Introduction

Diarrheal diseases are the second major cause of mortality among children under five years of age1. Nearly 500,000 children aged under five years including about 50,000 neonates die annually due to diarrheal diseases1,2,3. Every year an estimated 2 billion cases of diarrhea occur among children globally1,2,3,4.

Diarrheagenic bacteria significantly contributes to the etiology of gastroenteritis among children2,3,4. The proportionate incidence of different bacterial pathogens may vary in different geographical regions. However, prevalence of V.cholerae, Shigella spp., enterotoxigenic E. coli, and Salmonella spp. are consistently documented globally1,2,3,4,5,6.

Every year about 35,000 deaths are reported among children with diarrheal diseases in Bangladesh3,4,5,6,7. However, due to lack of strong surveillance and health system majority of the cases remains unreported in Bangladesh. In less than 5% of cases the pathogen is accurately investigated and identified3. Improper diagnosis leads to inappropriate use of antibiotics against diarrheal diseases in Bangladesh3,8,9.

The selection pressure of antimicrobial resistance strains has been increased and effectiveness of antimicrobials have decreased due to abuse of antibiotics10,11. Further, horizontal transfer of resistance genes within different bacterial pathogens have contributed to origin and dissemination of multidrug resistance (MDR) phenomenon and strains with extended-spectrum β-lactamases (ESBL) in environment, animals and humans10,11,12,13. Antibiotic-resistant bacteria have been found all over the world in common bacterial illnesses including diarrhea13. Unfortunately, majority of the bacterial pathogens associated with diarrhea haven been found developing antimicrobial resistance worldwide13,14,15,16,17,18,19. Recent studies in Bangladesh have reported increased incidence of multi-drug resistance E coli, Salmonella spp. and Shigella spp. in different human and environmental samples. The prevalence of diarrheagenic bacteria is high among children in Bangladesh3,13,14,15. Multidrug resistance bacterial pathogens in children can contribute to prolonged hospitalization and treatment failure13,14,15. Being a major health threat, antibiotic resistance leads to higher medical costs, prolonged hospital stays, increased morbidity and increased mortality13,14. Presence of antimicrobial and multidrug resistance bacterial infection can add to the existing health burden of diarrheal diseases in Bangladesh. However, studies on the multidrug resistance profiling of these major diarrheal pathogens in Bangladesh are not enough, which is a major public health concern.

Integrated study on the epidemiology, antibiotic resistance profiling and determining the association between phenotypic and genotypic resistance of bacterial pathogens isolated from children with diarrhea are lacking. The main aim of this study was to investigate the molecular epidemiology of bacterial pathogens associated with diarrheal diseases among children in Bangladesh. Further, this study was conducted to evaluate the prevalence of antimicrobial resistance and multidrug resistance properties of bacterial isolates among diarrheal children, their molecular markers and association of genotypic and phenotypic resistance of pathogens.

Results

Demographic characteristics of the pediatric patients

The ratio of male to female children was 2:1 (62% and 38%, respectively). About 43% (173 of 404) of the children with diarrhea aged below 12 months. Majority of the patients (80%) were from village areas. Nearly 90% (362 of 404) of the pediatric patients with diarrhea required hospitalization and 24% (98 of 404) showed prolonged infection for ≥ 6 days. Antibiotics were used in treatment of 95.5% of the children with diarrhea (Table 1).

Table 1 Risk of infection by different diarrheal pathogens among children according to their demographic conditions.
Full size table

Prevalence of bacterial pathogens among children

Nearly 63% (251 of 404) fecal specimens were tested positive for bacterial pathogens. Among bacterial pathogens detected, E. coli was the most prevalent (29.2%, 117 of 404) followed by Shigella spp. (17%, 68 of 404), V. cholerae (13.2%, 53 of 404), and Salmonella spp. (5.5%, 22 of 404), respectively (Supplementary Fig. i). We found a seasonal peak for infection of bacterial pathogens during May and August for 2019, 2020 and 2021 (Supplementary Fig. ii).

Analysis of mixed infection in children

The most prevalent mixed infection of children was caused by rotavirus and E. coli (15%, 60 of 404), followed by V. cholerae and Shigella spp. (7.7%, 31 of 404), (Table 2). Rotavirus was the major co-infecting virus (Supplementary Fig. iii). Co-infection with two pathogens was most prevalent (31%, 127 of 404) followed by three pathogens (12%, 48 of 404) and four pathogens (8%, 32 of 404), respectively.

Table 2 Risk analysis for disease outcome among children infected with mono-pathogens and co-pathogens of diarrhea.
Full size table

Risk of infections by bacteria and viruses among children

Male patient had a higher risk of bacterial [OR 1.85 (95% CI 0.97–2.64) (p = 0.0001)], viral [OR 1.54 (95% CI 0.84–1.9) (p = 0.01)] and mixed infection [OR 1.86 (95% CI 0.72–2.9) (p = 0.003)] than female patients. Children in all age groups were more susceptible to infection of virus than bacteria or mixed infection. The odds ratio of infection by virus was the highest [OR 5.85 (95% CI 2.3–7.42) (p = 0.005)] in children aged 1–3 months followed by 4-11 months [OR 3.59 (95% CI 1.85–4.98) (p = 0.003)]. The risk of bacterial infection was also higher in children aged 1–3 months [OR 2.3 (95% CI (0.9–2.8) (p = 0.01)] followed by 24–35 months [OR 2.1 (95% CI 0.9–3.4) (p = 0.001)]. However, the risk of mixed infection was the highest [OR 1.89 (95% CI 0.22–2.95) (p = 0.005)] in children aged above 60 months (Table 1). The risks of infection by different pathogens among the hospitalized children were also analyzed. Children hospitalized for ≥ 6 days had higher risk of bacterial infection [OR 3.87 (95% CI 1.65–5.74) (p = 0.001)] and co-infection [OR 4.5 (95% CI 2.8–7.55) (p = 0.005)] (Table 1).

Clinical features associated with diarrheal diseases

Diarrhea (87%, 351 of 404) was most common followed by abdominal pain (82%, 331 of 404), vomiting (73%, 295 of 404), dehydration (68%, 274 of 404) and fever (59%, 238 of 404) among the pediatric patients. Among the children infected with E. coli, diarrhea (74%) was the most common symptoms followed by fever (65%), (Supplementary Fig. iv). Similarly, among children with V. choleare infection, abdominal pain (76%) was the most prevalent symptom. Apparently, the most common duration of diarrhea was 5 days among children infected with E. coli (Supplementary Fig. v).

Association of coinfection with health outcomes among patients with diarrhea

The risk of diarrhea was the highest among the patients co-infected with E. coli and rotavirus [OR 3.6 (95% CI 1.1–5.4) (p = 0.001)] followed by Shigella spp. and rotavirus [OR 3.5 (95% CI 0.5–5.3) (p = 0.001)], and triple infection of E. coli, rotavirus and norovirus [OR 3.5 (95% CI 1.3–6.8) (p = 0.002)], respectively (Table 2). The risk of vomiting was the highest in children with co-infection of E. coli and norovirus [OR 3.8 (95% CI 1.6–5.4) (p = 0.0003)]. In mono-infection, children with infection of V. cholerae had higher risk of diarrhea [OR 2.5 (95% CI 1.1–4.6) (p = 0.005)] and fever [OR 1.8 (95% CI 0.9–3.2) (p = 0.01)] (Table 2).

Frequency of antimicrobial resistance of bacterial pathogens

Among the isolates of E. coli, the highest frequency of resistance was detected against ceftriaxone (79%) and erythromycin (79%) followed by norfloxacin (62%), ciprofloxacin (58%), and tetracycline (52%), respectively. On the contrary, most of the isolates of E. coli (70%) were sensitive against imipenem followed by colistin (53%) (Table 3). Isolates of V. cholerae showed highest resistance against erythromycin (81%). Similar to E coli, V. cholerae showed the highest sensitivity against imipenem (64%) and colistin (59%). Most of the isolates of Salmonella spp. showed resistance against erythromycin (86%) and ceftriaxone (77%). Besides colistin, isolates of Salmonella spp. showed high frequency of sensitivity against meropenem (59%) and imipenem (Table 3). Majority of the isolates of Shigella spp. showed resistance against ceftriaxone (88%), erythromycin (76%), and norfloxacin (72%). Isolates of E. coli (16%, 19 of 117), V. cholerae (19%, 10 of 53) and Shigella spp. (13%, 9 of 68) showed multidrug resistance against antibiotics of cephem (ceftriaxone), macrolides (erythromycin), quinolones (norfloxacin) and phenicol (chloramphenicol) (Fig. 1). Single resistance was most prevalent among the isolates of E. coli (46%), V. cholerae (39%) Salmonella spp. (46%) and Shigella spp. (44%) (Fig. 1). About 22–31% of the isolates of bacterial pathogens showed resistance against three or more groups of antibiotics (Fig. 1).

Table 3 Antimicrobial resistance profiling of isolates of bacterial pathogens detected from children with diarrhea.
Full size table
Figure 1
figure 1

Proportionate percentage of single, double, triple, quadruple and quintuple resistance isolates of (a) Escherichia coli, (b) Vibrio cholerae, (c) Salmonella spp. and (d) Shigella spp.

Full size image

Association of phenotypic resistance with genotypic resistance elements

We detected resistance genes against quinolones (qnr genes), β-Lactams (blaTEM), folate pathway antagonist (Cotrimoxazole-sxt genes), tetracycline (tet genes) and colistin (mcr genes). Genetic resistance elements against ciprofloxacin, cotrimoxazole and colistin were found in lower frequency among the isolates of E. coli (6–11%), V. cholerae (7–13%), Salmonella spp. (9–14%) and Shigella spp. (9–15%) (Table 4 and Supplementary Fig. vi). Among the isolates of E. coli, V. cholerae, and Salmonella spp. the highest frequency of resistance genes was found against β-Lactams (36%, 42 of 117; 36%, 19 of 53; 45%, 10 of 22, respectively) followed by tetracyclines (18%, 21 of 117; 20%, 11 of 53; 27%, 6 of 22, respectively).

Table 4 Association of phenotypic and genotypic resistance of bacterial pathogens isolated from pediatric patients with diarrhea.
Full size table

Significant association was found between the phenotypic resistance and genotypic elements among the isolates of V. cholerae (p = 0.005), and Salmonella spp. (p = 0.0004) against ciprofloxacin. Among the isolates of E. coli (p = 0.001), Salmonella spp. (p = 0.03) and Shigella spp. (p = 0.01) we found significant association between the phenotypic resistance and genotypic elements against ceftriaxone. Further, presence of the gene mcr-1 was significantly associated with the resistance properties of isolates of V. cholerae (p = 0.008) and Shigella spp. (p = 0.003) against colistin. In addition, the presence of sxt gene among the isolates of E. coli (p = 0.002) and V. cholerae (p = 0.005) was significantly associated with their phenotypic resistance against cotrimoxazole (Table 4).

Nucleotide sequence and phylogenetic analyses

The phylogenetic analysis revealed that the partial amplicons of qnrB (468 bp) isolated from E. coli were closely related with the previously reported reference qnrB genes from E. coli (CP031833) and Klebsiella pneumoniae (EU127476) (Fig. 2 part a). The partial sequences of amplicons of mcr-1 gene (1561 bp) of E. coli, V. cholerae and Salmonella spp. clustered closely with reference mcr-1 genes of E. coli of accession number, MW836072, CP101213, and KY013597 (Fig. 2 part b). Further, the partial amplicons of blaTEM (750 bp) encoded from the study isolates were closely related with each other and reference sequences of database. Study amplicons, TEM/JU/BD/22-1, TEM/JU/BD/22-5, TEM/JU/BD/22-6, TEM/JU/BD/22-8, and TEM/JU/BD/22-17 clustered closely with reference blaTEM ON221404, ON221405, and AB700703 (Fig. 2 part c). Partial amplicons of resistance gene against tetracycline (tet) (211 bp) isolated from pathogenic isolates of E. coli of this study were closely related with the reference tet (36) (NG048131) and AJ514254 (Fig. 2 part d).

Figure 2
figure 2

Phylogenetic relationship of antimicrobial resistance genes isolated from bacterial pathogens. (a) Partial sequences of qnrB gene from E. coli were used for constructing this tree, (b) Partial sequences of mcr-1 gene from E. coli were used for constructing this tree, (c) Partial sequences of blaTEM gene from E. coli were used for constructing this tree, (d) Partial sequences of tetA gene from V. cholerae were used for constructing this tree. The trees were constructed by using maximum likelihood model with a bootstrap value of 1000 by using MEGAX. The scale bars in the trees indicated nucleotide substitutions per site for each tree separately. Partial sequence of 16S rRNA from Bacillus spp was used as outgroup in tree A and partial sequence of carbapenem resistance gene from E. coli was used as out group in tree (b), (c) and (d).

Full size image

Mutational analysis of bla TEM

After aligning the sequences against reference sequences of respective resistance genes we searched for the presence of mutations. However, we did not find any significant mutations in the tet, qnrB and mcr-1 genes. We found significant mutations in the blaTEM resistance genes. In most of the study strains the amino acids up-to 158 residues were highly similar with the reference sequences. Notable substitution point mutations were found in TEM/JU/BD/22–4 and TEM/JU/BD/22–9. In TEM/JU/BD/22–4, substitution mutations were found at positions 159 (Ser → Ile), 169 (Phe → Leu), 174 (Val → Arg), and 177 (Cys → Asp). In TEM/JU/BD/22–9, two substitution mutations were seen at positions 187 (Thr → Lys) and 188 (Glu → Asn).

Discussion

According to the world health organization diarrhea is the 2nd major cause of mortality and the leading cause of malnutrition among children under five years1,2,3. The health burden of diarrheal diseases is severe in developing countries like Bangladesh3. The circulation of antimicrobial resistance strains of these bacterial pathogens is intensifying the health burden of diarrheal disease in Bangladesh13,14,15.

We detected significantly higher prevalence of bacterial infection (63%) than any other previous reports from Bangladesh1,3,9. Further, the proportionate incidence of diverse pathogens was alarming. We found E. coli (29%) in higher frequency followed by Shigella spp. (17%) and V. cholerae (13%). The diversity of bacterial pathogens associated with diarrhea in children are similar with previous studies3,9. The higher prevalence of Shigella spp. requires further investigation and V. cholerae may indicate the constant presence of cholera endemic in these regions. Findings are in good agreement with previous studies in Bangladesh, China, India, Iran and WHO data from developing countries2,8,15,16,17,18,19,20,21,22,23,24,25.

We found significantly diverse pathogens in children with diarrhea. Mixed infection with rotavirus, norovirus, adenovirus and human bocavirus was simultaneously found in the positive specimens of bacterial infection. Dual infection by rotavirus and E. coli was associated with (15%) of the cases followed by V. cholerae and Shigella spp. (7.7%). Further, we detected that 31% specimens had co-infection with two pathogens and 12% with three pathogens. Few previous studies have also reported the presence of multiple pathogens in the same specimens in Bangladesh. Our findings are in good similarity with the previous findings in Savar and Tangail in Bangladesh3, 9,18.

Association of coinfection with the clinical symptoms were also analyzed in this study. We found that presence of coinfection was significantly associated with higher odds of diarrhea, vomiting, dehydration and abdominal pain in children under five. The presence of multiple pathogens in a single patient makes it difficult to intervene or treat the conditions earlier. Among the co-infected samples, we could not determine which pathogen infected earlier. However, the presence of coinfection was associated with severe and chronic outcomes in children under five. These findings are supported by the data of previous studies3,5,8,9,18. These findings also indicated that the existing hygienic conditions or setting of the study area favored the spread of multiple pathogens associated with diarrhea.

Significantly higher prevalence of antimicrobial resistance (AMR) pathogens from family Enterobacteriaceae was confirmed by the disk diffusion method in this study. About 60% of the isolates of E. coli, V. cholerae, Salmonella spp., and Shigella spp. were resistance against ceftriaxone, erythromycin, norfloxacin, ciprofloxacin and tetracycline. These antibiotics are most commonly used in treatment of diarrheal diseases caused by Enterobacteriaceae and supported by the CLSI guidelines. These findings are supported by previous studies in Savar and Tangail Bangladesh and other developing countries3,15,16,17,18,19,20,21,24,25,26,27. However, we found higher incidence of antimicrobial resistance pathogens than the previous studies in Tangail18 and Savar3, which suggests that the problem of AMR is increasing rapidly and widely in Bangladesh. These findings suggest that use of any of these antibiotics against E coli, V cholerae, Salmonella spp. or Shigella spp. will be less effective option in treatment, which is also supported by previous studies24,25. Except imipenem, meropenem and colistin, significant resistance activity was found in all of the detected bacterial pathogens among children. Among the tested antibiotics, the highest frequency (nearly 70%) of sensitivity was found against imipenem and meropenem. Though colistin is not used clinically in treatment of diarrhea caused by Enterobacteriaceae, we found higher prevalence of colistin resistance pathogens. This outcome is supported by previous studies in Bangladesh3,18,27,28.

The multidrug resistance (MDR) profiling of the isolated pathogens was alarming. Significantly higher prevalence of MDR was detected (about 15%) among the isolates of E. coli, V. cholerae and Shigella spp. against several antibiotics including ceftriaxone, erythromycin, norfloxacin and chloramphenicol. This finding is supported by previous studies in Bangladesh, China and Iran3,14,17, 18,25,26,27,28. However, the report of MDR from pathogenic bacteria isolated from children with diarrhea is less available in Bangladesh. In addition, higher prevalence of MDR against these important and commonly used antibiotics is staggering. The prevalence of MDR strains of pathogenic bacteria might be a significant cause of severe and prolonged health outcomes among children with diarrhea in Bangladesh. The rapid and uncontrolled increase in use of antibiotics as human treatment and animal feed and treatment options has significantly contributed to the rise and spread of MDR, which is supported by the previous studies28.

Integration of molecular characteristics and epidemiological data can contribute significantly in tracing the origin and transmission of AMR and MDR strains of pathogenic E. coli, V. cholerae, Salmonella spp. and Shigella spp. Which will ultimately aid in tracing the sources of infection and contribute in reduction of health burden among children. Antibiotic resistance genes against different group of antibiotics were found among the isolates of E. coli, V. cholerae, Salmonella spp. and Shigella spp. Resistance genes against ciprofloxacin (qnrB), cotrimoxazole (sxt) and colistin (mcr-1) were found in lower frequency among the isolates of E. coli (⁓10%), V. cholerae (⁓13%), Salmonella spp. (⁓14%) and Shigella spp. (⁓15%). Antibiotic resistance gene blaTEM was found in highest frequency among the isolates of Salmonella spp. (45%) followed by E. coli (36%), and V. cholerae (36%). Further, tetA gene was detected among 18–27% isolates of these enteropathogenes. These findings are in good agreement with previous studies in Bangladesh3, 18. However, the diversity and prevalence of resistance genes were significantly higher in this study than previous reports. Further, we found that the presence of resistance genes in pathogenic E. coli, V cholerae, Salmonella spp., Shigella spp. were significantly associated with the phenotypic resistance properties against ceftriaxone, cotrimoxazole, ciprofloxacin, tetracycline and colistin. The findings of these study are supported by the previous studies in Bangladesh and China3,14,17,18,19,20,26,27,28. This is one of the first study to report the association between phenotypic and genotypic resistance of bacterial pathogens in Bangladesh. These findings are alarming for the pediatric health in Bangladesh as these bacterial pathogens contribute for a significant number of cases. Both AMR and MDR pathogens with the presence and association of resistance genes with treatment failure among the children with diarrhea require extensive studies in future.

The prevalence of resistance E coli, V cholerae, Salmonella spp. and Shigella spp. were higher in this study than previous studies in Bangladesh, India, Nigeria, Pakistan and Iran13,16,18,23,24,25. This phenotypic resistance and presence of resistance genes indicate probable continuous present of AMR pathogens among children in Bangladesh. It is established that misuse and over use of antibiotics have contributed to the origin and spread of resistance properties among pathogens. Importance should be given to appropriate diagnosis of pathogens before suggesting and use of antibiotics in children with diarrhea. Strict and widespread public health surveillance, education and policy are required to prevent further misuse and overuse of antibiotics in Bangladesh.

Findings from this study will add knowledge in the pathogenic diversity of children with diarrhea. Further, integrated approach to determine the prevalence of antimicrobial resistance and multidrug resistance isolates added significant information in the field. This study will contribute in determining and understanding the actual scenario and causes of antimicrobial resistance problem and their molecular elements, which will aid in accurate diagnosis and treatment of diarrheal patients in Bangladesh.

Conclusion

We detected high prevalence of E coli, V cholerae, Salmonella spp. and Shigella spp. among children with diarrhea in Bangladesh. Co-infection of viruses was also found at higher frequency among the children. Further, we detected higher incidence of antimicrobial and multidrug resistance isolates among these pathogenic bacteria in children with diarrhea. Findings from this study also suggested that presence of co-infection increased the severity and complications of the disease among children. Findings from this study will contribute in policy making to understand and reduce the health burden associated with antimicrobial and multidrug resistance enteropathogens.

Methods

Ethical approval

The ethical clearance was obtained from the Biosafety, Biosecurity & Ethical Committee at the Jahangirnagar University. The informed consent was taken from the participants before taking the survey.

Method guidelines

The authors confirm that all the methods were performed in accordance with the relevant guidelines and regulations. All methods were performed in accordance with the our previously published articles3,5,7,8. For bacterial culture and antibiotic sensitivity test, guidelines from ATCC (https://www.atcc.org/) and CLSI (https://clsi.org/) were followed, respectively.

Study population and fecal specimens

A total of 404 fecal specimens were collected from patients with diarrheal diseases from 3 clinics of two different localities (Savar and Tangail) in Bangladesh through January 2019 to December 2021. Samples were collected from Enam Medical College (135 of 404) and Dip Clinics (125 of 404) in Savar and Kumuduni Women's Medical College (144 of 404) in Tangail. Convenience sampling method was used to enroll the participants. Epidemiological and demographic data were collected from children aged below 18 years with acute gastroenteritis. The participants of this study were divided into seven age groups including the range in months, 1–3, 4–11, 12–23, 24–35, 36–47, 48- 60 and > 60 (Table 1). Clinical symptoms data of children were analyzed. Informed consent was obtained from the parents of patients. Inclusion criteria to take samples were patients age below 18 years, have symptoms of diarrhea according to WHO definition, reported in the clinic’s outpatients, inpatients or emergency department. Exclusion criteria were patients aged above 18 years, did not report of their diarrheal cases in these clinics during the study period, missing demographic data, and having other health complications. One fecal specimen was collected from every participant. After collection, the specimens were stored at − 20 °C. Transportation of the fecal specimens were conducted by maintaining − 20 °C temperature in ice box. All the specimens were stored at − 20 °C after being transported under maintaining proper conditions3. All methods were performed in accordance with the our previously published articles3,5,7,8.

Laboratory tests for V.cholerae, DEC, Salmonella spp., and Shigella spp

Colony characterization of bacterial pathogens were performed on specific selective agar media. MacConkey Agar, Thiosulphate-Citrate-Bile Salt Sucrose (TCBS) Agar, and Salmonella Shigella (SS) Agar media (HIMEDIA, India) were utilized aseptically to isolate and identify diarrheagenic E. coli (DEC), V.cholerae, Salmonella spp., and Shigella spp. Eosin Methylene Blue (EMB) Agar (HIMEDIA, India) for E.coli and Xylose Lysine Deoxycholate (XLD) Agar (HIMEDIA, India) for Salmonella spp. and Shigella spp. were used for further identification3,9.

Antibiotic susceptibility test of enteric bacterial pathogens

Antibiotic susceptibility test was performed by following the Kirby-Bauer Disk Diffusion Test and according to the CLSI guidelines3,29. Antibiotics of nine different groups were used, following the CLSI manual (Table 5). The susceptibility of the pathogens to each antibiotic was determined by measuring the zone diameter, which was further classified as resistance, intermediate, or susceptible according to the CLSI guidelines. E. coli ATCC 25922 strain was used concurrently as control to determine the validity of the test protocol.

Table 5 Performance standards for E. coli, V. cholerae, Salmonella spp. and Shigella spp. isolated from children with diarrhea to antimicrobial susceptibility testing performed in this study.
Full size table

Bacterial genome extraction and polymerase chain reaction

The bacterial genome was extracted by using the previously described boiled DNA method3,30. Further, genome of virus was isolated and purified (Supplementary material). The isolated bacteria were identified by using polymerase chain reaction (PCR). The following sequences of 16S rRNA primers (F- AGT TTG ATC CTG GCT CAG and R- ACC TTG TTA CGA CTT) were used for PCR reaction3. The PCR reaction mixture contained 12.5 µl of 2X master mix (GoTaq Green Master Mix, Promega, USA), 1 µl of forward (F) primer, 1 µl of reverse (R) primer, 6.5 µl of nuclease-free water, and 4 µl of template DNA (Eppendorf, Germany). The final volume of reaction mixture was 25 µl. The PCR reaction was conducted in a thermal cycler (2720 Thermal Cycler, Applied Biosystems, USA). The PCR reaction was performed at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 60 s3. The details of the PCR conditions for the detection of antimicrobial resistance genes are provided in the supplementary material.

PCR reaction to detect antimicrobial resistance genes

Primer pair, F- CATCTACCACTTCATAGGCAGC and R- CAGCTTAACTCACCAAGGAC were used for the amplification of sxt (242 base pairs) resistance gene. The PCR of sxt was conducted at 94 °C for 2 min 1 cycle, followed by 35 cycles of 94 °C for 1 min, 60.5 °C for 1 min, 72 °C for 1 min and a final extension at 72 °C for 10 min. For the amplification of qnrA (492 base pairs) primer pairs, F- GGATGCCAGTTTCGAGGA and R- TGCCAGGCACAGATCTTG were used in a thermal cycle at 94 °C for 5 min followed by 35 cycles at 94 °C for 1 min, 59 °C for 1 min, 72 °C for 1 min and final extension at 72 °C for 10 min. Primer pairs F-GATCGTGAAAGCCAGAAAGG and R-ACGATGCCTGGTAGTTGTCC were used for the amplification of qnrB (469 base pairs) resistance gene (Table 6). The PCR was conducted at 94 °C for 2 min followed by 35 cycles at 95 °C for 45 s, 53 °C for 45 s, 72 °C for 1 min and final extension at 72 °C for 5 min. For blaTEM (750) resistance gene primers, F- TCGGGGAAATGTGCGCG and R-TGCTTAATCAGTGAGGACCC were used (Table 6). PCR was done at 94 °C for 7 min followed by 30 cycles at 94 °C for 30 s, 53 °C for 30 s, 72 °C for 30 s and final extension at 72 °C for 5 min. Primer pair, F- GCTCGGTCAGTCCGTTTGTTCTTG and R- GGATGAATGCGGTGCGGTCTT were used for mcr-1, colistin resistance genes at 93 °C for 3 min followed by 35 cycles at 93 °C for 15 s, 57 °C for 30 s, 68 °C for 70 s followed by final extension at 72 °C for 5 min. For molecular detection of tet genes, previously published articles were followed (Table 6). All the PCR products were kept at 4 °C.

Table 6 List of primers used in this study.
Full size table

Viral genome extraction

Total viral genome was extracted by using the Promega SVA total genome kit according to the manufacturer’s protocols (Promega, Madison, USA)5,7,8. Reverse transcriptase polymerase chain reaction method was performed to detect rotavirus and norovirus and polymerase chain reaction to detect adenovirus and human bocavirus. Molecular sequencing method was applied to confirm genotypic characteristics of viruses5,7,8.

Agarose gel electrophoresis

The amplicons of the PCR were electrophoresed by using 1.5% agarose gel. Horizontal gel electrophoresis was run for 30 min3. Ladder DNA of 1 kilo base pair was used and specific amplicons were visualized by using the UV spectrophotometer (SPECORD-205, Analytik-Jena, Germany).

Nucleotide sequence analysis

The nucleotide sequences of PCR amplicons (DNA) positive for E. coli, V. cholerae, Salmonella spp. and Shigella spp. were determined with the Big-Dye terminator cycle sequencing kit and an ABI Prism 310 Genetic Analyzer (Applied Biosystems Inc. Foster City, CA). The sequences were analyzed by using Chromas 2.6.5 (Technelysium, Helensvale, Australia). Sequence homology was confirmed by using the BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi) program. Multiple sequence alignment (MSA) was performed in the BioEdit 7.2.6 software using the ClustalW Multiple Alignment algorithm3,31.

Phylogenetic analysis

Phylogenetic relationship and molecular evolutionary analysis of qnrB, mcr-1, blaTEM and tet genes with the reference sequences were conducted by using MEGA 10.0 software32. Phylogenetic trees were built by using the Maximum Composite Likelihood (MCL) method3,32. Reference sequences were retrieved from the GenBank Database (https://www.ncbi.nlm.nih.gov/nucleotide/). The datasets generated and/or analyzed during the current study are available in the NCBI repository. The following reference strains were used for phylogenetic analysis of qnrB gene: MF999219, CP059125, CP051692, CP031833, EU127476, CP096261, OM975894, CP088121, CP032204, CP054227, CP032204 and MN200703 (outgroup). Reference strains for blaTEM gene were: CP050932, CP048610, ON221405, ON221404, NG050233, AB700703, CP094365, CP095663, CP095655, CP095626, CP095618, KP853092, CP087666, CP095156, KT417856, KY739693 and KF268350 (outgroup). mcr-1 gene were: KY013597, OM069356, OM069355, OM038692, OM038691, CP102678, OL504740, CP101861, CP030156, CP101391, CP101366, CP100031, CP100017, CP101213, CP099722, CP081339, CP065023, CP091559, CP091557, MW421457, MW719568, CP090269, MW836072 and KF268350 (outgroup). tet genes: NG_048131, AJ514254, CP049298, CP043636, CP104212, CP089096, CP040909, KJ797592, CP103193, AY265739, CP043637, CP043637, and KF268350 (outgroup). The nucleotide sequences generated in this study were submitted in the GenBank, NCBI under the submission ID, 2664914, 2664908, 2664900, and 2664883 and accession number OQ297026-OQ297034.

Statistical analysis

We used percentage to present categorical variables and mean/ median for continuous variables. Inferential statistics (p value) was applied for the analysis. We calculated odds ratio (OR) of categorical variables by using two-tailed Chi-square or Fisher’s exact tests with 95% confidence intervals (CIs). For two-tailed tests p value < 0.05 were considered as significant. We performed data analysis by using Statistical Product and Service Solutions (SPSS v24.0) software (IBM, US).