Regulation of TRI5 expression and deoxynivalenol biosynthesis by a long non-coding RNA in Fusarium graminearum

Huang, Panpan; Yu, Xiao; Liu, Huiquan; Ding, Mingyu; Wang, Zeyi; Xu, Jin-Rong; Jiang, Cong

doi:10.1038/s41467-024-45502-w

Download PDF

Article
Open access
Published: 09 February 2024

Regulation of TRI5 expression and deoxynivalenol biosynthesis by a long non-coding RNA in Fusarium graminearum

Nature Communications volume 15, Article number: 1216 (2024) Cite this article

2019 Accesses
1 Citations
2 Altmetric
Metrics details

Subjects

Abstract

Deoxynivalenol (DON) is the most frequently detected mycotoxin in cereal grains and processed food or feed. Two transcription factors, Tri6 and Tri10, are essential for DON biosynthesis in Fusarium graminearum. In this study we conduct stranded RNA-seq analysis with tri6 and tri10 mutants and show that Tri10 acts as a master regulator controlling the expression of sense and antisense transcripts of TRI6 and over 450 genes with diverse functions. TRI6 is more specific for regulating TRI genes although it negatively regulates TRI10. Two other TRI genes, including TRI5 that encodes a key enzyme for DON biosynthesis, also have antisense transcripts. Both Tri6 and Tri10 are essential for TRI5 expression and for suppression of antisense-TRI5. Furthermore, we identify a long non-coding RNA (named RNA5P) that is transcribed from the TRI5 promoter region and is also regulated by Tri6 and Tri10. Deletion of RNA5P by replacing the promoter region of TRI5 with that of TRI12 increases TRI5 expression and DON biosynthesis, indicating that RNA5P suppresses TRI5 expression. However, ectopic constitutive overexpression of RNA5P has no effect on DON biosynthesis and TRI5 expression. Nevertheless, elevated expression of RNA5P in situ reduces TRI5 expression and DON production. Our results indicate that TRI10 and TRI6 regulate each other’s expression, and both are important for suppressing the expression of RNA5P, a long non-coding RNA with cis-acting inhibitory effects on TRI5 expression and DON biosynthesis in F. graminearum.

Identification and characterization of early Fusarium wilt responsive mRNAs and long non-coding RNAs in banana root using high-throughput sequencing

Article Open access 11 August 2021

Discovery of long non-coding RNAs in Aspergillus flavus response to water activity, CO2 concentration, and temperature changes

Article Open access 26 June 2023

An atypical class of non-coding small RNAs is produced in rice leaves upon bacterial infection

Article Open access 17 December 2021

Introduction

Fusarium head blight (FHB) is a devastating disease of wheat and barley that threatens global food security. Fusarium graminearum is one major causal agent of FHB and it also infects corn, millets, and other grain crops^1,2,3,4. In addition to causing significant yield losses, F. graminearum is a producer of deoxynivalenol (DON), which is the most frequently detected mycotoxin in cereal grains and food or feed processed from cereal grains⁵. As a type B trichothecene mycotoxin, DON is inhibitory to eukaryotic protein synthesis and harmful to human or animal health. It is also phytotoxic and DON production plays a critical role during plant infection^6,7. The gene that encodes the Tri5 trichodiene synthase is the first virulence factor functionally characterized by molecular genetic studies in F. graminearum⁸. The tri5 deletion mutant still causes typical symptoms at the inoculated spikelets but fails to spread to neighboring spikelets on the same head via the rachis^9,10.

Like in Fusarium sporotrichioides, a producer of type A trichothecene T-2 toxin, the 15 TRI genes related to trichothecene biosynthesis are distributed on three chromosomes in F. graminearum^{7,11,12,13,14,15}. Whereas TRI1-TRI16 and TRI101 are on chromosomes 1 and 3, respectively, the core TRI cluster that contains 12 genes, including TRI5, TRI6, and TRI10, is on chromosome 2^11,13. The precursor for trichothecene synthesis is farnesyl pyrophosphate (FPP) which is synthesized via the mevalonate pathway^15,16,17,18. The Tri5 trichodiene synthase catalyzes the first step in trichothecene biosynthesis by cyclizing FPP to trichodiene. The TRI1, TRI3, TRI4, TRI8, TRI11, and TRI101 genes encode enzymes responsible for catalyzing the other steps of DON biosynthesis and their expression is under the control of TRI6 and TRI10^7,18. For the other TRI genes, TRI12 encodes a major facilitator transporter functioning as the trichothecene efflux pump¹⁹. Whereas the function of TRI9 and TRI14 in trichothecene biosynthesis is not clear²⁰, TRI7, TRI13, and TRI16 are pseudogenes with frameshift or nonsense mutations in DON-producing strains of F. graminearum^21,22,23.

In filamentous fungi, gene clusters responsible for the synthesis of secondary metabolites often contain one transcription factor that functions as a pathway-specific regulator of other genes in the same cluster. Interestingly, two of the TRI genes, TRI6 and TRI10, function as transcriptional regulators of trichothecene biosynthesis in different Fusarium species^7,13. In F. graminearum, both TRI6 and TRI10 are important for TRI gene expression, DON production, and plant infection^18,24. Microarray analysis with infected wheat heads showed that the promoters of most TRI genes and other F. graminearum genes regulated by TRI6 have the YNAGGCC motif¹⁸, which is similar to the Tri6-binding site reported in F. sporotrichioides²⁵. In a later study, a motif of GTGA repeats was identified by ChIP-seq analysis with a TRI6-HA transformant cultured under nutrient-rich conditions and verified to be recognized by Tri6 proteins in gel mobility shift assays²⁶. Unlike Tri6 which is a Cys₂His₂ zinc finger protein, the Tri10 protein has no DNA-binding domain. Based on microarray analysis, TRI6 expression is not affected in the tri10 deletion mutant although deletion of TRI6 has a minor effect on the expression of TRI10. Therefore, the mechanism for regulating TRI gene expression by TRI10 and the functional relationship between TRI6 and TRI10 in regulating trichothecene biosynthesis are not clear in F. graminearum. Nevertheless, microarray analysis and qRT-PCR assays used in earlier studies could not distinguish sense and antisense transcripts and are not suitable to characterize the expression levels of TRI genes with antisense transcripts.

To better understand the roles of TRI6 and TRI10 in regulating TRI gene expression and DON biosynthesis, in this study, we conducted strand-specific RNA-seq analysis with the tri6 and tri10 deletion mutants under DON-inducing conditions. Although many TRI genes were down-regulated in both mutants, we found that TRI10 regulated the expression of over 450 genes with diverse functions but TRI6 was more specific for regulating TRI genes. As the master regulator, TRI10 was essential for the expression of TRI6 and suppression of antisense-TRI6. Antisense transcripts of TRI5 and a lncRNA transcribed from its promoter (named RNA5P) also were identified in the tri6 and tri10 mutants. Although overexpression of RNA5P ectopically with the RP27 promoter had no effect, increased expression of RNA5P in situ resulted in a significant reduction or elimination of TRI5 expression and DON production. In contrast, deletion of RNA5P increased DON production and TRI5 expression. Taken together, these results indicate that both TRI10 and TRI6 are important for suppressing the expression of antisense-TRI5 as well as RNA5P, which is a lncRNA inhibitory to TRI5 expression and DON biosynthesis in F. graminearum.

Results

TRI10 regulates more genes than TRI6 under DON-inducing conditions

Both TRI6 and TRI10 are in the same transcription direction with TRI5 and they are on a 7.5-kb region in the core TRI gene cluster (Fig. 1a). To identify genes regulated by TRI6 and TRI10, we conducted RNA-seq analysis with the wild type and the tri6 and tri10 mutants¹⁸ (Supplementary Table 1) cultured in DON-producing LTB (liquid trichothecene biosynthesis) medium for three days. The tri6 and tri10 mutants we used were generated in a previous study by gene replacement with the hygromycin phosphotransferase (hph) cassette (Fig. 1a). Whereas the TRI5-TRI6 region was 248-bp longer in the tri6 mutant, the TRI5-TRI10 region was 575-bp shorter in the tri10 mutant in comparison with the wild type (Fig. 1a) due to the gene replacement events¹⁸. In comparison with the wild type, a total of 56 and 450 differentially expressed genes (DEGs) had over 2-fold changes in their expression levels in the tri6 and tri10 mutants, respectively. Among them, 40 and 16 DEGs were down- and up-regulated in the tri6 mutant (Supplementary Data 1). In the tri10 mutant, 231 and 219 DEGs were down- and up-regulated, respectively (Supplementary Data 2). These results indicate that TRI10 regulates more genes than TRI6 in F. graminearum in DON-producing cultures. GO enrichment analysis showed that DEGs down-regulated in the tri6 mutant are enriched for genes involved in toxin metabolic process and pyridoxal phosphate biosynthesis or metabolism (Supplementary Fig. 1a). In the tri10 mutant, down-regulated DEGs are enriched for genes associated with RNA transcription, binding, and processing (Supplementary Fig. 1b).

**Fig. 1: Comparative analysis of DEGs identified in the *tri6* and *tri10* mutants.**

We then compared RNA-seq data of the tri6 and tri10 mutants and found that 17 and 14 DEGs were down- or up-regulated in both mutants (Fig. 1b and Supplementary Table 2). A total of 7 TRI genes were down-regulated in both mutants (Fig. 1c), indicating positive regulation by both TRI6 and TRI10. Among the four TRI genes without significant changes in expression levels in the tri6 or tri10 mutant (Fig. 1c), TRI7, TRI13, and TRI16 are pseudogenes with frameshift and nonsense mutations in DON-producing strains of F. graminearum such as PH-1^21,22,23. For TRI8 which encodes a trichothecene 3-O-esterase, its expression was reduced but less than 2-fold in the tri6 or tri10 mutant. Interestingly, among the 230 DEGs down-regulated in the tri10 mutant, only TRI4 was a DEG up-regulated in the tri6 mutant (Fig. 1c). Because TRI4 shares the same promoter region with TRI6, up-regulated expression of TRI4 expression in the tri6 mutant may be directly related to the abolishment of the self-inhibitory binding of Tri6 to its own promoter²⁶.

To evaluate the potential effects of hph cassette transcription on neighboring TRI genes, we generated the tri6 and tri10 deletion mutants with the hph cassette transcribed in the opposite direction from TRI5 and TRI6 or TRI10 (Supplementary Fig. 2a, b). The resulting tri6 and tri10 deletion mutants had the same defects in TRI5 expression and DON biosynthesis with the published mutants¹⁸ (Supplementary Fig. 2c–e), indicating that the TRI6 and TRI10 gene deletion events but not the direction of hph are responsible for the defects observed in the tri6 and tri10 mutants.

Expression of antisense transcripts of TRI5, TRI6, and TRI11 in the tri6 or tri10 mutant

Because our data were generated by stranded RNA-seq, we then separated the sense and antisense transcripts of the TRI genes and examined for changes in their abundance in the tri6 and tri10 mutants compared to the wild type. In the wild type, only TRI5 and TRI6 had rare anti-sense transcripts (Supplementary Table 3). In the tri10 mutant, antisense transcripts of TRI5 and TRI6 were significantly increased (Fig. 1d). For the TRI5 gene, sense transcripts were rare but antisense transcripts were abundant in the tri6 and tri10 mutants (Fig. 1d), indicating a negative regulation of antisense-TRI5 by TRI6 and TRI10.

For TRI11, the only other TRI genes with antisense transcripts detected in this study, its sense transcripts were rare in the tri6 and tri10 mutants, a significant reduction compared to the wild type. Antisense transcripts of TRI11 were present in both mutants but more abundant in the tri10 mutant (Fig. 1d). These results indicate that TRI6 and TRI10 are not only essential for the expression of sense transcripts of TRI5 and TRI11 but also important for suppressing their antisense transcription. Based on the stranded RNA-seq data, antisense transcripts of the other TRI genes were not detected in the wild type, and the tri6 and tri10 mutants (Supplementary Fig. 3).

Repression of TRI10 expression by TRI6 and vice versa

TRI10 has no antisense transcripts in the wild type and tri6 mutant. However, the expression level of TRI10 was significantly increased (over 2-fold) in the tri6 mutant compared to the wild type (Fig. 2a). These results indicate that TRI10 expression is negatively regulated by TRI6. In the tri10 deletion mutant, the expression level of antisense-TRI6 was significantly increased (over 4-fold) based on both RNA-seq (Fig. 1d) and qRT-PCR assays (Fig. 2b) compared to the wild type. For the sense transcripts of TRI6, the overall abundance was also increased in the tri10 mutant due to a significant increase in partial transcripts mapped to the 3’-terminal region of TRI6 (Fig. 1d; Fig. 2b). Close examination showed that antisense transcripts of TRI6 predominantly mapped to its 5’-terminal 410-bp region. In contrast, the 3’-terminal 274-bp region of TRI6 was more abundant in its sense transcripts (Fig. 1d), suggesting the pairing and degradation of TRI6 mRNA by antisense-TRI6 transcripts. These results indicate that the expression of sense and antisense transcripts of TRI6, is negatively regulated by TRI10. Interestingly, antisense transcripts mapped to the terminator region of TRI6 had a 65-bp intron (Fig. 1d) that is a part of antisense-TRI6 based on RT-PCR assays (Supplementary Fig. 4a, b). To test the importance of this intron, we generated the TRI6^ME mutant allele, in which the GT-AG splicing sites were changed to AT-TG, and transformed into the tri6 mutant (Supplementary Fig. 4a, b). In LTB cultures, the resulting tri6/TRI6^ME transformant was normal in DON biosynthesis and TRI6 expression (Supplementary Fig. 4c, d), indicating that splicing of this intron in antisense transcripts is not important for the function of TRI6.

**Fig. 2: Regulation of *TRI6* expression by *TRI10* and vice versa.**

We then generated mutants deleted of a 185-bp region covering parts of the terminator region of TRI6 by the gene replacement approach (Fig. 2c). This region likely contains the promoter region for antisense-TRI6. In the resulting TRI6^AD transformant (Supplementary Table 1), antisense transcripts of TRI6 were significantly reduced in qRT-PCR assays with RNA isolated from LTB cultures (Fig. 2d). However, the expression of TRI6 sense transcripts and DON production were also significantly reduced in the TRI6^AD mutant (Fig. 2d, e). Therefore, deletion of this 185-bp region and insertion of the selectable marker at the TRI6 locus likely affect the expression of both sense and antisense transcripts, possibly by interfering with the initiation of their transcription, transcription efficiency, or transcript stability.

Overexpression of antisense-TRI5 inhibits DON biosynthesis

Antisense transcripts of TRI5 were not detectable in the wild type under DON inducing conditions but were abundant in both tri6 and tri10 mutants. To determine the function of antisense-TRI5 transcripts, we generated the P_RP27-antiTRI5 construct and transformed it into PH-1 (Fig. 3a). Transformants with the P_RP27-antiTRI5 construct integrated ectopically were isolated (Supplementary Table 1) and assayed for TRI5 and DON production in LTB cultures. In comparison with the wild type, the expression of antisense-TRI5 was increased over 20-fold but DON production and the expression level of TRI5 was significantly reduced in the P_RP27-antiTRI5 transformants (Fig. 3b, c). In plant infection assays, P_RP27-antiTRI5 transformants, like the tri5 mutant, caused symptoms only on the inoculated wheat spikelet (Fig. 3d). These results indicate that overexpression of antisense-TRI5 reduced the sense transcripts of TRI5 and inhibitory to DON biosynthesis.

RNA5P is a lncRNA mapped to the promoter region of TRI5

Close examination of strand-specific RNA-seq data showed that, under DON-inducing conditions, the 675-bp transcripts mapped to the promoter region of TRI5 (named RNA5P for RNA transcribed from the TRI5 promoter) were rare in PH-1 but became abundant in the tri6 and tri10 mutants, especially in the latter (Fig. 1c and Supplementary Table 3). Furthermore, RNA5P has one intron that was spliced in a small percentage of RNA5P transcripts in the tri6 and tri10 mutants (Fig. 1c). Alternative splicing of this intron will lead to two transcripts of RNA5P (Fig. 4a). Based on prediction with ExPASy (web.expasy.org/translate), these two transcripts may encode two small peptides of 58- and 86-amino acid residues that share the same stop codon (Fig. 4a and Supplementary Fig. 5). To test whether RNA5P is a part of TRI5 mRNA, we conducted RT-PCR analysis with RNA isolated from LTB cultures of PH-1. Whereas primer pairs 5PRT1/5PRT2 and TF1/TR2 amplified the 0.11 and 0.18-kb band, respectively, no band could be amplified with primer pairs 5PRT1 and TR2 (Fig. 4b), indicating that RNA5P transcripts are independent of TRI5 mRNA.

**Fig. 4: RNA5P is a lncRNA transcribed from the *TRI5* promoter.**

To test whether RNA5P transcripts can be translated, we generated the RNA5P-3×FLAG fusion construct (Fig. 4a) under the control of the constitutive RP27 promoter²⁷ and transformed it into PH-1. In the resulting P_RP27-RNA5P-3×FLAG transformants, the expression of RNA5P was increased in transformants with the fusion construct compared with PH-1 (Fig. 4c). However, the anti-FLAG antibody failed to detect any band on western blots of total proteins isolated from the resulting RNA5P-3×FLAG transformants cultured in LTB (Fig. 4d). As the control, the expression of FgEsa1 histone acetyltransferase was detected in the FgESA1-3xFLAG transformant²⁸ under the same experimental conditions (Fig. 4d). To further prove the function of RNA5P is independent of protein coding, we inserted an adenine (A) in the predicted ORF of RNA5P in situ (Fig. 4e and Supplementary Fig. 6). The resulting transformant with the frameshift mutation verified by sequencing analysis (Fig. 4f) was normal in TRI5 expression (Fig. 4g) and DON production (Fig. 4h) in comparison with the wild type. These results suggest that RNA5P does not encode functional proteins and likely acts as a lncRNA in F. graminearum.

Deletion of RNA5P by promoter switching increases TRI5 expression

To characterize the function of RNA5P, we used the gene replacement approach to replace 834-bp region upstream from the TRI5 ORF that contains the RNA5P region with an 834-bp fragment of the TRI12 promoter (Fig. 5a, b). TRI12 was selected because, like TRI5, its expression is regulated by both TRI6 and TRI10 but its expression level was 10-fold lower than that of TRI5 based on our RNA-seq data (Fig. 5a, b). The size of the promoter regions used for promoter swapping was kept similar to avoid possible effects of size changes on local chromatin structures in the TRI gene cluster¹⁴. In the resulting P_TRI12-TRI5 transformants, the replacement of TRI5 promoter with that of TRI12 was verified by PCR amplification (Supplementary Fig. 7). When assayed by qRT-PCR with RNA isolated from LTB cultures, the expression of RNA5P was detected in the wild type but not in the P_TRI12-TRI5 transformant (Fig. 5c). The expression level of TRI5 sense transcripts was increased 2.6-fold in the P_TRI12-TRI5 transformant compared to the wild type (Fig. 5c). However, the transcription of antisense-TRI5 was only slightly increased in the P_TRI12-TRI5 transformant (Fig. 5c). Consistent with increased expression of TRI5, DON production was also increased in the P_TRI12-TRI5 transformant (Fig. 5d). Microscopical examination also showed a slight increase in the formation of hyphal swelling or cellular differentiation associated with DON production (Fig. 5e). These results indicate that even though TRI12 has a lower expression level than TRI5, deletion of RNA5P by replacing the promoter of TRI5 with that of TRI12 had no significant effect on antisense-TRI5 expression but significantly increased TRI5 expression and DON biosynthesis.

**Fig. 5: Deletion of RNA5P increase *TRI5* expression and DON production.**

Overexpression of RNA5P ectopically has no inhibitory effect on TRI5 expression and DON biosynthesis

To determine the effect of RNA5P overexpression, we generated the P_RP27-RNA5P construct (Fig. 6a) and transformed it into PH-1. In the resulting transformants (Supplementary Table 1) the transforming P_RP27-RNA5P construct was ectopically integrated into the wild-type strain PH-1 (Fig. 6a). The P_RP27-RNA5P transformants (LT7 and LT10) were normal in growth, conidiation, and sexual reproduction (Fig. 6b). In comparison with the wild type, the expression level of RNA5P was increased over 5-fold in LTB cultures in the P_RP27-RNA5P transformants (Fig. 6c). However, the expression level of TRI5 (Fig. 6c) and DON production (Fig. 6d) were not significantly affected in P_RP27-RNA5P transformants. These results indicate that overexpression of RNA5P ectopically has no inhibitory effects on TRI5 expression and DON biosynthesis. Therefore, the inhibitory effect of RNA5P on TRI5 appears to be cis-acting and require its transcription from the TRI5 locus.

**Fig. 6: Overexpression of RNA5P has no effect on *TRI5* expression and DON production.**

In situ overexpression of RNA5P with the TrpC promoter suppresses TRI5 expression and DON production

To assay the effect of in situ RNA5P overexpression, a 366-bp fragment of the TrpC promoter was inserted 622-bp upstream from the transcription initiation site of RNA5P (126-bp downstream from the predicted Tri6-binding site) by homologous recombination (Fig. 7a). The integration of the TrpC promoter in the promoter region of RNA5P was verified by PCR amplification (Fig. 7a). The P_TrpC-RNA5P transformants (TR1 and TR2) were normal in growth (Fig. 7b). In LTB cultures, the expression level of RNA5P was almost 15-fold higher in the P_TrpC-RNA5P transformant than in the wild type (Fig. 7c), indicating increased expression of RNA5P by the TrpC promoter.

**Fig. 7: In situ overexpression of RNA5P with the TrpC promoter inhibits *TRI5* expression.**

We then assayed TRI5 expression and DON production in LTB cultures. In comparison with the wild type, the expression level of TRI5 was significantly reduced in the P_TrpC-RNA5P transformants (Fig. 7c). DON production was almost non-detectable in the P_TrpC-RNA5P mutants (Fig. 7d). As a control, we also generated transformants with the TrpC promoter sequence integrated at the same site but in the opposite direction (Fig. 7a). Unlike the P_TrpC-RNA5P transformants, the resulting P_{TrpC-inverted}-RNA5P transformants (ATR1 and ATR3) were similar with the wild type in the expression levels of RNA5P and TRI5 (Fig. 7c) as well as DON biosynthesis (Fig. 7d). These results indicate that in situ overexpression of RNA5P by the TrpC promoter negatively impacts TRI5 expression and DON biosynthesis, confirming the cis-acting inhibitory effect of RNA5P.

Elevated expression of RNA5P by the GTGA to TGAG mutation in its promoter also suppresses DON biosynthesis

To confirm the cis-acting effect of RNA5P, we introduced the GTGA (underlined) to TGAG mutation to the TCACGGGCTACAGTGAATGTTCGTGA sequence found at 748-bp upstream from its transcription initial site. This sequence contains two putative Tri6-binding sites²⁶ that overlap at the underlined GTGA (Fig. 8a). In the TRI5^M6B transformants TM6 and TM66 in which the change of underlined GTGA to TGAG was confirmed by PCR amplification and sequencing (Fig. 8b), the expression level of RNA5P was significantly increased in the TRI5^M6B transformants compared to the wild type in LTB cultures (Fig. 8c). In comparison with the wild type, the TRI5^M6B transformants were significantly reduced in the expression level of TRI5 (Fig. 8c) and DON production (Fig. 8d). These results suggest that like the self-inhibitory binding of Tri6 to its own promoter²⁶, binding of Tri6 to this GTGA repeat site is suppressive to the expression of RNA5P. Overexpression of RNA5P in situ by the GTGA to TGAG mutation that eliminates the inhibitory binding of Tri6 to its promoter is repressive to TRI5 expression and DON production, confirming the cis-acting effect of RNA5P (Fig. 8e).

**Fig. 8: The GTGA to TGAG mutation in the promoter of RNA5P affects its expression and DON biosynthesis.**

Discussion

As an important virulence factor, DON biosynthesis plays a critical role in plant infection in F. graminearum. Similar to earlier studies¹⁸, our RNA-seq data showed that both TRI6 and TRI10 are required for the expression of many TRI genes essential for DON biosynthesis. However, microarray analysis with the tri6 and tri10 mutants showed that TRI10 is a pathway-specific regulator while TRI6 functions as a regulator to regulate other genes functionally related to plant infection¹⁸. In this study, we found that deletion of TRI6 only impacted the expression of 56 genes, which was significantly fewer than 450 DEGs in the tri10 mutant. One likely explanation for these contrasting observations is that, although the same strain was used, conditions for RNA isolate was different. For microarray analysis, RNA was isolated from infected wheat heads¹⁸. In this study, RNA used for RNA-seq analysis was isolated from LTB cultures. It is possible that TRI6 regulates more genes related to plant infection but TRI10 regulates many more genes than TRI6 in DON-producing, axenic cultures. In F. graminearum, differences in TRI gene regulation exist between planta and cultures. In F. graminearum, differences in DON biosynthesis between axenic cultures and infected plant tissues have been observed in mutants deleted of TRI14 that encodes a hypothetical protein of no known functions²⁰. In F. sporotrichioides, TRI10 functions as the principal regulatory element, orchestrating the expression of TRI6. While TRI10 regulates many other genes, TRI6 exhibits a more specific role in governing the TRI genes associated with T-2 toxin production^29,30, which is similar to what we observed in F. graminearum. Because sense transcripts are not distinguished from antisense transcripts by conventional microarray analysis and qRT-PCR assays, deletion of TRI10 seemingly displayed no obvious effect on TRI6 expression as shown by Seong and colleagues¹⁸. In this study, we found that TRI6 is one of the three TRI genes with antisense transcripts. In comparison with the wild type, antisense transcripts of TRI6 in the tri10 mutant became more abundant as detected by microarray analysis and qRT-PCR assays¹⁸. For TRI10, it had no antisense transcripts, and its expression was increased over 5-fold in the tri6 mutant, which is similar to the negative regulation of TRI10 by TRI6 in F. sporotrichioides²⁹. Therefore, TRI6 and TRI10 may regulate each other’s expression in LTB cultures with TRI10 is the master, global regulator in F. graminearum. Because TRI6 expression is regulated by TRI10 and lacks any known DNA-binding domain, it is possible that regulation of other TRI genes by TRI10 is mediated by TRI6. In concordance, TRI6 was reported to interact with pathway-specific transcription factor Gra2 for the regulation of gramillin biosynthesis³¹. TRI10 may also regulate different subsets of genes by interacting with pathway-specific transcription factors.

Interestingly, a recent study with the Tri6_nsm mutant carrying a nonsense mutation in TRI6 (no changes in the length of TRI6) and ΔTri6 tk gene replacement mutant (with an increase of 7.0-kp at the TRI6 locus) showed that the expression of TRI10 was elevated in the latter but not in the Tri6_nsm mutant¹⁴, suggesting a possible effect of changes in the length of TRI6 and regional chromatin structures on TRI10 expression. Unlike the 7.0-kb increase the ΔTri6 tk strain, the gene replacement event in the tri6 mutant resulted an increase of only 248-bp at the TRI6 locus¹⁸, which is 2.6-kp upstream from TRI5 (Fig. 1a). The defect of the tri6 mutant in DON biosynthesis was largely complemented by ectopic expression of TRI6¹⁸ confirming that the phenotype observed in the mutant is related to TRI6 deletion. Similarly, the tri10 deletion mutant was complemented by ectopic expression of TRI10 and the gene replacement event at this locus resulted in a shortening of 575-bp¹⁸. Furthermore, changes in chromatin structures usually create an environment that is permissive for similar activation or repression of neighboring genes³², however, the tri6 deletion mutant was significantly reduced in TRI5 expression but increased in TRI10 expression although all three genes in the TRI6-TRI5-TRI10 region are transcribed in the same direction (Fig. 1a). The opposite effects of TRI6 deletion on the expression of TRI5 and TRI10 further indicate that changes in TRI expression in the tri6 mutant is likely due to its transcriptional regulation by TRI6. Nevertheless, we noticed differences in culture conditions and F. graminearum strains used by Liew and colleagues¹⁴ and in this study¹⁸. Because DON is a secondary metabolite, we normally assay DON production and TRI gene expression in cultures of strain PH-1³³ that have been incubated for at least for 72 h. It is also noteworthy that the nonsense mutation at the Methionine (Met) residue (A¹⁰TG¹² to TAG) in the Tri6_nsm mutant of strain JCM 9873¹⁴ is towards the N-terminus of Tri6 and truncated proteins may be translated from downstream in-frame ATG or CTG/GTG codons³⁴. Overall, the regulation on TRI genes is multilayered and involves transcription factors, antisense transcripts, and chromosomal organization.

In comparison with the wild type, the expression of antisense-TRI5 was significantly up-regulated in the tri6 and tri10 mutants, suggesting a negative regulation by TRI6 and TRI10. Because full-length sense transcripts of TRI5 were rare or absent in the tri6 and tri10 mutants, detection of TRI5 expression by qRT-PCR or microarray analysis in both mutants in earlier studies¹⁸ could be due to its antisense transcripts. For the RNA5P lncRNA transcribed from the promoter region of TRI5, its expression is also negatively regulated by both TRI6 and TRI10. Because mutations at the GTGA repeats in its promoter increased RNA5P expression, TRI6 may represses RNA5P expression by inhibitory binding to this predicted Tri6-binding site. For TRI10, it may repress RNA5P expression via its regulation of TRI6. However, repression by inhibitory binding of Tri6 does not explain the low expression level of RNA5P in the wild type under DON producing conditions. Similar to antisense-TRI5, a low-level expression of RNA5P in the wild type may be related to fine adjustment of trichodiene synthase activities to avoid excessive DON or DON toxicity in F. graminearum.

Although lncRNAs have a broad range of mode of actions^35,36, transcriptional regulation of neighboring protein-coding genes is one of the common mechanisms for lncRNAs³⁷. In this study, we showed that deletion of RNA5P by replacing the TRI5 promoter with that of TRI12 resulted in a significant increase in TRI5 expression and DON production although TRI12 has a lower expression level than TRI5. Furthermore, we showed that overexpression RNA5P ectopically with the RP27 promoter had no effect but overexpression of RNA5P in situ with the TrpC promoter reduced TRI5 expression and DON production. In addition, when the Tri6-binding site in the RNA5P promoter region was mutagenized, the expression of RNA5P was significantly increased but TRI5 expression and DON production were suppressed. These results indicated that RNA5P has a cis-acting inhibitory effect on the transcription of TRI5, which is essential for DON biosynthesis. TRI6 may regulate the expression of TRI5 by binding with the RNA5P promoter region upstream of TRI5. The putative Tri6-binding site (GTGA/TCAC repeats separated by 0 to 8 nucleotides) is present in the promoter region of TRI5 in both F. culmorum and F. sporotrichioides although at different positions.

To our knowledge, RNA5P is the first lncRNA known to regulate secondary metabolism in filamentous fungi. In yeast, plants, and animals, some cis-acting lncRNAs mediate gene silencing through the recruitment of polycomb repressive complex 2 (PRC2), while others repress the transcription of target genes by nucleosome rearrangements or formation of RNA-DNA^38,39. In F. graminearum, RNA5P is transcribed from the promoter region of TRI5. The expression of RNA5P lncRNA may inhibit the transcription of TRI5 by causing repositions of nucleosomes or the formation of RNA-DNA triplexes at its transcription initiation sites. It is also possible that RNA5P suppresses TRI5 expression by recruiting PRC2 known to be important for repressing TRI genes and other secondary metabolite gene clusters⁴⁰ to the promoter region of TRI5. Therefore, further characterizations are necessary to determine the molecular mechanism of cis-acting regulation of TRI5 expression by RNA5P in F. graminearum.

Methods

Strains and cultural conditions

The wild type and mutant strains³³ and transformants generated in this study (Supplementary Table 1) were routinely cultured on potato dextrose agar (PDA) plates. PDA cultures incubated at 25 ^oC for three days were used to examine growth rate and colony morphology⁴¹. Conidiation and conidium morphology were assayed with conidia harvested from 5-day-old carboxymethyl cellulose (CMC) cultures⁴². To assess defects in sexual reproduction, aerial hyphae of 5-day-old carrot agar cultures were pressed down with sterile 0.1% Tween 20 and then incubated at 25 °C under black light. Perithecium formation was examined 7 days after induction for sexual reproduction⁴³. PEG-mediated transformation of protoplasts was performed for gene replacement⁴². Hygromycin B (H005, MDbio, China) and geneticin (345810, Sigma-Aldrich, USA) were added to the final concentration of 300 and 150 μg/ml, respectively, for transformation selection.

Plant infection and DON production assays

Conidia were collected from 5-day-old CMC cultures and resuspended to a final concentration of 10⁵ spores/ml in sterile distilled water. For each wheat head of cultivar Xiaoyan 22, the fifth spikelet from the bottom was drop-inoculated with 10 μl of conidium suspension. Wheat heads that underwent inoculation were covered with plastic bags for 48 hours to maintain moisture. Subsequently, the examination of infected wheat heads for diseased spikelets was conducted at 14 days post-inoculation (dpi) to determine the disease index, quantifying the number of diseased spikelets per head^44,45. For assaying DON production, conidia were resuspended to a final concentration of 10⁴ conidia/ml in LTB medium⁴⁶. After incubation for 7 days, DON was measured by GCMS-QP2010 system with AOC-20i autoinjector (Shimadzu Co. Japan)^47,48. For each strain, mean and standard deviation were calculated with data from three biological replicates.

Generation of the TRI6 ^AD, TRI5 ^Δpromoter, tri6, tri10 mutant alleles and transformants

To generate the TRI6^AD allele deleted of the 185-bp putative promoter region of antisense-TRI6 with the split marker approach⁴⁹, 1-kb each of its upstream and downstream fragments was amplified with the primer pairs indicated in Fig. 2c and ligated to the 5’- and 3’- terminal regions of the hygromycin phosphotransferase (hph) cassette fused with the thymidine kinase (TK) by overlapping PCR. The fused hph-TK selectable marker is suitable for selection for resistance against hygromycin and sensitivity to 5-fluoro-2’-deoxyuridine (Floxuridine) in fungi^50,51. The resulting PCR products were transformed into protoplasts of PH-1 to isolate transformants resistant to hygromycin and screen for TRI6^AD mutants by PCR for the deletion of the 185-bp region of TRI6. Similar approaches were used to generate transformants deleted of the promoter of TRI5 (TRI5^Δpromoter) as indicated in Supplementary Fig. 6.

To generate the tri6 mutant (AT6) by replacing the TRI6 gene with a reverse-transcribed hph cassette, its upstream and downstream fragments were amplified with the primer pairs indicated in Supplementary Fig. 2 and ligated to the 3’- and 5’- terminal regions of the hygromycin phosphotransferase (hph) cassette by overlapping PCR. The resulting PCR products were transformed into protoplasts of PH-1 to isolate transformants resistant to hygromycin and screen for the tri6 mutants by PCR. Similar approaches were used to generate the tri10 deletion mutant (AT10). All the primers used are listed in Supplementary Data 3.

Generation of the TRI6 ^ME, TRI5 ^M6B and RNA5P^M mutants

To generate the TRI6^ME allele, the GT-AG to AT-TG mutations were introduced by overlapping PCR with mutations in the primers. The resulting mutant allele were fused with flanking sequences of TRI6 amplified with primer pairs T6Y-1F/MER and MEF/T6Y-4R and transformed into protoplasts of TRI6^AD transformant. Transformants resistant to 25 μg/ml floxuridine (HY-B0097, MCE, USA) were isolated and screened by PCR for the replacement of hph-TK with the TRI6^ME allele by homologous recombination^50,51. For TRI5^M6B, the GTGA to TGAG mutation at −1482 to −1479 was introduced by overlapping PCR with mutations in the primer pairs indicated in Fig. 8a. The resulting TRI5^M6B fragment was then fused with flanking sequences of TRI5 and transformed into protoplasts of the TRI5^Δpromoter mutant T5P. Floxuridine-resistant transformants were isolated and screened for the replacement of hph-TK with TRI5^M6B. Similar approaches were used to generate the RNA5P^M transformant which has an adenine (A) insertion in the RNA5P as indicated in Fig. 4e. All the primers used were listed in Supplementary Data 3.

Generation of P_TRI12-TRI5, P_TrpC-RNA5P and P_{TrpC-inverted}-RNA5P transformants

To replace the promoter of TRI5 with that of TRI12, a fragment containing the TRI12 promoter region was amplified with primer pairs indicated in Fig. 5b and fused to the upstream or downstream flanking sequences of TRI5 by overlapping PCR. The resulting PCR products were transformed into protoplasts of the TRI5^Δpromoter mutant T5P. Transformants resistant to floxuridine were isolated and screened by PCR for the replacement of hph-TK with TRI5 promoter. To generate the P_TrpC-RNA5P transformants, the TrpC promoter was fused with the upstream and downstream flanking sequences of RNA5P amplified with primer pairs T5Y-1F/TR-2R, TR-5F/T5Y-4R by overlapping PCR. The resulting PCR products were transformed into the TRI5^Δpromoter mutant T5P. Transformants resistant to floxuridine were isolated and verified for the integration of P_TrpC-RNA5P at TRI5. Similar approaches were used to generate P_{TrpC-inverted}-RNA5P transformant in which the TrpC promoter is in the opposite direction of RNA5P transcription. All the primers used were listed in Supplementary Data 3.

Generation of P_RP27-RNA5P and P_RP27-antisense-TRI5 constructs and transformants

The yeast gap repair approach⁵² was used to generate the andP_RP27-RNA5P and P_RP27-antisense-TRI5 constructs. For RNA5P, it was amplified with primer pair LT1F/LT2R and fused with the CaMV ployA signal terminator⁵³ amplified with primer pair LT3F/LT4R. The resulting PCR product was co-transformed with XhoI-digested pFL2 (geneticin resistance) into yeast strain XK1-25⁵⁴. The recombined P_RP27-RNA5P construct was rescued from Trp+ transformants and transformed into PH-1 after verification by sequencing. Transformants resistant to geneticin were isolated and verified by PCR for the integration of P_RP27-RNA5P ectopically.

For antisense-TRI5, a 299-bp fragment corresponding to 449-747 bp of the TRI5 sense transcript was amplified with primer pair SF1/SR2. The resulting PCR product was closed into pFL2 by gap repair as outlined above. The P_RP27-RNA5P construct was verified by sequence analysis and transformed into protoplasts of PH-1. Geneticin-resistant transformants were isolated and verified by PCR for the integration of P_RP27-antisense-TRI5 ectopically. All the primers used were listed in Supplementary Data 3.

Stranded RNA-seq analysis

Total RNAs were isolated from hyphae harvested from 3-day-old LTB cultures with the TRIzol reagent for RNA-seq analysis (15596018, Invitrogen, USA). Conidia used to inoculate LTB were collected from 5-day-old CMC cultures. Strand-specific RNA-seq libraries constructed with the NEB Next Ultra Directional RNA Library Prep Kit (E7765, NEB, USA) were sequenced with Illumina HiSeq 2500 at Novogene Bioinformatics Technology (China). The resulting RNA-seq reads were mapped onto the updated version (Named YL1) of the reference genome of F. graminearum strain PH-1⁵⁵ by HISAT2⁵⁶ and visualized with the Integrative Genomics Viewer (IGV) tool (software.broadinstitute.org/software/igv/)⁵⁵. The number of reads (count) mapped to each gene was calculated by feature Counts⁵⁷. Genes with log₂FC greater than 1 and FDR less than 0.05⁵⁸ were identified as Differentially Expressed Genes (DEGs) using the edge Run package with the exact Test function. GO enrichment analysis was analyzed with Blast2GO⁵⁹. Data from two independent biological replicates were used for differential expression analysis. The RNA-seq data generated in this study have been deposited in the NCBI Sequence Read Archive database under accession code PRJNA1044545. The reference genome of F. graminearum strain PH-1⁵⁵ used in this study is available in the NCBI GenBank database under accession code PRJNA782099.

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assays

Total RNA of each strain was isolated from 3-day-old LTB cultures with TRIzol for qRT-PCR assay (Invitrogen, USA). Conidia used to inoculate LTB were collected from 5-day-old CMC cultures. First-strand cDNA was synthesized with Fast Quant RT Kit (KP1116, TIANGEN, China) before performing qRT-PCR assays with the CFX96 Real-Time System (Bio-RAD, USA)⁶⁰. Primer pairs for amplifying RNA5P, TRI5, antisense-TRI5, TRI6, antisense-TRI6, TRI10, and TRI12 are 5PRT1/5RPT2, TF1/TR2, AF3/AF4, T6RTF/T6RTR (for both TRI6 and antisense-TRI6), T10RTF/T10RTR and T12RTF/T12RTR, respectively. The ACTIN gene (FG4G14550) was used as the internal control²⁸. The relative expression level of individual genes or transcripts was calculated by the 2^–ΔΔCt method⁶¹. Data from three independent biological replicates were used to calculate the mean and standard deviation. All the primers used were listed in Supplementary Data 3.

Western blot analysis with the RNA5P-3×FLAG transformants

To generate the P_RP27-RNA5P-3×FLAG-T_CaMV construct by yeast gap repair⁵², the RNA5P-3×FLAG fusion construct was generated by PCR amplification with primers pair LT1F/L3F-R and fused with the CaMV ployA terminator⁵³ by overlapping PCR. The resulting PCR product was co-transformed with XhoI-digested pFL2 into yeast strain XK1-25⁵⁴. The recombined P_RP27-RNA5P-3×FLAG-T_CaMV construct was rescued from Trp+ transformants and transformed into PH-1 after verification by sequencing. Transformants resistant to geneticin were screened by PCR. Total proteins were isolated from the resulting transformants with hyphae harvested from 3-day-old LTB cultures. For western blot analyses, total proteins were separated on 12.5% SDS-PAGE gels and transferred to nitrocellulose membranes⁵⁴. The primary anti-FLAG antibody (F9291, Sigma, USA) and secondary anti-Mouse antibody (DY60203, DEEYEE, China) were used to detect the expression of RNA5P-3×FLAG fusion proteins. Detection with a primary anti-Tub2 β-tubulin antibody (HA720035, HUABIO, China)⁶² and secondary anti-Rabbit antibody (DY60202, DEEYEE, China) were used as the loading control. Proteins isolated from the ESA1−3×FLAG transformant²⁸ were used as the positive control for detection with the anti-FLAG antibody. A dilution of 1:1,000 is used for primary antibodies and 1:10,000 for secondary antibodies.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Data supporting the findings of this work are available within the paper and its Supplementary Information files. The RNA-seq data generated in this study have been deposited in the NCBI Sequence Read Archive database under accession code PRJNA1044545. The reference genome of F. graminearum strain PH-1 used in this study is available in the NCBI GenBank database under accession code PRJNA782099. Source data are provided with this paper.

References

Ma, Z. et al. Germplasms, genetics and genomics for better control of disastrous wheat Fusarium head blight. Theor. Appl. Genet. 133, 1541–1568 (2020).
Article PubMed Google Scholar
Khan, M. K. et al. Fusarium head blight in wheat: contemporary status and molecular approaches. 3 Biotech 10, 172 (2020).
Article PubMed PubMed Central Google Scholar
Ma, H., Liu, Y., Zhao, X., Zhang, S. & Ma, H. Exploring and applying genes to enhance the resistance to Fusarium head blight in wheat. Front. Plant Sci. 13, 1026611 (2022).
Article PubMed PubMed Central Google Scholar
Goswami, R. S. & Kistler, H. C. Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 5, 515–525 (2004).
Article CAS PubMed Google Scholar
Audenaert, K., Vanheule, A., Hofte, M. & Haesaert, G. Deoxynivalenol: a major player in the multifaceted response of Fusarium to its environment. Toxins (Basel) 6, 1–19 (2013).
Article PubMed Google Scholar
Jansen, C. et al. Infection patterns in barley and wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted Fusarium graminearum. Proc. Natl Acad. Sci. USA 102, 16892–16897 (2005).
Article ADS CAS PubMed PubMed Central Google Scholar
Chen, Y., Kistler, H. C. & Ma, Z. Fusarium graminearum Trichothecene Mycotoxins: Biosynthesis, Regulation, and Management. Annu. Rev. Phytopathol. 57, 15–39 (2019).
Article CAS PubMed Google Scholar
Proctor, R. H., Hohn, T. M. & McCormick, S. P. Reduced virulence of Gibberella zeae caused by disruption of a trichothecene toxin biosynthetic gene. Mol. Plant Microbe Interact. 8, 593–601 (1995).
Article CAS PubMed Google Scholar
Bonnighausen, J., Schauer, N., Schafer, W. & Bormann, J. Metabolic profiling of wheat rachis node infection by Fusarium graminearum - decoding deoxynivalenol-dependent susceptibility. N. Phytol. 221, 459–469 (2019).
Article Google Scholar
Bai, G. H., Desjardins, A. E. & Plattner, R. D. Deoxynivalenol-nonproducing Fusarium graminearum causes initial infection, but does not cause disease spread in wheat spikes. Mycopathologia 153, 91–98 (2002).
Article CAS PubMed Google Scholar
Ward, T. J., Bielawski, J. P., Kistler, H. C., Sullivan, E. & O’Donnell, K. Ancestral polymorphism and adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic. Fusarium. Proc. Natl Acad. Sci. USA 99, 9278–9283 (2002).
Article ADS CAS PubMed Google Scholar
Kimura, M., Tokai, T., Takahashi-Ando, N., Ohsato, S. & Fujimura, M. Molecular and genetic studies of fusarium trichothecene biosynthesis: pathways, genes, and evolution. Biosci. Biotechnol. Biochem. 71, 2105–2123 (2007).
Article CAS PubMed Google Scholar
Proctor, R. H., McCormick, S. P., Alexander, N. J. & Desjardins, A. E. Evidence that a secondary metabolic biosynthetic gene cluster has grown by gene relocation during evolution of the filamentous fungus Fusarium. Mol. Microbiol. 74, 1128–1142 (2009).
Article CAS PubMed Google Scholar
Liew, M. X. X., Nakajima, Y., Maeda, K., Kitamura, N. & Kimura, M. Regulatory mechanism of trichothecene biosynthesis in Fusarium graminearum. Front. Microbiol. 14, 1148771 (2023).
Article PubMed PubMed Central Google Scholar
Alexander, N. J., Proctor, R. H. & McCormick, S. P. Genes, gene clusters, and biosynthesis of trichothecenes and fumonisins in Fusarium. Toxin Rev. 28, 198–215 (2009).
Article CAS Google Scholar
Menke, J., Weber, J., Broz, K. & Kistler, H. C. Cellular development associated with induced mycotoxin synthesis in the filamentous fungus Fusarium graminearum. PLoS One 8, e63077 (2013).
Article ADS CAS PubMed PubMed Central Google Scholar
Flynn, C. M., Broz, K., Jonkers, W., Schmidt-Dannert, C. & Kistler, H. C. Expression of the Fusarium graminearum terpenome and involvement of the endoplasmic reticulum-derived toxisome. Fungal Genet. Biol. 124, 78–87 (2019).
Article CAS PubMed PubMed Central Google Scholar
Seong, K. Y. et al. Global gene regulation by Fusarium transcription factors Tri6 and Tri10 reveals adaptations for toxin biosynthesis. Mol. Microbiol. 72, 354–367 (2009).
Article CAS PubMed Google Scholar
Menke, J., Dong, Y. & Kistler, H. C. Fusarium graminearum Tri12p influences virulence to wheat and trichothecene accumulation. Mol. Plant Microbe Interact. 25, 1408–1418 (2012).
Article CAS PubMed Google Scholar
Dyer, R. B., Plattner, R. D., Kendra, D. F. & Brown, D. W. Fusarium graminearum TRI14 is required for high virulence and DON production on wheat but not for DON synthesis in vitro. J. Agric. Food Chem. 53, 9281–9287 (2005).
Article CAS PubMed Google Scholar
Brown, D. W., McCormick, S. P., Alexander, N. J., Proctor, R. H. & Desjardins, A. E. Inactivation of a cytochrome P-450 is a determinant of trichothecene diversity in Fusarium species. Fungal Genet. Biol. 36, 224–233 (2002).
Article CAS PubMed Google Scholar
McCormick, S. P. et al. Tri1 in Fusarium graminearum encodes a P450 oxygenase. Appl. Environ. Microbiol. 70, 2044–2051 (2004).
Article ADS CAS PubMed PubMed Central Google Scholar
Lee, T., Han, Y. K., Kim, K. H., Yun, S. H. & Lee, Y. W. Tri13 and Tri7 determine deoxynivalenol- and nivalenol-producing chemotypes of Gibberella zeae. Appl. Environ. Microbiol. 68, 2148–2154 (2002).
Article ADS CAS PubMed PubMed Central Google Scholar
Jiang, C. et al. TRI6 and TRI10 play different roles in the regulation of deoxynivalenol (DON) production by cAMP signalling in Fusarium graminearum. Environ. Microbiol. 18, 3689–3701 (2016).
Article CAS PubMed Google Scholar
Hohn, T. M., Krishna, R. & Proctor, R. H. Characterization of a transcriptional activator controlling trichothecene toxin biosynthesis. Fungal Genet. Biol. 26, 224–235 (1999).
Article CAS PubMed Google Scholar
Nasmith, C. G. et al. Tri6 is a global transcription regulator in the phytopathogen Fusarium graminearum. PLoS Pathog. 7, e1002266 (2011).
Article CAS PubMed PubMed Central Google Scholar
Bourett, T. M., Sweigard, J. A., Czymmek, K. J., Carroll, A. & Howard, R. J. Reef coral fluorescent proteins for visualizing fungal pathogens. Fungal Genet. Biol. 37, 211–220 (2002).
Article CAS PubMed Google Scholar
Jiang, H. et al. Opposing functions of Fng1 and the Rpd3 HDAC complex in H4 acetylation in Fusarium graminearum. PLoS Genet. 16, e1009185 (2020).
Article CAS PubMed PubMed Central Google Scholar
Tag, A. G. et al. A novel regulatory gene, Tri10, controls trichothecene toxin production and gene expression. Appl. Environ. Microbiol. 67, 5294–5302 (2001).
Article ADS CAS PubMed PubMed Central Google Scholar
Peplow, A. W., Tag, A. G., Garifullina, G. F. & Beremand, M. N. Identification of new genes positively regulated by Tri10 and a regulatory network for trichothecene mycotoxin production. Appl. Environ. Microbiol. 69, 2731–2736 (2003).
Article ADS CAS PubMed PubMed Central Google Scholar
Shostak, K. et al. Activation of biosynthetic gene clusters by the global transcriptional regulator TRI6 in Fusarium graminearum. Mol. Microbiol. 114, 664–680 (2020).
Article CAS PubMed Google Scholar
Sproul, D., Gilbert, N. & Bickmore, W. A. The role of chromatin structure in regulating the expression of clustered genes. Nat. Rev. Genet. 6, 775–781 (2005).
Article CAS PubMed Google Scholar
Cuomo, C. A. et al. The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Sci. (N. Y., N. Y.) 317, 1400–1402 (2007).
Article ADS CAS Google Scholar
Wei, J., Zhang, Y., Ivanov, I. P. & Sachs, M. S. The stringency of start codon selection in the filamentous fungus Neurospora crassa. J. Biol. Chem. 288, 9549–9562 (2013).
Article CAS PubMed PubMed Central Google Scholar
Mercer, T. R., Dinger, M. E. & Mattick, J. S. Long non-coding RNAs: insights into functions. Nat. Rev. Genet. 10, 155–159 (2009).
Article CAS PubMed Google Scholar
Mattick, J. S. et al. Long non-coding RNAs: definitions, functions, challenges and recommendations. Nat. Rev. Mol. Cell Biol. 24, 430–447 (2023).
Article CAS PubMed Google Scholar
Mattick, J. S. & Gagen, M. J. The evolution of controlled multitasked gene networks: the role of introns and other noncoding RNAs in the development of complex organisms. Mol. Biol. Evol. 18, 1611–1630 (2001).
Article CAS PubMed Google Scholar
Statello, L., Guo, C. J., Chen, L. L. & Huarte, M. Gene regulation by long non-coding RNAs and its biological functions. Nat. Rev. Mol. Cell Biol. 22, 96–118 (2021).
Article CAS PubMed Google Scholar
Gil, N. & Ulitsky, I. Regulation of gene expression by cis-acting long non-coding RNAs. Nat. Rev. Genet. 21, 102–117 (2020).
Article CAS PubMed Google Scholar
Connolly, L. R., Smith, K. M. & Freitag, M. The Fusarium graminearum histone H3 K27 methyltransferase KMT6 regulates development and expression of secondary metabolite gene clusters. PLoS Genet. 9, e1003916 (2013).
Article PubMed PubMed Central Google Scholar
Ren, J. et al. Deletion of all three MAP kinase genes results in severe defects in stress responses and pathogenesis in Fusarium graminearum. Stress Biol. 2, 6 (2022).
Article CAS PubMed PubMed Central Google Scholar
Hou, Z. et al. A mitogen-activated protein kinase gene (MGV1) in Fusarium graminearum is required for female fertility, heterokaryon formation, and plant infection. Mol. Plant Microbe Interact. 15, 1119–1127 (2002).
Article CAS PubMed Google Scholar
Wang, C. et al. Functional analysis of the kinome of the wheat scab fungus Fusarium graminearum. PLoS Pathog. 7, e1002460 (2011).
Article CAS PubMed PubMed Central Google Scholar
Gale, L. R., Ward, T. J., Balmas, V. & Kistler, H. C. Population subdivision of Fusarium graminearum sensu stricto in the upper midwestern United States. Phytopathology 97, 1434–1439 (2007).
Article CAS PubMed Google Scholar
Jiang, C. et al. An expanded subfamily of G-protein-coupled receptor genes in Fusarium graminearum required for wheat infection. Nat. Microbiol. 4, 1582–1591 (2019).
Article CAS PubMed Google Scholar
Gardiner, D. M., Kazan, K. & Manners, J. M. Novel genes of Fusarium graminearum that negatively regulate deoxynivalenol production and virulence. Mol. Plant Microbe Interact. 22, 1588–1600 (2009).
Article CAS PubMed Google Scholar
Jiang, C. et al. An orphan protein of Fusarium graminearum modulates host immunity by mediating proteasomal degradation of TaSnRK1α. Nat. Commun. 11, 4382 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Goswami, R. S. & Kistler, H. C. Pathogenicity and in planta mycotoxin accumulation among members of the fusarium graminearum species complex on wheat and rice. Phytopathology 95, 1397–1404 (2005).
Article CAS PubMed Google Scholar
Catlett, N. L., Lee, B.-N., Yoder, O. C. & Turgeon, B. G. Split-marker recombination for efficient targeted deletion of fungal genes. Fungal Genet. Rep. 50, 9–11 (2003).
Article Google Scholar
Krappmann, S., Bayram, O. & Braus, G. H. Deletion and allelic exchange of the Aspergillus fumigatus veA locus via a novel recyclable marker module. Eukaryot. Cell 4, 1298–1307 (2005).
Article CAS PubMed PubMed Central Google Scholar
Qiu, J. et al. Localisation of the benzimidazole fungicide binding site of Gibberella zeae β₂-tubulin studied by site-directed mutagenesis. Pest Manag. Sci. 67, 191–198 (2011).
Article CAS PubMed Google Scholar
Bruno, K. S., Tenjo, F., Li, L., Hamer, J. E. & Xu, J. R. Cellular localization and role of kinase activity of PMK1 in Magnaporthe grisea. Eukaryot. Cell 3, 1525–1532 (2004).
Article CAS PubMed PubMed Central Google Scholar
Sanfaçon, H. & Wieczorek, A. Analysis of cauliflower mosaic virus RNAs in Brassica species showing a range of susceptibility to infection. Virology 190, 30–39 (1992).
Article PubMed Google Scholar
Zhou, X., Zhang, H., Li, G., Shaw, B. & Xu, J. R. The cyclase-associated protein Cap1 is important for proper regulation of infection-related morphogenesis in Magnaporthe oryzae. PLoS Pathog. 8, e1002911 (2012).
Article CAS PubMed PubMed Central Google Scholar
Lu, P. et al. Landscape and regulation of alternative splicing and alternative polyadenylation in a plant pathogenic fungus. N. Phytol. 235, 674–689 (2022).
Article CAS Google Scholar
Kim, D., Langmead, B. & Salzberg, S. L. HISAT: a fast spliced aligner with low memory requirements. Nat. Methods 12, 357–360 (2015).
Article CAS PubMed PubMed Central Google Scholar
Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930 (2014).
Article CAS PubMed Google Scholar
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Article PubMed PubMed Central Google Scholar
Conesa, A. et al. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 21, 3674–3676 (2005).
Article CAS PubMed Google Scholar
Duan, K. et al. Herbicide 2,4-dichlorophenoxyacetic acid interferes with MAP kinase signaling in Fusarium graminearum and is inhibitory to fungal growth and pathogenesis. Stress Biol. 3, 31 (2023).
Article CAS PubMed PubMed Central Google Scholar
Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2^–ΔΔCt Method. Methods 25, 402–408 (2001).
Article CAS PubMed Google Scholar
Wang, H. et al. Stage-specific functional relationships between Tub1 and Tub2 beta-tubulins in the wheat scab fungus Fusarium graminearum. Fungal Genet. Biol. 132, 103251 (2019).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank Zhe Tang, Ping Xiang, Yuhan Zhang, Xinyu Cao, Xinlong Gao for assistance with sample preparation, DON measurement, and microscopic observation. We also thank Drs. Qinhu Wang, Guanghui Wang, and Ming Xu for fruitful discussions. This work was supported by grants from the National Key R&D Program of China (2022YFD1400100), Shaanxi Science Fund for Distinguished Young Scholars (2022JC-14), the National Youth Talent Support Program, and Innovation Capability Support Program of Shaanxi (No. 2023-CX-TD-56) to CJ as well as a grant from the USWBSI to JRX.

Author information

Authors and Affiliations

State Key Laboratory for Crop Stress Resistance and High-Efficiency Production, College of Plant Protection, Northwest A&F University, Yangling, Shaanxi, 712100, China
Panpan Huang, Xiao Yu, Huiquan Liu, Mingyu Ding & Cong Jiang
Department of Botany and Plant Pathology, Purdue University, West Lafayette, IN, 47907, USA
Panpan Huang, Zeyi Wang & Jin-Rong Xu

Authors

Panpan Huang
View author publications
You can also search for this author in PubMed Google Scholar
Xiao Yu
View author publications
You can also search for this author in PubMed Google Scholar
Huiquan Liu
View author publications
You can also search for this author in PubMed Google Scholar
Mingyu Ding
View author publications
You can also search for this author in PubMed Google Scholar
Zeyi Wang
View author publications
You can also search for this author in PubMed Google Scholar
Jin-Rong Xu
View author publications
You can also search for this author in PubMed Google Scholar
Cong Jiang
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

J.R.X., C.J., and P.H. conceived and designed the experiments; P.H., X.Y., M.D., and Z.W. performed the experiments; P.H., H.L., and C.J. contributed materials/analysis tools and analyzed the data; J.R.X., C.J., and P.H. wrote the paper.

Corresponding authors

Correspondence to Jin-Rong Xu or Cong Jiang.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Makoto Kimura and the other, anonymous, reviewers for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Description of Additional Supplementary Files

Supplementary Dataset 1

Supplementary Dataset 2

Supplementary Dataset 3

Reporting Summary

Source data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Huang, P., Yu, X., Liu, H. et al. Regulation of TRI5 expression and deoxynivalenol biosynthesis by a long non-coding RNA in Fusarium graminearum. Nat Commun 15, 1216 (2024). https://doi.org/10.1038/s41467-024-45502-w

Download citation

Received: 18 August 2023
Accepted: 24 January 2024
Published: 09 February 2024
DOI: https://doi.org/10.1038/s41467-024-45502-w

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.