Denaturing High Pressure Liquid Chromatography (DHPLC) for the Analysis of Somatic p53 Mutations

Denaturing high pressure liquid chromatography (DHPLC) is a relatively new technique, which uses heteroduplex formation between wild-type and mutated DNA strands to identify mutations. Heteroduplex molecules are separated from homoduplex molecules by ion-pair, reverse-phase liquid chromatography on a special column matrix with partial heat denaturation of the DNA strands (O'Donovan et al, 1998; Oefner et al, 1998). DHPLC is potentially a very useful method for the screening of a large number of samples for mutations. So far, it has mainly been used for the analysis of germline mutations in various inherited diseases for which a high degree of sensitivity has been reported (Gross et al, 1999; Holinski-Feder et al, 2001; O'Donovan et al, 1998). With respect to the analysis of somatic mutations in tumors, however, one potential drawback is that DHPLC requires that both wild-type and mutant DNA are present so that heteroduplexes can form. Ideally, these DNA molecules should be present in equal amounts. In actual tumor specimens this is often not the case, because non tumorous cells may be present in various amounts or the normal wild-type allele may be lost (LOH) in tumors with somatic mutations of tumor suppressor genes.

Here we report the use of the DHPLC technique for the analysis of somatic p53 mutations. We established the separation conditions for exons 5 thru 8 with known p53 mutations, determined the sensitivity for the detection of heteroduplex by dilution series of wild-type and mutant PCR products, and then analyzed 18 microdissected colorectal carcinomas for p53 mutations in exons 5 thru 8. DNA from specimens with known mutations in exons 5 thru 8 of p53 included seven breast carcinomas, two urothelial carcinomas, a DNA sample from a Li-Fraumeni patient and two cell lines (HT29 and MDA-MB-435S), and DNA from blood of an individual with a polymorphism in exon 6. DNA from these tumor samples were either from frozen or paraffin-embedded tumor tissue and consisted almost entirely of tumor cells obtained by touch preparation (Saitoh et al, 1994) or laser microdissection. The DNA was isolated using standard techniques. To establish the separation conditions, DHPLC analysis was performed after mixing the tumor samples and cell lines with wild-type DNA at a ratio of 2:1. The PCR reactions were performed in 25 μl of a reaction mixture consisting of 10 mm Tris-HCl (pH 8.3), 50 mm KCl, 1.0, 1.5, or 2.0 mm MgCl₂, 0.01% gelatin, and 200 mm dNTP 0.4 mm of each primer. After an initial denaturation step at 94° C for 4 minutes, 40 cycles were performed consisting of 30 seconds at 55° to 60° C and 30 seconds at 72° C, followed by a final extension of 7 minutes at 72° C. The primers were: exon 5 forward: atgtgttcacttgtgccctg; exon 5 revers: aaccagccctgtcgtctctc; exon 6 forward: agggtccccaggcctctgat; exon 6 revers: cacccttaacccctcctccc; exon 7 forward: ccaaggcgcactggcctcatc, exon 7 revers: cagaggctggggcacagcagg; exon 8 forward: ttccttactgcctcttgctt; exon 8 revers: tgtcctgcttgcttacctcg. Mutation analysis was essentially performed according to the method of Oefner and Underhill (1998) on an automated DHPLC analysis system (Transgenomic, Omaha, Nebraska). The PCR products were denatured for 4 minutes at 94° C and cooled to room temperature at a rate of 1° C/minute, and 3 to 15 μl of PCR products were applied to a preheated reverse phase column (DNA-Sep; Transgenomic). Elution of the DNA was performed in a linear acetonitrile gradient of buffers A and B. Buffer A consisted of 0.1 M triethylammonium acetate (TEAA) and buffer B of 0.1M TEAA and 25% acetonitrile. The temperature for optimal resolution of heteroduplex and homoduplex DNA detection was determined by analyzing the melting behavior of a PCR fragment of each exon while the temperature was increased by 1° C increments from 50° C to 55° C until the fragment was completely melted. The analysis temperature for each fragment was the point at which 75% of the DNA was present as an alpha helix or 1° to 2° C higher. The experimental melting behavior of the DNA fragments was compared with the melting behavior calculated by the Wavemaker software (Transgenomic) included with the DHPLC analysis system. This computer analysis was included in the interpretation of separate melting domains in the analyzed fragments. Fragments with more than one melting domain were analyzed at additional temperatures. The separation conditions used for each exon are listed in Table 1.

Table 1 DHPLC Conditions for Exons 5–8 of the p53 Gene

The DHPLC conditions established for p53 exons 5 thru 8 detected all 10 of the previously characterized sequence variations in exons 5 thru 8 in a blinded analysis (Table 2). In addition, the DNA of the cell lines and of the blood showed aberrant DHPLC patterns in the corresponding exons.

Table 2 Mutations and Polymorphisms Identified by the Established DHPLC Conditions

The sensitivity for heteroduplex detection in the presence of various ratios of mutant and wild-type fragments was determined by DNA dilution series of up to 1% using a common polymorphism in exon 6 of the p53 gene and with DNA of the HT29 cell line, which has an exon 8 mutation (G>A, codon 273). A slightly or clearly aberrant pattern was detected when the amount of one allele was 10% or 20%, respectively, in the case of HT29. In the case of the polymorphism in exon 6, a clear aberrant pattern was detected when the amount was ≥10%. This showed that heteroduplexes can be detected in the presences of 5% to 10% wild-type cells (two alleles/cell) when analyzing a tumor cell population for mutation of a tumor suppressor gene with simultaneous loss of the wild-type allele. Ten percent of normal cells are nearly always present, even when tumor samples are obtained by laser microdissection, making mixing with wild-type DNA unnecessary under most conditions. On the other hand this means that a heterozygous mutation (one normal and one mutated allele/cell) would be detectable in a background of 60% to 80% of normal cells (two normal alleles/cell). Others have reported a high degree of sensitivity for the detection of variant alleles comprising up to 5% of the analyzed DNA (Wolford et al, 2000).

We then analyzed 18 colorectal carcinomas, in which the p53 mutation status was not known, for mutations in exons 5 thru 8. DNA from these samples was isolated from formalin-fixed, paraffin-embedded specimens after manual microdissection to give a tumor cell content in the range of 60% to 80%. Samples with an aberrant DHPLC pattern were directly sequenced. We identified 10 mutations in nine carcinomas. Exons 5 thru 8, from the samples of the remaining nine carcinomas with normal DHPLC patterns, were also directly sequenced and one mutation was found. We analyzed this PCR fragment under additional separation conditions using various temperatures, but no aberrant DHPLC pattern was detected. Taken the analysis of the samples with the known p53 mutations and the analysis of the colorectal carcinomas together, the DHPLC conditions used detected a total of 19 different mutations and one known exon 6 polymorphism (Table 2). Examples are shown in Figure 1. Out of the 124 PCR fragments that were analyzed, seven DHPLC patterns were judged as suspicious aberrant and no mutation was identified by sequencing. Thus, the overall sensitivity and specificity of our method, used for the detection of p53 mutations in exons 5 thru 8, was in the range of 95%. Although DHPLC was recently reported for the detection of p53 mutations in ovarian tumors, DNA sequencing of the tumors that did not show an aberrant DHPLC pattern was not described (Gross et al, 2001). Comparison of sequencing and DHPLC results for other genes has revealed sensitivities for mutation detection ranging from 95% to 100% (Holinski-Feder et al, 2001; Jones et al, 1999; O'Donovan et al, 1998). Other prescreening methods, such as single strand conformation polymorphism (SSCP) or denaturing gradient gel electrophoresis (DGGE), have also been widely used for mutation analysis, including for p53. However, these techniques are characterized by a lower sensitivity (Hayashi and Yandell, 1993) and are also more labor intensive. Furthermore, the ability of DHPLC to detect mutant alleles, over a broad range of differing wild-type allele concentrations, also makes this method well suited for the analysis of somatic mutations in tissue tumor samples in which the proportion of mutant and wild-type alleles is variable.

Figure 1

Examples of an aberrant denaturing high performance liquid chromatography (DHPLC) chromatogram in comparison with the wild type. A, G>T, −1, 5′, exon 5; B, G>A codon 248, exon 7.

mu, mutated; wt, wild type.