hapln1a+ cells guide coronary growth during heart morphogenesis and regeneration

Sun, Jisheng; Peterson, Elizabeth A.; Chen, Xin; Wang, Jinhu

doi:10.1038/s41467-023-39323-6

Download PDF

Article
Open access
Published: 13 June 2023

hapln1a⁺ cells guide coronary growth during heart morphogenesis and regeneration

Nature Communications volume 14, Article number: 3505 (2023) Cite this article

1985 Accesses
2 Citations
4 Altmetric
Metrics details

Subjects

Abstract

Although several tissues and chemokines orchestrate coronary formation, the guidance cues for coronary growth remain unclear. Here, we profile the juvenile zebrafish epicardium during coronary vascularization and identify hapln1a⁺ cells enriched with vascular-regulating genes. hapln1a⁺ cells not only envelop vessels but also form linear structures ahead of coronary sprouts. Live-imaging demonstrates that coronary growth occurs along these pre-formed structures, with depletion of hapln1a⁺ cells blocking this growth. hapln1a⁺ cells also pre-lead coronary sprouts during regeneration and hapln1a⁺ cell loss inhibits revascularization. Further, we identify serpine1 expression in hapln1a⁺ cells adjacent to coronary sprouts, and serpine1 inhibition blocks vascularization and revascularization. Moreover, we observe the hapln1a substrate, hyaluronan, forming linear structures along and preceding coronary vessels. Depletion of hapln1a⁺ cells or serpine1 activity inhibition disrupts hyaluronan structure. Our studies reveal that hapln1a⁺ cells and serpine1 are required for coronary production by establishing a microenvironment to facilitate guided coronary growth.

Coordination of endothelial cell positioning and fate specification by the epicardium

Article Open access 06 July 2021

Perinatal angiogenesis from pre-existing coronary vessels via DLL4–NOTCH1 signalling

Article 08 September 2021

Regulatory pathways governing murine coronary vessel formation are dysregulated in the injured adult heart

Article Open access 22 July 2019

Introduction

Adult humans lack the capacity to regenerate lost contractile tissues and this deficiency leads to heart failure, which has no final therapeutic strategy available and remains the leading cause of death worldwide^1,2. Recent studies demonstrated mammalian cardiomyocyte turnover occurs throughout life^3,4,5, suggesting an endogenous regeneration program exists in mammals. However, this program cannot be efficiently initiated or completed to effectively restore lost cardiac tissue. Elucidating the mechanisms of endogenous cardiac regeneration will facilitate the development of regenerative therapeutic strategies. Previous studies in neonatal mice, zebrafish, newts, and urodele amphibians demonstrated their robust capacity to significantly regenerate damaged cardiac tissues^6,7,8,9. These reports also identified multiple cell types and molecules with roles in endogenous heart regeneration, but the details of their coordination to ensure successful regeneration is largely unknown.

As a crucial step in mammalian heart repair and regeneration, coronary revascularization therapies are an effective means to treat ischemic heart disease and are considered a promising strategy for myocardial restoration^10,11,12. Currently, only large-caliber vessels can be targeted in therapy and the mechanisms of coronary revascularization during regeneration are still under investigation. Fully characterizing coronary growth will help in the pursuit of better tools and interventions to stimulate efficient heart repair and regeneration. Cardiac tissues and macrophages were previously identified as essential factors for coronary expansion, migration, patterning, and remodeling^13,14,15,16. Mitogens and chemokines like VEGF, IGF, and Cxcl12 play vital roles during coronary growth, and some of these factors are speculated to guide coronary expansion^12,15,16,17. As these proposed guiding molecules are not well illustrated in their derived tissues, the direct interaction of these cues with coronary growth tips has yet to be observed.

The epicardium is a mesothelial cell layer enveloping the outer surface of the vertebrate heart and conducts multiple functions in cardiac development and regeneration^18,19,20,21. Due to their functional roles, there is increasing interest in targeting epicardial cells to promote heart repair²². However, the epicardium itself is a heterogeneous tissue and which subpopulations offer benefits to cardiac regeneration events is far from clear. Recent gene expression profiling analyses identified an epicardial cell subset that surrounds and supports proliferating cardiomyocytes during myocardial compaction and regeneration²³, suggesting a “niche” effect of an epicardial subpopulation on generating new contractile tissues. As the epicardium is also required for coronary vascularization and revascularization^12,24, there is likely an epicardial cell cluster responsible for coronary growth during heart morphogenesis and regeneration. Presently, an epicardial cell subtype that supports vascular growth has yet to be identified.

To explore the effect of epicardial cell clusters on coronary production, we initially focused on coronary vascularization as tissue injury promotes organ developmental programs to restart. Moreover, coronary vascularization encompasses a simpler environment than revascularization, which incurs strong injury-induced stress/inflammatory responses. Here, we first examined epicardial cells with scRNA-seq analysis during the juvenile stage when robust coronary vascularization occurs in compact muscles and detected hapln1a⁺ epicardial cells enriched with angiogenesis genes. Then, fluorescence reporter assays indicated that hapln1a⁺ cells not only surround coronary vessels but also form pre-leading linear structures in advance of coronary sprouts. Next, we visualized coronary growth in juvenile heart surfaces and observed coronary extension along hapln1a⁺ cellular structures, while hapln1a⁺ cell depletion blocked such coronary growth. We also discovered hapln1a⁺ cells exist ahead of coronary sprouts in the regenerating area of adult hearts and depleting hapln1a⁺ cells blocked coronary revascularization. After examining gene expression in hapln1a⁺ cells from juvenile and regenerating hearts with scRNA-seq and in situ hybridization analyses, we detected hapln1a⁺ cells locally expressed serpine1, a gene previously implicated in cancer angiogenesis, metastasis, and with expression around coronary sprouts. Pharmacological inhibition of serpine1 function resulted in coronary growth blockage during heart morphogenesis and regeneration. Furthermore, we found that the hapln1a substrate, hyaluronan (HA), formed a linear structure along and preceding the coronary vessels. Depletion of hapln1a⁺ cells or inhibition of serpine1 activity disrupted the HA structure. Our results demonstrate that hapln1a⁺ cells are required for coronary production by creating a local environment to facilitate coronary growth and reveal a key cellular player of coronary regrowth during heart regeneration.

Results

hapln1a ⁺ epicardial cell clusters in juvenile hearts are enriched with angiogenesis factors

Zebrafish coronary growth establishes a dense vasculature network from 5 to 6 weeks post-fertilization (wpf) until the adult stage, a period during which latent epicardial clusters are also undergoing development²³. As cardiac regeneration recapitulates many aspects of heart morphogenesis and detection of epicardial cell clusters at the juvenile stage has not been reported, we performed scRNA-seq analysis with tcf21⁺ cells²⁵ in zebrafish hearts at 7 wpf (Supplementary Fig. 1) to explore juvenile epicardial clusters and their potential effects on coronary growth. After performing stringent filtering to discard a small number of non-epicardial cell types like cardiomyocytes (myl7)²⁶, endothelial cells (fli1a)¹⁶, and hematopoietic cells (gata1a, lcp1)^27,28, we obtained high-quality transcriptomes of 733 tcf21⁺ cells. Unsupervised clustering identified 6 clusters, with each cluster possessing characteristic gene expression patterns (Fig. 1a–c and Supplementary Fig. 2). Clusters 1 and 3 revealed a high degree of expression overlap for genes associated with vascular growth and extracellular matrix (ECM) organization, as both clusters expressed high levels of fn1a and ntn1^29,30. Although it is unclear whether they represent distinct cellular identities, we observed a notable difference in cluster 3 with high levels of expression of genes related to cell proliferation, such as frzb, mustn1a, and tgfbi^31,32,33. Cluster 2 cells predominantly displayed retinoic acid metabolic processing genes, such as aldh1a2 and crabp1a^34,35. Cluster 4 cells highly expressed several genes implicated in translation, such as rpl39 and rps21^36,37. The expression of ciartα and dbpβ in cluster 5 suggests an involvement in the circadian rhythm process^38,39. Cluster 6 cells expressed cxcl12b and sema4ba, indicative of chemotaxis roles^40,41. Among these cells, clusters 1, 3, and 6 displayed enrichment in vascular growth-related genes (Fig. 1c). As cluster 1 is the most heavily represented of these 3 cell states, we first focused on cluster 1 and observed high expression of hapln1a in this cluster²³, with slight expression in clusters 3, 4, and 5 (Fig. 1d and Supplementary Fig. 3). To determine whether hapln1a⁺ cells have elevated expression of angiogenesis-related genes, we compared gene expression in tcf21⁺/hapln1a⁺ cells vs. tcf21⁺/hapln1a^- cells (Fig. 1e). These results showed an enrichment of angiogenesis-related genes such as angptl2b, dcn, cxcl12a, fstl1b, and rspo3^{42,43,44,45,46} in hapln1a⁺ cells, and gene ontology analysis further revealed angiogenesis as a top enrichment factor in hapln1a⁺ cells (Fig. 1e and f), suggesting hapln1a⁺ cells regulate coronary vascularization.

**Fig. 1: Single-cell RNA-sequencing reveals hapln1a+ epicardial clusters are enriched with angiogenesis factors during coronary vascularization.**

hapln1a ⁺ cells pre-lead coronary sprouts during vascularization

To determine the interaction between hapln1a⁺ cells and coronary vessels, we examined juvenile hapln1a:mCherry;deltaC:EGFP fish, whose transgenes have been utilized to visualize hapln1a⁺ cells and coronary endothelial cells, respectively^23,47. We observed EGFP fluorescence signals surrounded by mCherry⁺ signals (Fig. 2a), indicating that hapln1a⁺ cells wrap around coronary vessels and behave as perivascular cells⁴⁸. We then analyzed the scRNA-seq data for perivascular cell markers and observed pdgfrβ expression in clusters 1 and 6⁴⁹ (Supplementary Fig. 4). Interestingly, we further noticed that mCherry⁺ cells formed linear structures located ahead of EGFP⁺ cells (Fig. 2b). These observations were surprising, as perivascular cells are known for their recruitment to newly formed vessels for stabilization and maturation, and they normally develop after or in parallel with vessel sprouts^50,51. To confirm these observations and determine whether we uncovered a rare phenomenon, we categorized and quantified three hapln1a⁺ cell position types according to their localization with coronary sprouts in juvenile ventricles: hapln1a⁺ cells trailing, in parallel, or in advance of deltaC⁺ cells (Fig. 2c). The results indicated that the position type of hapln1a⁺ cells in advance of deltaC⁺ cells is dominant (82%) (Fig. 2d), suggesting a spatial correlation of hapln1a⁺ cells with coronary sprouts during vascularization.

**Fig. 2: hapln1a+ cells form cellular structures in advance of coronary sprouts during vascularization.**

Coronary sprouts are not tightly correlated with macrophages, nerves, or the myocardium

As previous studies suggest macrophages, nerves, and cardiomyocytes affect coronary vasculature formation^{13,14,17,52,53,54}, we asked whether these tissues have a spatial correlation with coronary sprouts. To assess the association of coronary growth with macrophages, we extracted juvenile deltaC:EGFP fish hearts and performed IB4 staining for macrophage visualization⁵⁵. We observed some macrophages close to coronary vessels (Fig. 2e), but we seldomly detected macrophages located directly ahead of coronary sprouts.

Due to the observed alignment of blood vessels and nerves in many adult peripheral tissues, it is speculated that these cells follow each other’s growing path⁵⁶. As zebrafish ventricular innervation occurs during coronary vascularization⁵⁷, we then asked if coronary growth associates with nerve fibers. To test this possibility, we isolated hearts from juvenile deltaC:EGFP fish and performed antibody staining against acetylated α-tubulin (AcT) and human neuronal C/D (Hu) to visualize heart innervation^57,58, an established label combination which has previously been used to detect neuronal somas in neuroanatomical studies in the zebrafish intestine and goldfish heart^59,60,61. We observed some EGFP⁺ signals and AcT-Hu⁺ cells in parallel in the ventricular surface, but EGFP⁺ cell extensions were not close to AcT-Hu⁺ cells (Fig. 2f). These observations indicate alignment of zebrafish coronary vessels with nerve fibers in the heart chamber, but coronary sprouts are not tightly associated with nerves.

We then examined the association of coronary sprouts with compact muscle, a tissue that is gradually vascularized during myocardial compaction. Zebrafish heart development starts within 24 h post-fertilization and continues throughout both juvenile and early adult life stages. In juvenile zebrafish, some gata4:EGFP⁺ CMs initially appear on the ventricular surface at ~5 weeks of age and gradually expand and eventually encapsulate the whole chamber to create a contiguous wall of compact muscle^62,63. Recent reports suggest coronary vessels can form a scaffold for cardiomyocyte production¹², but whether expanded cardiomyocytes affect coronary growth has not been examined. We assessed juvenile gata4:EGFP;deltaC:mCherry hearts⁴⁷ and observed mCherry⁺ signals embedded in the EGFP⁺ area on the ventricular surface. However, most mCherry⁺ cell extensions localized outside of the EGFP⁺ area, indicating coronary sprouts are not tightly associated with expanding cardiomyocytes (Fig. 2g).

Overall, our results indicate that coronary growth has no tight correlation with macrophages, nerves, and cardiac muscles during vascularization.

Coronary vessels grow along pre-formed hapln1a ⁺ cellular structures

Given our observations on the interaction of coronary sprouts with hapln1a⁺ epicardial cells, macrophages, nerves, and cardiomyocytes, we hypothesized that the pre-formed hapln1a⁺ cell structure is instrumental to promoting coronary growth. To test this possibility, we first utilized an in vitro system to examine the migration of hapln1a⁺ cells and coronary endothelial cells. In this system, extracted and cultured heart tissue adhere to the base of a dish after 2–3 days and then cardiac tissues migrate outside of the cultured heart tissue. We extracted and cultured juvenile hapln1a:mCherry;deltaC:EGFP heart tissue in a dish. Daily imaging showed that both mCherry⁺ cells and EGFP⁺ cells migrated away from the cultured hearts and spread to the dish bottom. Interestingly, hapln1a⁺ cells were always located in front of deltaC⁺ cells (Fig. 3a), suggesting a leading role of hapln1a⁺ cells for coronary extension.

Next, we examined hapln1a⁺ cells and coronary growth in an ex vivo system, which recently reported visualizing robust coronary expansion on the surface of juvenile fish ventricles within several days⁴⁷. When first culturing juvenile hapln1a:mCherry;deltaC:EGFP hearts, mCherry⁺ linear structures are already established on the ventricular surface with no EGFP green signals; 6 h later, green signals protruded from existing EGFP tubules and extended along the established red linear structure; 12 h later, green signals continued to extend and bifurcate following the mCherry linear structure (Fig. 3b). Interestingly, we also observed coronary extension in an area without hapln1a⁺ cells as it had no detectable mCherry⁺ signals, but this growth was transient and quickly withdrawn (Fig. 3b). These results indicate coronary growth is guided by pre-formed hapln1a⁺ cellular structures and coronary extension may be transient without hapln1a⁺ cells during vascularization.

hapln1a ⁺ cells are required for coronary vascularization

To further identify the requirement of hapln1a⁺ cells for coronary vascularization, we examined coronary growth under the condition of hapln1a⁺ cell loss with hapln1a:mCherry-NTR fish²³. First, we examined ex vivo coronary growth in juvenile ventricles after hapln1a⁺ cell depletion⁴⁷. The 7 wpf juvenile hapln1a:NTR;deltaC:EGFP fish and deltaC:EGFP siblings were treated with 10 mM Metronidazole (Mtz) for 12 h each day for 2 continuous days. Then, the hearts were extracted and cultured ex vivo. Daily imaging revealed that EGFP⁺ cells did not extend in hapln1a:NTR;deltaC:EGFP hearts with hapln1a⁺ cell depletion, compared with robust coronary growth in deltaC:EGFP hearts (Fig. 4a, b). Next, we evaluated in vivo coronary vascularization in juvenile fish after hapln1a⁺ cell ablation. The 7 wpf hapln1a:NTR;deltaC:EGFP fish and deltaC:EGFP siblings were first treated with 10 mM Mtz for 12 h each day for 2 continuous days and returned to the fish aquarium. Then, we performed the third treatment at 5 days after the first treatment. At 5 days after the third Mtz treatment, we collected hearts and assessed coronary vessels in the ventricles. The coronary vessel density and junctions in hapln1a:NTR;deltaC:EGFP animals were significantly lower than in deltaC:EGFP sibling controls (Fig. 4c–e), while coronary vessel numbers in hapln1a:NTR;deltaC:EGFP animals were more than in deltaC:EGFP sibling controls (Fig. 4f). As hapln1a⁺ cells also envelop existing coronary vessels and behave as perivascular cells, these results indicate that coronary growth is not only blocked but coronary vessels also become unstable without hapln1a⁺ cells. This instability caused the fragmentation of existing vessels and resulted in the increased vessel numbers in the condition of hapln1a⁺ cell loss.

**Fig. 4: hapln1a+ cell depletion resulted in defective coronary vascularization.**

hapln1a ⁺ cells are required for coronary revascularization during regeneration

Next, we asked if hapln1a⁺ cells play a role in coronary regrowth during heart regeneration. We examined hapln1a⁺ cells and coronary vessels in the regenerating injury area and observed coronary sprouts closely associated with pre-formed hapln1a⁺ cell structures (Fig. 5a, b). To test the requirement of hapln1a⁺ cells for coronary revascularization, we utilized the hapln1a:NTR fish strain to deplete hapln1a⁺ cells during heart regeneration. Adult hapln1a:NTR;deltaC:EGFP animals and deltaC:EGFP siblings were treated with 10 mM Mtz from 2 days post-amputation (dpa) for 12 h per day for 3 continuous days, and hearts were collected at 7 dpa. We determined that coronary vessel density in the regenerating area is significantly lower in hapln1a:NTR;deltaC:EGFP fish hearts, compared with deltaC:EGFP controls (Fig. 5c, d). These results implicate the requirement of hapln1a⁺ cells for coronary revascularization during heart regeneration. As hapln1a⁺ cells form around 30% of tcf21⁺ cells during morphogenesis (Fig. 1d) and around 50% during regeneration²³, we also examined the effect of randomly ablating around 50% of tcf21⁺ cells (Supplementary Fig. 5a, b). With this method of tcf21⁺ cell ablation, there was no significant difference in coronary vascularization and revascularization when compared with control animals (Supplementary Fig. 5c–f), indicating that ablating hapln1a⁺ cells has a more severe effect on coronary growth.

**Fig. 5: Coronary re-growth follows and requires hapln1a+ cell structures.**

Locally expressed serpine1 in hapln1a ⁺ cells regulates coronary growth

To understand the molecular nature of hapln1a⁺ cells on guided coronary growth, we performed scRNA-seq analyses with hapln1a⁺ cells from juvenile and regenerating hearts. The hapln1a⁺ cells were isolated from the ventricles of juvenile hapln1a:EGFP animals at 7 wpf and the regenerating area of the ventricular apex of adult animals at 7 dpa. A total of 4419 hapln1a⁺ cells from juvenile hearts and 2637 hapln1a⁺ cells from adult hearts were sequenced and analyzed. After examining gene expression in these cells, we found that hapln1a⁺ cell clusters not only highly express genes with known roles in vascular growth, such as vegfaa, cxcl12a, ccbe1, tgfb1a, and cpn1.1 (Supplementary Fig. 6)^{16,24,64,65,66,67,68}, but they also express the serpine1 gene (also known as plasminogen activator inhibitor-1), which was recently implicated in cardiomyocyte proliferation during zebrafish heart regeneration⁶⁹. Previous studies demonstrated that serpine1 regulates neuron migration during development in mice and humans and mediates cancer invasion and metastasis, through modulating interactions between cells and the extracellular matrix (ECM) to control the balance between cell adhesion and migration^70,71. Therefore, we speculated that hapln1a⁺ cells may regulate coronary growth through serpine1.

To test this possibility, we first performed in situ hybridization analyses and confirmed serpine1 expression in hapln1a⁺ cells during coronary vascularization and revascularization (Fig. 6a–c). We found that serpine1 signals closely localized to coronary sprouts (Fig. 7a–c), while other genes like vegfaa, cxcl12a, ccbe1, tgfb1a, and cpn1.1 did not show a close correlation with coronary sprouts (Supplementary Fig. 7), suggesting that hapln1a⁺ cell-derived serpine1 may regulate coronary growth. Therefore, we next examined coronary growth after blocking serpine1 function under different conditions by treatment with its antagonist Tiplaxtinin, which blocks the Serpine1 protease and has been used to inhibit serpine1 activity in different systems, including during zebrafish heart regeneration^{69,72,73,74,75,76}. Previous studies measured and determined that the inhibitory effect of 20 µM of Tiplaxtinin on serpine1 is ~95%^72,77. We first examined ex vivo juvenile ventricular coronary growth after blocking serpine1 function with 20 µM Tiplaxtinin and observed blocked coronary growth in the dish (Fig. 8a, b). Moreover, these blocked coronary extensions can re-start after drug removal, indicating that the coronary growth restriction by serpine1 inhibition does not occur by coronary cell death (Supplementary Fig. 8). Next, we treated 6 wpf juvenile fish with Tiplaxtinin for 12 h and continuously for 7 days. We found fewer coronary vessels in hearts treated with Tiplaxtinin when compared with vehicle controls (Fig. 8c, d). Lastly, we treated adult fish with Tiplaxtinin from 3 dpa for 12 h and continuously for 4 days and observed fewer coronary vessels in the regenerating area at 7 dpa, compared with vehicle controls (Fig. 8e, f). Similar to a previous report that the endocardium expresses serpine1 after heart injury⁶⁹, we also detected serpine1 signals in the inner injury area. However, we speculate that these serpine1-expressing cells are not directly correlated with coronary extension as coronary vessels mainly extended from the lateral area of the ventricular wall to the middle of the injury site. Together, our results indicate that hapln1a⁺ cell-derived serpine1 controls coronary growth during heart morphogenesis and regeneration.

**Fig. 6: hapln1a+ cells adjacent to coronary sprouts express the serpine1 gene.**

**Fig. 7: hapln1a+ cells adjacent to coronary sprouts express the serpine1 gene.**

**Fig. 8: Inhibiting serpine1 function blocks coronary growth during vascularization and revascularization.**

Depletion of hapln1a-expressing cells or inhibition of serpine1 activity results in defective hyaluronic acid deposition near coronary sprouts

To elucidate the mechanism by which hapln1a⁺ cells and serpine1 activity impact coronary growth, we assessed the distribution of the hapln1a⁺ cell substrate, hyaluronic acid (HA). We recently reported that hapln1a⁺ epicardial cells regulate HA deposition to facilitate cardiomyocyte proliferation during heart morphogenesis and regeneration²³. HA is required for coronary revascularization during zebrafish heart regeneration^78,79,80. Previous studies also demonstrated that endothelial cells can attach and grow along HA fibers in vitro, and a scaffold in tissue-engineered vascular grafts formed from HA-based biomaterials can completely generate a new vascular tube. These studies indicate that the administration of HA can enhance cell proliferation, adhesion, tubular sprout formation, and the migration of endothelial cells^{78,79,80,81,82,83,84}. We speculate that HA is involved in guided coronary growth. To examine this possibility, we first assessed HA localization with coronary vessels on the ventricular surface in juvenile deltaC:EGFP animals. We detected strong association of linear HA signals with EGFP⁺ signals (Fig. 9a). Next, we examined the HA deposition after ablating hapln1a⁺ cells at 7 wpf. Juvenile hapln1a:mCherry-NTR;deltaC:EGFP animals and deltaC:EGFP siblings were treated with 10 mM Mtz and their hearts were collected for histological analysis. We assessed the size of HA aggregates by quantifying the area of each focus of HA and found that hapln1a⁺ cell-depleted hearts displayed 35% lower HA intensity per HA aggregate, when compared with control siblings (Fig. 9b), indicating that the ablation of hapln1a⁺ cells disrupted the linear structure of HA in the coronary growth area. Next, we examined HA signals in the regeneration area and found HA signals were closely associated with deltaC:EGFP⁺ cells (Fig. 9c). We then assessed the HA deposition within the regenerating area after depleting hapln1a⁺ cells and observed that 7 dpa injury sites of hapln1a⁺ cell-depleted animals displayed ~47% smaller puncta of HA, compared with wild-type siblings (Fig. 9d). Next, we assessed whether serpine1 functions through regulating the HA structure during morphogenesis and regeneration, as previous reports indicated serpine1 protects the ECM to maintain a matrix necessary for endothelial cells to migrate and form capillaries⁸⁵. We examined HA deposition in the ventricle surface after treating juvenile deltaC:EGFP fish with Tiplaxtinin for 12 h and continuously for 7 days and found that inhibitor treated hearts displayed a 64% lower HA intensity per HA aggregate, when compared with control siblings (Fig. 9e, f), revealing a disorganized HA linear structure within the coronary growth area. Lastly, we treated adult fish with Tiplaxtinin from 3 dpa for 12 h and continuously for 4 days and observed 53% lower HA intensity per HA aggregate at 7 dpa, compared with vehicle controls (Fig. 9g, h). Our results indicate a mechanism for hapln1a⁺ cell function during morphogenesis and regeneration, in which HA is deposited by hapln1a⁺ cells and then organized by serpine1-expressing cells for coronary growth during vascularization and revascularization.

**Fig. 9: Depletion of hapln1a+ cells or serpine1 pathway inactivation lead to defective hyaluronic acid (HA) deposition in the coronary growth area during morphogenesis and regeneration.**

Discussion

In this study, we profiled tcf21⁺ epicardial cells from juvenile zebrafish hearts and characterized the role of hapln1a⁺ epicardial cells in coronary growth during heart morphogenesis and regeneration. Our work demonstrates that coronary growth is a hapln1a⁺ cell-guided process and identifies serpine1 as a critical regulator for coronary growth.

The epicardium is essential for heart development and regeneration. Transcriptional profiles of the epicardium and epicardium-derived cells were reported in embryonic, adult, and regenerating hearts^86,87,88,89. Recently, we demonstrated that hapln1a⁺ epicardial cells define epicardial subpopulations for cardiomyocyte proliferation during heart morphogenesis and regeneration²³. Here, our results indicate coronary formation is a key function of hapln1a⁺ epicardial cells. In addition to its role in wrapping and stabilizing newly formed coronary vessels, hapln1a⁺ cells precede vascular sprouts to guide coronary growth. This process may be analogous to guidepost cell populations that can be transient and act to assist biological events. For example, guidepost cell populations provide a scaffold or release paracrine factors during axon targeting^90,91. The observation of coronary growth following and relying on hapln1a⁺ cells suggests that hapln1a⁺ cells ostensibly behave as a cellular cue of a guiding scaffold. Epicardial cells are also known to secrete developmental factors, including many ECM components, during heart regeneration^22,23,92. Our work indicates that hapln1a⁺ cells regulate HA organization during heart morphogenesis and regeneration. Although HA has previously been implicated in vessel growth stimulation and been applied during bioengineering for vessel tube formation^{69,78,79,80,81,82,83,84}, no studies have reported that HA lines coronary vessels and paves the road for coronary growth during morphogenesis and natural regeneration. These hapln1a⁺ cell-derived HA cables may function as scaffolds, which could prevent loss of ECM components during tissue remodeling, act as a template for matrix regeneration, and support interactions with other cell types^{93,94,95,96,97}. Our recent and current studies raise an intriguing possibility that hapln1a⁺ epicardial cells oversee principal cardiogenic activities including myocardial expansion and coronary growth. In future, understanding the molecular nature of hapln1a⁺ subpopulations on cardiomyocyte proliferation and coronary growth, and how they control local cardiogenesis can inspire new ideas for targeted tissue regeneration.

Our work on the function of serpine1 on coronary growth also provides new evidence of epicardial cells regulating the regeneration environment and further demonstrates that nerves and vessels share similar mechanisms to regulate their migration⁹⁸. Our previous report indicated that the epicardial cluster 1 not only deposits HA through has1 expression but also requires hapln1 to stabilize HA structures²³. Our current results indicated that serpine1 is involved in this process by locally organizing linear HA structures to guide coronary extension. In this study, we discovered that hapln1a⁺ cells and serpine1 activity are responsible for major coronary growth in zebrafish: hapln1a⁺ cells deposit HA and serpine1 regulates the HA organization to form a linear structure, which is required for coronary extension and continuous growth. As hapln1 expression is distributed in the cells wrapping and in advance of coronary vessels, we speculate that the hapln1 protein plays a general role in organizing HA structure by stabilizing the binding of HA with other ECM proteins like proteoglycan, but it likely does not play a major role in the guidance of coronary growth as it is not expressed locally in the area of coronary extension. Further, our analyses also revealed that there is a small percentage (around 18%) of coronary growth extensions that occur without any hapln1a⁺ cells during heart morphogenesis. Although we also observed the withdrawal of the extended coronary vessels without hapln1a⁺ cells, we cannot exclude other mechanisms that provide guidance cues that may affect coronary growth during vascularization and revascularization. Further, we noticed that the percentage of serpine1 expression in hapln1a⁺ cells is different during heart morphogenesis and regeneration. We speculate that this difference arose because coronary vascularization occurs for around two months (from 5 wpf −12 wpf) and builds the coronary vasculature from very few coronary cells, while coronary revascularization occurs within 2–3 weeks and generates new vessels from existing vessels. Another possibility is that the endocardium functions through serpine1 to regulate myocardial regeneration while such endocardium-derived serpine1 doesn’t exist during heart morphogenesis. We speculate that these differences led us to detect low expression levels of serpine1 in morphogenesis hearts in comparison with serpine1 expression in the injury site. Further, a lower disruption effect on the HA structure was observed after blocking serpine1 in juvenile hearts when compared with other conditions such as depleting hapln1a⁺ cells in juvenile and regenerating hearts and blocking serpine1 in regenerating hearts. One reason for these variations is that hapln1a⁺ cell loss not only leads to small aggregates of HA but also less HA production²³, while serpine1 plays an organizational role in the local coronary extension area. Further, although the heart regeneration process always recapitulates the developmental process, coronary vascularization in juvenile fish takes around 2 months (from 5 wpf to 12 wpf), while revascularization occurs within 2–3 weeks. This temporal difference may cause different speeds of ECM deposition and coronary growth during development and regeneration. Accordingly, blocking serpine1 during development may cause a lower disruption effect on HA structure in juvenile hearts when compared with regenerating hearts.

Previous studies implicated other cell types in the process of guiding coronary growth. For example, macrophages localize near coronary tips during embryonic mice heart development¹⁴. In our study, we observed macrophages attached to coronary vessels, but the phenomenon of macrophages associating with coronary growth tips was seldom observed. We speculate that macrophages may regulate zebrafish coronary vessel sprouting, but they most likely do not play a major role in guiding coronary growth as they are not tightly associated with one another. Cardiomyocytes have also been reported to secrete mitogens like cxcl12 to regulate the vascularization of zebrafish compact muscle¹⁶. We examined proliferating cardiomyocytes and coronary vessels during myocardial compaction and observed coronary growth sprouts outside of the area of expanding compact myocardium, indicating that coronary growth is mainly not regulated by newly formed myocardium. Further, we examined nerves and coronary sprouts during coronary vascularization and didn’t observe a tight correlation between coronary sprouts and nerves. Compared with these current proposed guiding cells, our study reveals that hapln1a⁺ cells may play a major role in guiding coronary growth.

Methods

Zebrafish and heart injuries

All animal procedures were approved by the Institutional Animal Care and Use Committee of Emory University and performed in accordance with Emory University guidelines. 4-10-month-old outbred EK or EK/AB zebrafish were used for ventricular resection surgeries⁷. All animals were used with male to female at 1:1 when sex determination has occurred. To deplete hapln1a-expressing cells, Tg(hapln1a:mCherry-NTR)^{em14Tg 23} transgenic zebrafish were used at the age of 6-7 weeks with a length between 1.5 and 1.8 cm (juvenile), or 4–10 months with a length of at least 3 cm (adult). Animal density was maintained at ~4 fish/L in all experiments. Animals were randomly assigned to the test groups in all experiments. To deplete as many hapln1a⁺ cells as possible and avoid non-specific toxic effects, juvenile and adult hapln1a:mCherry-NTR animals and their control siblings were treated with vehicle or 10 mM Mtz in different conditions: fish were incubated with vehicle/Mtz in 1.5 L mating tanks for 12 h/day, and the treatment continued for 2 days in juvenile fish and 3 days in adult fish. Transgenic strains described elsewhere include: Tg(gata4:EGFP)^ae1Tg⁹⁹, Tg(tcf21:nucEGFP)^pd41Tg⁹⁹, Tg(hapln1a:EGFP)^pd338Tg²³, Tg(hapln1a:mCherry-NTR)^em14Tg²³, Tg(deltaC:EGFP)^em11Tg⁴⁷, Tg(deltaC:mCherry)^em11Tg⁴⁷. All transgenic strains were analyzed as hemizygotes.

Histology

Histological analyses were performed on 10 μm cryosections or whole-mount paraformaldehyde-fixed hearts. For immunostaining of whole-mounted hearts or heart sections: samples were blocked with 2% horse serum, 1% DMSO, 10% heat inactivated new calf serum and 0.1% Tween-20 in PBS for 1 h at room temperature. Primary antibodies were diluted in PBS plus 1% DMSO, 10% heat inactivated new calf serum, and 0.1% Tween-20 and incubated with hearts overnight at 4 °C. Samples were then washed with PBS plus 0.1% Tween-20 and incubated with the secondary antibody diluted in the PBS plus 1% DMSO, 10% heat inactivated new calf serum, and 0.1% Tween-20 for 1 h at room temperature. Samples were mounted in Vectashield vibrance antifade mounting medium with DAPI (Vector Laboratories, H-1800-10). To determine the general innervation of the heart, we used antibodies against acetylated α-tubulin (AcT) combined with human neuronal protein C/D (HuC/HuD). Primary antibodies used in this study include IB4 (Vector labs, DL-1208-5, 1:100), HuC/HuD (Invitrogen, A21271, 1:100), AcT (Sigma-Aldrich, T6793-.2 ML, 1:100), and GFP (Aves Labs, GFP-1020, 1:200). Alexa Fluor secondary antibodies used include 488 (goat anti-Chicken, A-11039, 1:200) and 594 (goat anti-mouse, A-11005, 1:200). Whole-mounted and sectioned ventricular tissues were imaged using a Zeiss LSM800 confocal scanning microscope with ZEN V3.7.

The immuno-localization of HA was performed on paraformaldehyde-fixed hearts using a biotin-labeled HA-binding protein. Hyaluronic acid binding protein (HABP) recognizes HA saccharide sequences and is able to localize HA in tissues by streptavidin conjugation with an appropriate fluorophore¹⁰⁰. To detect HA, samples were blocked with 2% BSA in PBS for 1 h at room temperature. HA was stained with HABP (Sigma, 385911, 2.5 µg/ml) in 3% BSA overnight at 4 °C. Samples were then washed with PBS and incubated with Alexa Fluor 633 streptavidin conjugate (Thermo Fisher, S21375, 1:500) in 3% BSA for 1 h. Samples were mounted in Vectashield vibrance antifade mounting medium with DAPI (Vector Laboratories, H-1800-10) and imaged using a Zeiss LSM800 confocal scanning microscope with ZEN V3.7.

Fluorescence in situ hybridization

Probes were synthesized by T7 RNA Polymerase (Roche,10881767001) and SP6 RNA Polymerase (Roche, 0810274001) and labeled by Digoxigenin RNA labeling mix (Roche, 11277073910). Fluorescence in situ hybridization was performed as previously described¹⁰¹. In summary, hearts were removed and fixed overnight at 4 °C in 4% paraformaldehyde. After processing, these hearts were cryosectioned to obtain 10 μm sections and then hybridized with probes in hybridization buffer, followed by blocking and then incubation with anti-Digoxigenin-POD fab fragments (Roche, 11207733910) in blocking buffer. The mRNA was detected using a TSA Plus Cyanine 5 Kit (AKOYA BIOSCIENCES, NEL745001KT) according to the manufacturer’s instructions. Next, the sections were processed with standard antibody staining protocols for immunofluorescence as described⁷ and then imaged. The primers for generating antisense mRNA are as follows: serpine1 Forward = TTGGGCTACAGGTGTTTGCT and Reverse = GCCGGTCAAGTGTGATTTCC; vegfaa Forward = ATGAACTTGGTTGTTTATTTGAT and Reverse = TCATCTTGGCTTTTCACATC; cxcr12a Forward = CGCCATTCATGCACCGATTT and Reverse = TGACCTGATTCTGCTGAGCG; ccbe1 Forward = TACCCGTGCGTAAAGTCCAC and Reverse = ACAGTCTCAAACCGGCCAAT; tgfb1a Forward = TGCTTGCTGGACAGTTTGGT and Reverse = GTGCCAACAGCTCGTCTCTT; and cpn1.1 Forward = AAATGAGGTGCTCGGAAGGG and Reverse = TTTTAGCCGTCGATAGGCCC.

Heart culture

The heart culture was performed as previously described^21,47. In summary, hearts were rinsed several times in PBS after collection and embedded in 1% low melting agarose with DMEM medium plus 10% fetal bovine serum, 1% non-essential amino acids, 100 U/mL penicillin, 100 μg/mL streptomycin, 50 µg/mL Primocin™ (InvivoGen), and 50 μM 2-Mercaptoethanol. Hearts were placed on the gridded glass bottom of live imaging dishes, and cultured at 28 °C in an incubator with 5% CO₂. Tiplaxtinin (Selleckchem, S7922) was dissolved in ethanol to a stock concentration of 20 mM. Tiplaxtinin was used at a final concentration of 20 μM for in vivo treatment and ex vivo culture. Fluorescent transgenes in these hearts were monitored using a fluorescence stereomicroscope SteREO Discovery with ZEN V3.5 and Zeiss LSM800 confocal scanning microscope with ZEN V3.7.

Coronary quantification in juvenile and regenerating hearts

To quantify coronary expansion in juvenile hearts from deltaC:EGFP fish, whole-mounted specimens were selected and ventricle images were captured using a 10x objective lens (1024 × 1024 pixels). The coronary vessel lengths were measured by ImageJ V1.53. To quantify the vessel sprouting activity, the total number of vessel junctions (branches ≥ 2) were counted. To quantify coronary vessel number in juvenile hearts from deltaC:EGFP fish, whole-mounted images of the ventricle were captured using a ×10 objective lens (1024 × 1024 pixels). The number of coronary vessels were counted manually with ImageJ. To quantify coronary vessel expansion in regenerating hearts from deltaC:EGFP fish: three medial, longitudinal sections were selected from each heart. Images of single optical slices of the ventricle were acquired using a ×20 objective lens (1024 × 1024 pixels) by adjusting the gain to detect EGFP signals above background level. EGFP⁺ areas were quantified in pixels by ImageJ software, and the density of EGFP⁺ signals versus imaged area (500 × 300 pixels) was calculated and averaged from 3 sections of each ventricle for each heart. To quantify coronary vessel sprouts associated with hapln1a⁺ cells, whole-mounted specimens were selected and imaged. Images of ventricles were captured using a ×20 objective lens (1024 × 1024 pixels). The correlation between coronary vessel sprouts and hapln1a⁺ cells was determined by the percentage of coronary vessel sprouts associated with hapln1a⁺ cells in the following orientations: pre-leading, in parallel with, or behind the coronary vessel sprouts. To quantify the association of coronary vessel sprouts with serpine1 signals in juvenile ventricles, whole-mounted specimens were selected and imaged. Images of ventricles were captured using a ×20 objective lens (1024 × 1024 pixels). The correlation between coronary vessel sprouts and sepine1 signals was determined by the percentage of coronary vessel sprouts associating with serpine1 within 30 µm of the coronary vessel sprouts.

HA quantification

To calculate HA signals, whole-mount ventricles in juvenile fish and ventricular sections of injured hearts from adult fish were stained with biotinylated HABP (hyaluronan binding protein) and fluorescently labeled streptavidin–Alexa-647 conjugate. Images of the ventricle were captured with a ×20 objective lens (1024 × 1024 pixels). HA signals were measured in pixels by ImageJ software for signals either close to vessel tips (200 × 200 pixels) of whole-mount ventricles or in the edge of the injury site (250 × 250 pixels) of each sectioned ventricle. We calculated HA aggregates by the number of HA dots per unit area of HA signals to determine the HA structure organization.

Single-cell RNA-sequencing

To prepare tcf21⁺ and hapln1a⁺ cells for single-cell RNA-sequencing analyses: 80 tcf21:nucEGFP and 120 hapln1a:EGFP fish were raised to the juvenile stage, and 60 hapln1a:EGFP fish were raised to the adult stage. Juvenile hearts were collected at 7 wpf (1.6–1.8 cm length). The hearts of adult fish at 6 months old (3.5–4 cm length) were extracted at 7 days post-amputation (dpa) and the wounded apex region was collected. The heart samples were digested with 0.26 U/mL Liberase^TM Thermolysin Medium (TM) based on a previously published protocol¹⁰². Dissociated cells were spun down and live EGFP⁺ cells were sorted by flow cytometry with FACSDiva v9.0. To ensure at least a 95% cell viability following the entire procedure, we gated viable cells by negative SYTOX^TM Red fluorescence and examined cell viability after cell sorting (Supplementary Fig. 1). Isolated cells were sent to the Emory Integrated Genomics Core (EIGC) center for 10x single-cell RNA-sequencing. Isolated EGFP⁺ cells were prepared in a single-cell suspension and counted using a Countess (ThermoFisher) system. The loaded Single Cell 3’ Chip was placed on a 10x Genomics Chromium Controller Instrument (10x Genomics, Pleasanton, CA, USA) to generate single-cell gel beads in emulsion (GEMs). Single-cell RNA-seq libraries were prepared using the Chromium Single Cell 3’ Library & Cell Bead Kit v3.1 (Cat. No. 1000128, 1000127, 120262; 10x Genomics) according to the manufacturer’s protocol. Libraries were sequenced with an Illumina NextSeq550 using mid-output 150-cycle kits according to manufacturer specifications. The newly generated scRNA-seq data were demultiplexed, aligned, and quantified using Cell Ranger Single-Cell Software V3.0.2. Preliminary filtered data generated from Cell Ranger were used for downstream analysis by the Seurat R package according to standard workflow.

Statistics and reproducibility

All data are presented as mean ± standard deviation. All statistical analyses were performed using GraphPad Prism 7 software. The two-sided Mann–Whitney rank-sum test was used for assessing statistical differences between two groups. Animals in experimental groups were randomly assigned and blinded for quantification. The results with P values < 0.05 were considered statistically significant.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The scRNA-seq dataset has been deposited in the National Center for Biotechnology Information Gene Expression Omnibus (GEO) under accession number GSE216649. All other relevant data supporting the key findings of this study are available within the article and its Supplementary Information files or from the corresponding author upon reasonable request. Source data are provided with this paper.

Code availability

Code used for single-cell RNA-seq data analysis is available on a GitHub repository at https://github.com/jishengsun/tcf21_hapln1a_scRNAseq.

References

MacRae, C. A., Roden, D. M. & Loscalzo, J. The future of cardiovascular therapeutics. Circulation 133, 2610–2617 (2016).
Article PubMed Google Scholar
Virani, S. S. et al. Heart disease and stroke statistics-2020 update: a report from the American Heart Association. Circulation 141, e139–e596 (2020).
Article PubMed Google Scholar
Bersell, K., Arab, S., Haring, B. & Kuhn, B. Neuregulin1/ErbB4 signaling induces cardiomyocyte proliferation and repair of heart injury. Cell 138, 257–270 (2009).
Article CAS PubMed Google Scholar
Senyo, S. E. et al. Mammalian heart renewal by pre-existing cardiomyocytes. Nature 493, 433–436 (2013).
Article ADS CAS PubMed Google Scholar
Bergmann, O. et al. Evidence for cardiomyocyte renewal in humans. Science 324, 98–102 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Porrello, E. R. et al. Transient regenerative potential of the neonatal mouse heart. Science 331, 1078–1080 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Poss, K. D., Wilson, L. G. & Keating, M. T. Heart regeneration in zebrafish. Science 298, 2188–2190 (2002).
Article ADS CAS PubMed Google Scholar
Singh, B. N., Koyano-Nakagawa, N., Garry, J. P. & Weaver, C. V. Heart of newt: a recipe for regeneration. J. Cardiovasc. Transl. Res. 3, 397–409 (2010).
Article PubMed Google Scholar
Godwin, J. W., Debuque, R., Salimova, E. & Rosenthal, N. A. Heart regeneration in the salamander relies on macrophage-mediated control of fibroblast activation and the extracellular landscape. NPJ Regen. Med. 2, 22 (2017).
Article PubMed PubMed Central Google Scholar
Chong, J. J. et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature 510, 273–277 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Elgendy, I. Y., Mahtta, D. & Pepine, C. J. Medical therapy for heart failure caused by ischemic heart disease. Circ Res. 124, 1520–1535 (2019).
Article CAS PubMed PubMed Central Google Scholar
Marin-Juez, R. et al. Coronary revascularization during heart regeneration is regulated by epicardial and endocardial cues and forms a scaffold for cardiomyocyte repopulation. Dev. Cell 51, 503–515 e504 (2019).
Article CAS PubMed PubMed Central Google Scholar
Larrivee, B., Freitas, C., Suchting, S., Brunet, I. & Eichmann, A. Guidance of vascular development: lessons from the nervous system. Circ. Res. 104, 428–441 (2009).
Article CAS PubMed Google Scholar
Leid, J. et al. Primitive embryonic macrophages are required for coronary development and maturation. Circ. Res. 118, 1498–1511 (2016).
Article CAS PubMed PubMed Central Google Scholar
Ivins, S. et al. The CXCL12/CXCR4 axis plays a critical role in coronary artery development. Dev. Cell 33, 455–468 (2015).
Article CAS PubMed PubMed Central Google Scholar
Harrison, M. R. et al. Chemokine-guided angiogenesis directs coronary vasculature formation in zebrafish. Dev. Cell 33, 442–454 (2015).
Article CAS PubMed PubMed Central Google Scholar
Chen, H. I. et al. VEGF-C and aortic cardiomyocytes guide coronary artery stem development. J. Clin. Invest. 124, 4899–4914 (2014).
Article CAS PubMed PubMed Central Google Scholar
Lepilina, A. et al. A dynamic epicardial injury response supports progenitor cell activity during zebrafish heart regeneration. Cell 127, 607–619 (2006).
Article CAS PubMed Google Scholar
Zhou, B. et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J. Clin. Invest. 121, 1894–1904 (2011).
Article CAS PubMed PubMed Central Google Scholar
Quijada, P., Trembley, M. A. & Small, E. M. The role of the epicardium during heart development and repair. Circ. Res. 126, 377–394 (2020).
Article CAS PubMed PubMed Central Google Scholar
Wang, J., Cao, J., Dickson, A. L. & Poss, K. D. Epicardial regeneration is guided by cardiac outflow tract and Hedgehog signalling. Nature 522, 226–230 (2015).
Article ADS CAS PubMed PubMed Central Google Scholar
Wei, K. et al. Epicardial FSTL1 reconstitution regenerates the adult mammalian heart. Nature 525, 479–485 (2015).
Article ADS CAS PubMed PubMed Central Google Scholar
Sun, J. et al. hapln1 defines an epicardial cell subpopulation required for cardiomyocyte expansion during heart morphogenesis and regeneration. Circulation https://doi.org/10.1161/CIRCULATIONAHA.121.055468 (2022).
El-Sammak, H. et al. A Vegfc-Emilin2a-Cxcl8a signaling axis required for zebrafish cardiac regeneration. Circ. Res. 130, 1014–1029 (2022).
Article CAS PubMed PubMed Central Google Scholar
Kikuchi, K. et al. tcf21+ epicardial cells adopt non-myocardial fates during zebrafish heart development and regeneration. Development 138, 2895–2902 (2011).
Article CAS PubMed PubMed Central Google Scholar
Huang, C. J., Tu, C. T., Hsiao, C. D., Hsieh, F. J. & Tsai, H. J. Germ-line transmission of a myocardium-specific GFP transgene reveals critical regulatory elements in the cardiac myosin light chain 2 promoter of zebrafish. Dev. Dyn. 228, 30–40 (2003).
Article CAS PubMed Google Scholar
Lyons, S. E. et al. A nonsense mutation in zebrafish gata1 causes the bloodless phenotype in vlad tepes. Proc. Natl Acad. Sci. USA 99, 5454–5459 (2002).
Article ADS CAS PubMed PubMed Central Google Scholar
Kell, M. J. et al. Targeted deletion of the zebrafish actin-bundling protein L-plastin (lcp1). PLoS ONE 13, e0190353 (2018).
Article PubMed PubMed Central Google Scholar
Wang, J., Karra, R., Dickson, A. L. & Poss, K. D. Fibronectin is deposited by injury-activated epicardial cells and is necessary for zebrafish heart regeneration. Dev. Biol. 382, 427–435 (2013).
Article CAS PubMed Google Scholar
Yebra, M. et al. Recognition of the neural chemoattractant Netrin-1 by integrins alpha6beta4 and alpha3beta1 regulates epithelial cell adhesion and migration. Dev. Cell 5, 695–707 (2003).
Article CAS PubMed Google Scholar
Guo, Y. et al. Frzb, a secreted Wnt antagonist, decreases growth and invasiveness of fibrosarcoma cells associated with inhibition of Met signaling. Cancer Res. 68, 3350–3360 (2008).
Article CAS PubMed PubMed Central Google Scholar
Hadjiargyrou, M. Mustn1: a developmentally regulated pan-musculoskeletal cell marker and regulatory gene. Int. J. Mol. Sci. 19, 206 (2018).
Article PubMed PubMed Central Google Scholar
Guo, S. K., Shen, M. F., Yao, H. W. & Liu, Y. S. Enhanced expression of TGFBI promotes the proliferation and migration of glioma cells. Cell. Physiol. Biochem. 49, 1097–1109 (2018).
Article PubMed Google Scholar
Cai, A. Q. et al. Cellular retinoic acid-binding proteins are essential for hindbrain patterning and signal robustness in zebrafish. Development 139, 2150–2155 (2012).
Article CAS PubMed PubMed Central Google Scholar
Liu, R. Z. et al. Retention of the duplicated cellular retinoic acid-binding protein 1 genes (crabp1a and crabp1b) in the zebrafish genome by subfunctionalization of tissue-specific expression. FEBS J. 272, 3561–3571 (2005).
Article CAS PubMed Google Scholar
Dave, B. et al. Targeting RPL39 and MLF2 reduces tumor initiation and metastasis in breast cancer by inhibiting nitric oxide synthase signaling. Proc. Natl Acad. Sci. USA 111, 8838–8843 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Dinh, T. T. H. et al. Disruption of entire Cables2 locus leads to embryonic lethality by diminished Rps21 gene expression and enhanced p53 pathway. Elife 10, e50346 (2021).
Article CAS PubMed PubMed Central Google Scholar
Yamaguchi, S. et al. Role of DBP in the circadian oscillatory mechanism. Mol. Cell. Biol. 20, 4773–4781 (2000).
Article CAS PubMed PubMed Central Google Scholar
Chen, C. Y. et al. Effects of aging on circadian patterns of gene expression in the human prefrontal cortex. Proc. Natl Acad. Sci. USA 113, 206–211 (2016).
Article ADS CAS PubMed Google Scholar
Kolodkin, A. L., Matthes, D. J. & Goodman, C. S. The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cell 75, 1389–1399 (1993).
Article CAS PubMed Google Scholar
Janssens, R., Struyf, S. & Proost, P. The unique structural and functional features of CXCL12. Cell. Mol. Immunol. 15, 299–311 (2018).
Article CAS PubMed Google Scholar
Horio, E. et al. Role of endothelial cell-derived angptl2 in vascular inflammation leading to endothelial dysfunction and atherosclerosis progression. Arterioscler. Thromb. Vasc. Biol. 34, 790–800 (2014).
Article CAS PubMed Google Scholar
Mohan, R. R. et al. Targeted decorin gene therapy delivered with adeno-associated virus effectively retards corneal neovascularization in vivo. PLoS ONE 6, e26432 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Cavallero, S. et al. CXCL12 signaling is essential for maturation of the ventricular coronary endothelial plexus and establishment of functional coronary circulation. Dev. Cell 33, 469–477 (2015).
Article CAS PubMed PubMed Central Google Scholar
Ouchi, N. et al. Follistatin-like 1, a secreted muscle protein, promotes endothelial cell function and revascularization in ischemic tissue through a nitric-oxide synthase-dependent mechanism. J. Biol. Chem. 283, 32802–32811 (2008).
Article CAS PubMed PubMed Central Google Scholar
Scholz, B. et al. Endothelial RSPO3 controls vascular stability and pruning through non-canonical WNT/Ca(2+)/NFAT signaling. Dev. Cell 36, 79–93 (2016).
Article CAS PubMed Google Scholar
Sun, J. et al. Zebrafish heart regeneration after coronary dysfunction-induced cardiac damage. Dev. Biol. 487, 57–66 (2022).
Article CAS PubMed Google Scholar
Wanjare, M., Kusuma, S. & Gerecht, S. Perivascular cells in blood vessel regeneration. Biotechnol. J. 8, 434–447 (2013).
Article CAS PubMed PubMed Central Google Scholar
Riew, T. R., Choi, J. H., Kim, H. L., Jin, X. & Lee, M. Y. PDGFR-beta-positive perivascular adventitial cells expressing nestin contribute to fibrotic scar formation in the striatum of 3-NP intoxicated rats. Front. Mol. Neurosci. 11, 402 (2018).
Article CAS PubMed PubMed Central Google Scholar
Crisan, M., Corselli, M., Chen, W. C. & Peault, B. Perivascular cells for regenerative medicine. J. Cell. Mol. Med. 16, 2851–2860 (2012).
Article CAS PubMed PubMed Central Google Scholar
Sweeney, M. & Foldes, G. It takes two: endothelial-perivascular cell cross-talk in vascular development and disease. Front. Cardiovasc. Med. 5, 154 (2018).
Article CAS PubMed PubMed Central Google Scholar
Talman, V. & Kivela, R. Cardiomyocyte-endothelial cell interactions in cardiac remodeling and regeneration. Front. Cardiovasc. Med. 5, 101 (2018).
Article PubMed PubMed Central Google Scholar
Sunderkotter, C., Steinbrink, K., Goebeler, M., Bhardwaj, R. & Sorg, C. Macrophages and angiogenesis. J. Leukoc. Biol. 55, 410–422 (1994).
Article CAS PubMed Google Scholar
Corliss, B. A., Azimi, M. S., Munson, J. M., Peirce, S. M. & Murfee, W. L. Macrophages: an inflammatory link between angiogenesis and lymphangiogenesis. Microcirculation 23, 95–121 (2016).
Article PubMed PubMed Central Google Scholar
Lai, S. L. et al. Reciprocal analyses in zebrafish and medaka reveal that harnessing the immune response promotes cardiac regeneration. Elife 6, e25605 (2017).
Article PubMed PubMed Central Google Scholar
Glebova, N. O. & Ginty, D. D. Growth and survival signals controlling sympathetic nervous system development. Annu. Rev. Neurosci. 28, 191–222 (2005).
Article CAS PubMed Google Scholar
Brown, D. et al. Neuregulin-1 is essential for nerve plexus formation during cardiac maturation. J. Cell. Mol. Med. 22, 2007–2017 (2018).
Article CAS PubMed Google Scholar
Stoyek, M. R., Croll, R. P. & Smith, F. M. Intrinsic and extrinsic innervation of the heart in zebrafish (Danio rerio). J. Comp. Neurol. 523, 1683–1700 (2015).
Article CAS PubMed Google Scholar
Bisgrove, B. W., Raible, D. W., Walter, V., Eisen, J. S. & Grunwald, D. J. Expression of c-ret in the zebrafish embryo: potential roles in motoneuronal development. J. Neurobiol. 33, 749–768 (1997).
Article CAS PubMed Google Scholar
Olsson, C. Autonomic innervation of the fish gut. Acta Histochem. 111, 185–195 (2009).
Article PubMed Google Scholar
Newton, C. M., Stoyek, M. R., Croll, R. P. & Smith, F. M. Regional innervation of the heart in the goldfish, Carassius auratus: a confocal microscopy study. J. Comp. Neurol. 522, 456–478 (2014).
Article CAS PubMed Google Scholar
Kikuchi, K. et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature 464, 601–605 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Gupta, V. & Poss, K. D. Clonally dominant cardiomyocytes direct heart morphogenesis. Nature 484, 479–484 (2012).
Article ADS CAS PubMed PubMed Central Google Scholar
Bautch, V. L. VEGF-directed blood vessel patterning: from cells to organism. Cold Spring Harb. Perspect. Med. 2, a006452 (2012).
Article PubMed PubMed Central Google Scholar
Ara, T., Tokoyoda, K., Okamoto, R., Koni, P. A. & Nagasawa, T. The role of CXCL12 in the organ-specific process of artery formation. Blood 105, 3155–3161 (2005).
Article CAS PubMed Google Scholar
Bonet, F. et al. CCBE1 is required for coronary vessel development and proper coronary artery stem formation in the mouse heart. Dev. Dyn. 247, 1135–1145 (2018).
Article CAS PubMed Google Scholar
Low, E. L., Baker, A. H. & Bradshaw, A. C. TGFbeta, smooth muscle cells and coronary artery disease: a review. Cell. Signal. 53, 90–101 (2019).
Article CAS PubMed PubMed Central Google Scholar
Wu, T. Y. et al. Fine-tune regulation of carboxypeptidase N1 controls vascular patterning during zebrafish development. Sci. Rep. 7, 1852 (2017).
Article ADS PubMed PubMed Central Google Scholar
Munch, J., Grivas, D., Gonzalez-Rajal, A., Torregrosa-Carrion, R. & de la Pompa, J. L. Notch signalling restricts inflammation and serpine1 expression in the dynamic endocardium of the regenerating zebrafish heart. Development 144, 1425–1440 (2017).
CAS PubMed Google Scholar
Genestine, M. et al. Vascular-derived SPARC and SerpinE1 regulate interneuron tangential migration and accelerate functional maturation of human stem cell-derived interneurons. Elife 10, e56063 (2021).
Article CAS PubMed PubMed Central Google Scholar
Mahmood, N., Mihalcioiu, C. & Rabbani, S. A. Multifaceted role of the urokinase-type plasminogen activator (uPA) and its receptor (uPAR): diagnostic, prognostic, and therapeutic applications. Front. Oncol. 8, 24 (2018).
Article PubMed PubMed Central Google Scholar
Gorlatova, N. V. et al. Mechanism of inactivation of plasminogen activator inhibitor-1 by a small molecule inhibitor. J. Biol. Chem. 282, 9288–9296 (2007).
Article CAS PubMed Google Scholar
Daniel, A. E. et al. Plasminogen activator inhibitor-1 controls vascular integrity by regulating VE-cadherin trafficking. PLoS ONE 10, e0145684 (2015).
Article PubMed PubMed Central Google Scholar
Kang, J. et al. Plasminogen activator inhibitor-1 enhances radioresistance and aggressiveness of non-small cell lung cancer cells. Oncotarget 7, 23961–23974 (2016).
Article MathSciNet PubMed PubMed Central Google Scholar
Lin, L. L. et al. PAI-1-dependent inactivation of SMAD4-modulated junction and adhesion complex in obese endometrial cancer. Cell Rep. 33, 108253 (2020).
Article CAS PubMed PubMed Central Google Scholar
Yamagami, Y. et al. Role of plasminogen activator inhibitor-1 in methotrexate-induced epithelial-mesenchymal transition in alveolar epithelial A549 cells. Biochem. Biophys. Res. Commun. 525, 543–548 (2020).
Article CAS PubMed Google Scholar
Seker, F. et al. Identification of SERPINE1 as a regulator of glioblastoma cell dispersal with transcriptome profiling. Cancers (Basel) 11, 1651 (2019).
Article CAS PubMed Google Scholar
Pardue, E. L., Ibrahim, S. & Ramamurthi, A. Role of hyaluronan in angiogenesis and its utility to angiogenic tissue engineering. Organogenesis 4, 203–214 (2008).
Article PubMed PubMed Central Google Scholar
Luo, Y. et al. Hyaluronic acid facilitates angiogenesis of endothelial colony forming cell combining with mesenchymal stem cell via CD44/ MicroRNA-139-5p pathway. Front. Bioeng. Biotechnol. 10, 794037 (2022).
Article PubMed PubMed Central Google Scholar
Ghose, S., Biswas, S., Datta, K. & Tyagi, R. K. Dynamic Hyaluronan drives liver endothelial cells towards angiogenesis. BMC Cancer 18, 648 (2018).
Article PubMed PubMed Central Google Scholar
Turner, N. J., Kielty, C. M., Walker, M. G. & Canfield, A. E. A novel hyaluronan-based biomaterial (Hyaff-11) as a scaffold for endothelial cells in tissue engineered vascular grafts. Biomaterials 25, 5955–5964 (2004).
Article CAS PubMed Google Scholar
Lepidi, S. et al. Hyaluronan biodegradable scaffold for small-caliber artery grafting: preliminary results in an animal model. Eur. J. Vasc. Endovasc. Surg. 32, 411–417 (2006).
Article CAS PubMed Google Scholar
Burdick, J. A. & Prestwich, G. D. Hyaluronic acid hydrogels for biomedical applications. Adv. Mater. 23, H41–H56 (2011).
Article CAS PubMed PubMed Central Google Scholar
Peattie, R. A. et al. Stimulation of in vivo angiogenesis by cytokine-loaded hyaluronic acid hydrogel implants. Biomaterials 25, 2789–2798 (2004).
Article CAS PubMed Google Scholar
Ismail, A. A., Shaker, B. T. & Bajou, K. The plasminogen-activator plasmin system in physiological and pathophysiological angiogenesis. Int. J. Mol. Sci. 23, 337 (2021).
Article PubMed PubMed Central Google Scholar
Hesse, J. et al. Single-cell transcriptomics defines heterogeneity of epicardial cells and fibroblasts within the infarcted murine heart. Elife 10, e65921 (2021).
Article CAS PubMed PubMed Central Google Scholar
Yuan, N. et al. Practice patterns and patient outcomes after widespread adoption of remote heart failure care. Circ. Heart Fail 14, e008573 (2021).
Article PubMed PubMed Central Google Scholar
Weinberger, M., Simoes, F. C., Patient, R., Sauka-Spengler, T. & Riley, P. R. Functional heterogeneity within the developing zebrafish epicardium. Dev. Cell 52, 574–590.e576 (2020).
Article CAS PubMed PubMed Central Google Scholar
Cao, J. et al. Single epicardial cell transcriptome sequencing identifies Caveolin 1 as an essential factor in zebrafish heart regeneration. Development 143, 232–243 (2016).
CAS PubMed PubMed Central Google Scholar
Scimone, M. L. et al. Muscle and neuronal guidepost-like cells facilitate planarian visual system regeneration. Science 368, eaba3203 (2020).
Article CAS PubMed PubMed Central Google Scholar
Silva, C. G., Peyre, E. & Nguyen, L. Cell migration promotes dynamic cellular interactions to control cerebral cortex morphogenesis. Nat. Rev. Neurosci. 20, 318–329 (2019).
Article CAS PubMed Google Scholar
Bassat, E. et al. The extracellular matrix protein agrin promotes heart regeneration in mice. Nature 547, 179–184 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Evanko, S. P., Potter-Perigo, S., Johnson, P. Y. & Wight, T. N. Organization of hyaluronan and versican in the extracellular matrix of human fibroblasts treated with the viral mimetic poly I:C. J. Histochem. Cytochem. 57, 1041–1060 (2009).
Article CAS PubMed PubMed Central Google Scholar
Sun, Y. Y. & Keller, K. E. Hyaluronan cable formation by ocular trabecular meshwork cells. Exp. Eye Res. 139, 97–107 (2015).
Article CAS PubMed PubMed Central Google Scholar
Wang, A. & Hascall, V. C. Hyaluronan structures synthesized by rat mesangial cells in response to hyperglycemia induce monocyte adhesion. J. Biol. Chem. 279, 10279–10285 (2004).
Article CAS PubMed Google Scholar
Jokela, T. A. et al. Induction of hyaluronan cables and monocyte adherence in epidermal keratinocytes. Connect. Tissue Res. 49, 115–119 (2008).
Article CAS PubMed Google Scholar
de La Motte, C. A., Hascall, V. C., Calabro, A., Yen-Lieberman, B. & Strong, S. A. Mononuclear leukocytes preferentially bind via CD44 to hyaluronan on human intestinal mucosal smooth muscle cells after virus infection or treatment with poly(I.C). J. Biol. Chem. 274, 30747–30755 (1999).
Article PubMed Google Scholar
Carmeliet, P. Blood vessels and nerves: common signals, pathways and diseases. Nat. Rev. Genet. 4, 710–720 (2003).
Article CAS PubMed Google Scholar
Heicklen-Klein, A. & Evans, T. T-box binding sites are required for activity of a cardiac GATA-4 enhancer. Dev. Bol. 267, 490–504 (2004).
Article CAS Google Scholar
Raio, L. et al. Hyaluronan content of Wharton’s jelly in healthy and Down syndrome fetuses. Matrix Biol. 24, 166–174 (2005).
Article CAS PubMed Google Scholar
He, J., Mo, D., Chen, J. & Luo, L. Combined whole-mount fluorescence in situ hybridization and antibody staining in zebrafish embryos and larvae. Nat. Protoc. 15, 3361–3379 (2020).
Article CAS PubMed Google Scholar
Spanjaard, B. et al. Simultaneous lineage tracing and cell-type identification using CRISPR-Cas9-induced genetic scars. Nat. Biotechnol. 36, 469–473 (2018).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Weilan Lin for fish care and the Developmental Studies Hybridoma Bank for antibodies. Microscopy data for this study were acquired and analyzed using the Microscopy in Medicine Core in Cardiology at Emory. This work was supported by a NIH T32 training fellowship (5T32HL007745-28) and by a AHA (23POST1014396) to E.A.P.; grants from NHLBI (R01HL142762) to J.W. The Microscopy in Medicine Core in Cardiology at Emory was supported by NIH grant (P01 HL095070).

Author information

Authors and Affiliations

Cardiology Division, School of Medicine, Emory University, Atlanta, GA, 30322, USA
Jisheng Sun, Elizabeth A. Peterson, Xin Chen & Jinhu Wang

Authors

Jisheng Sun
View author publications
You can also search for this author in PubMed Google Scholar
Elizabeth A. Peterson
View author publications
You can also search for this author in PubMed Google Scholar
Xin Chen
View author publications
You can also search for this author in PubMed Google Scholar
Jinhu Wang
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization by J.S., and J.W.; methodology by J.S., and J.W.; investigation by J.S., E.A.P., X.C., and J.W.; formal analysis by J.S., and J.W.; visualization by J.S. and J.W.; writing by J.W.; funding acquisition by J.W; supervision by J.W. All authors commented on the manuscript.

Corresponding author

Correspondence to Jinhu Wang.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Sun, J., Peterson, E.A., Chen, X. et al. hapln1a⁺ cells guide coronary growth during heart morphogenesis and regeneration. Nat Commun 14, 3505 (2023). https://doi.org/10.1038/s41467-023-39323-6

Download citation

Received: 15 November 2022
Accepted: 07 June 2023
Published: 13 June 2023
DOI: https://doi.org/10.1038/s41467-023-39323-6

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.