic effects. Exon 3 hotspot mutations of CTNNB1 are marked on the lollipop plot from cBioportal31,32.

Full size image

Aberrant beta-catenin accumulation signals dysregulation of cell proliferation and metabolism, leading to tumorigenic effects23,24. In line with this, beta-catenin nuclear immunoexpression was observed in all the mutation-positive cases, and in 3/4 of the wild-type cases (Fig. 4). Considering that most of the wild-type cases also exhibited nuclear beta-catenin accumulation, mutations affecting other components of the beta-catenin destruction complex (e.g. inactivating mutations in APC or Axin tumor suppressor proteins) or alternative pathways’ crosstalk activating the pathway cannot be excluded8,10,26.

Fig. 4: Beta-catenin immunoexpression in adenoid amelobastoma.
figure 4

The photomicrographs show the focal nuclear expression of beta-catenin in both wild-type (upper panel) and mutation-positive (bottom panel) adenoid ameloblastoma cases. A and B Case #2; C and D cases #5 and #8. Cases #3, #4, #6, and #7 are shown in E, F, G, and H, respectively.

Full size image

The 2017 WHO Classification of Head and Neck Tumors recognized three entities amongst the “ghost cell lesions family”: calcifying odontogenic cyst, dentinogenic ghost cell tumor, and ghost cell odontogenic carcinoma, all of which contain CTNNB1 mutations8,9,11,19. Additionally, ghost and clear cells are also observed in other tumors, including pilomatrixoma and adamantinomatous craniopharyngiomas, which also harbor CTNNB1 mutations together with additional genetic changes27,28,29. In the present study, CTNNB1 mutations were not restricted to cases containing ghost cells. Conversely, we did not detect mutations in some cases with ghost cells suggesting other changes may be required to develop this change.

Patient #6 of the present cohort had a primary tumor, originally diagnosed as adenomatoid odontogenic tumor, which was enucleated. The lesion recurred 6 years later and was considered a recurrence of adenomatoid odontogenic tumor. In the second recurrence, 6 years after the first recurrence, diagnosis was revised and the tumor was classified as adenoid ameloblastoma. Samples of the primary and recurrent tumors showed beta-catenin mutation p.Ser37Phe. The difficulties in reaching a final diagnosis illustrated by this case suggest that molecular assessment might be a helpful tool for challenging cases. As shown by our results, the presence of beta-catenin mutation would have favored the diagnosis of adenoid ameloblastoma, since such mutations do not occur in adenomatoid odontogenic tumors.

In summary, in the present study, we report for the first time the occurrence of CTNNB1 exon 3 mutations in adenoid ameloblastoma. The immunohistochemical nuclear expression of the beta-catenin suggests that this cellular pathway is activated in the tumor. This finding supports the new WHO classification of odontogenic tumours30 in classifying adenoid ameloblastoma as a separate entity from ameloblastoma and its subtypes but also raises the possibility of a relationship with odontogenic carcinoma with dentinoid and other ghost cell-containing odontogenic tumours.