Abstract
Huntington’s disease (HD) is a neurodegenerative disorder caused by a dominant gain-of-function mutation in the huntingtin gene, resulting in an elongated polyglutamine repeat in the mutant Huntingtin (mHtt) that mediates aberrant protein interactions. Previous studies implicated the ubiquitin–proteasome system in HD, suggesting that restoring cellular proteostasis might be a key element in suppressing pathology. We applied genetic interaction tests in a Drosophila model to ask whether modulating the levels of deubiquitinase enzymes affect HD pathology. By testing 32 deubiquitinase genes we found that overexpression of Yod1 ameliorated all analyzed phenotypes, including neurodegeneration, motor activity, viability, and longevity. Yod1 did not have a similar effect in amyloid beta overexpressing flies, suggesting that the observed effects might be specific to mHtt. Yod1 overexpression did not alter the number of mHtt aggregates but moderately increased the ratio of larger aggregates. Transcriptome analysis showed that Yod1 suppressed the transcriptional effects of mHtt and restored the expression of genes involved in neuronal plasticity, vesicular transport, antimicrobial defense, and protein synthesis, modifications, and clearance. Furthermore, Yod1 overexpression in HD flies leads to the upregulation of genes involved in transcriptional regulation and synaptic transmission, which might be part of a response mechanism to mHtt-induced stress.
Similar content being viewed by others
Introduction
Accumulation of misfolded proteins is a hallmark of several neurodegenerative diseases1. In Huntington’s disease (HD, OMIM #143100), a late-onset monogenic dominant disorder, aggregates of mutant huntingtin (Htt) protein are present both in the cytosol and the nucleus2,3. Htt is a large, 3144 amino acid protein that has an N-terminal polyglutamine (polyQ) repeat, several HEAT (huntingtin, elongation factor 3, protein phosphatase 2A, TOR1) repeats, a nuclear localization signal, and a C-terminal nuclear export signal4. The disease-causing mutation is an expansion of the polymorphic CAG repeat in the first exon of the huntingtin (HTT, OMIM: 613004) gene that translates to an elongated polyQ repeat in the mutant Htt protein (mHtt)5. Repeats of 36 or more glutamines (Qs) are pathogenic, and alleles with ≥ 40 Qs have complete penetrance. mHtt is cleaved by several proteases, including caspases and calpains, that result in the formation of short, toxic, aggregation-prone, polyQ-containing N-terminal mHtt fragments2. mHtt induces a complex pathogenesis that negatively affects several key cellular processes, including transcriptional regulation and the ubiquitin–proteasome system (UPS)6,7,8. A plethora of studies indicate the involvement of the UPS in mHtt-induced pathological processes6, although several aspects of perturbed UPS function, i.e., the role of deubiqutinatase (DUB) enzymes in HD pathology, are still not clearly elucidated.
Ubiquitin (Ub), a 76 amino acid protein, is encoded by multigene families both in fruit flies and mammals. Members of these gene families encode ubiquitin either in the form of tandem polyubiquitin precursors or fused to ribosomal protein precursors, and the formation of Ub monomers require the activity of DUB enzymes9,10,11,12. Ubiquitin can be covalently conjugated to target proteins by a tightly controlled, multistep enzymatic mechanism12. Monoubiquitination or multiubiquitination of proteins affects their activity and interactions, while polyubiquitination (formation of a ubiquitin chain of at least four units) through the K48 lysine residue marks proteins for proteasomal degradation13. Conjugation of Ub to target proteins needs the activity of ubiquitin-activating (E1), ubiquitin-conjugating (E2), and ubiquitin ligase (E3) enzymes, while Ub is released from proteins by hydrolysis via the activity of DUB enzymes12. The availability of free ubiquitin monomers is essential for the proper regulation of Ub-dependent processes. The level of monoubiquitin is heavily influenced by DUB enzymes that are required for both the synthesis of Ub and its release from protein substrates12. In humans, approximately 100 DUBs were identified to date that belong to six structurally distinct protein families, including the ovarian tumor proteases (OTU), the ubiquitin-specific protease (USP), the ubiquitin C-terminal hydrolases (UCH), the Josephin / Machado-Joseph Deubiquitinases (MJD), and the motif interacting with ubiquitin-containing novel DUB family (MINDY) cysteine protease families, and the Zn-dependent JAMM metalloprotease protein family14. Six of these enzymes were shown previously to interact with the Htt protein and/or modulate some aspect of HD pathology15.
In this study, we performed a genetic interaction screen in a Drosophila model of HD to identify DUBs that have modulatory effects on mHtt-induced pathology. In the fruit fly genome, there are approximately 45 genes encoding DUB enzymes12. We tested the effects of altering the activity of 32 genes, encoding DUBs belonging to the OTU, MJD, USP, UCH, or JAMM families, on mHtt-induced phenotypes and found that increased activity of the Yod1 (CG4603) gene, encoding the Drosophila ortholog of the human YOD1 protein, suppressed all tested phenotypes in the HD model. We found that Yod1 overexpression had only minor effects on mHtt aggregation but led to the restoration of the transcriptional activity of the majority of genes dysregulated in the HD model.
Results
Genetic screen of deubiquitinases identifies Yod1 as a modulator of mutant Huntingtin induced pathology
To evaluate the effects of DUB mutants on HD pathology we performed genetic interaction tests by generating flies expressing exon1 of human Huntingtin with a 120 residue long polyQ repeat (Httex1.Q120)16 in the nervous system under the influence of the elav-GAL pan-neuronal driver (HD flies) and simultaneously being heterozygous for DUB mutations, transgenes or RNAi constructs. We tested the effects of altered levels of 32 deubiquitinase genes, including six genes of the OTU family (CG3251, CG4968, Deubiquitinating enzyme A (Duba), ovarian tumor (out), trabid (trbd), and Yod1), one gene of the MJD family (CG3781), 18 genes of the USP family (Cylindromatosis (CYLD), Deubiquitinating apoptotic inhibitor (DUBAI), fat facets (faf), non-stop (not), puffyeye (puf), Ubiquitin specific protease 1 (Usp1), Usp2, Usp5, Usp7, Usp8, Usp10, Usp-12-46, Usp14, Usp15-31, Usp20-33, Usp30, Usp32, and Usp47), two genes of the UCH family (Ubiquitin carboxy-terminal hydrolase (Uch), and Uch-L5), and five genes of the JAMM metalloproteinase family (CG2224, COP9 signalosome subunit 5 (CSN5), CSN6, Regulatory particle non-ATPase 8 (Rpn8), and Rpn11).
Neuronal expression of Httex1.Q120 leads to neuronal degeneration, decreased viability and longevity, and impaired motor activity16,17. We investigated the effects of DUB mutants on these four mHtt-induced phenotypes (Fig. 1, Supplementary file S1). The effect on neurodegeneration was analyzed by determining the degeneration of photoreceptor neurons in the compound eye of seven-day-old females by the pseudopupil assay18. In wild-type flies seven visible rhabdomeres, light gathering structures of photoreceptor neurons, can be visualized in each ommatidium. In Httex1.Q120 expressing flies neurodegeneration leads to the reduction of the number of intact rhabdomeres16. We found that overexpression of Yod1 (P = 9.7 × 10–12, Supplementary Fig. S1) or reduction of trbd (P = 2.7 × 10–8) or Usp1 (P = 1.13 × 10–6) significantly ameliorated mHtt-induced neurodegeneration in the eye (Fig. 1A).
Characterization the effects of DUB mutants on HD phenotypes in genetic interaction crosses. Female flies overexpressing mHtt in the nervous system and simultaneously carrying a genetic element affecting a specific DUB (heterozygous for a loss-of function DUB allele (LOF), or overexpressing a DUB transgene (GOF), or expressing an RNAi construct (RNAi)) were compared to mHtt expressing control female siblings. (A) Neurodegeneration was measured as loss of rhabdomeres in the compound eye. (B) Viability was determined by comparing the number of emerging mHtt, mHtt-DUB and non-expressing control flies. (C) Longevity was analyzed by comparing median lifespans. (D) Climbing activity was determined by measuring the vertical distance climbed in 5 s. The X scale shows the − log(P) values of statistical tests (neurodegeneration: t-test, viability: Χ2-test, longevity: Fisher’s exact test, climbing: Wilcoxon Sum of Ranks test). Green color indicates significant suppression, red color indicates significant enhancement of phenotypes, and grey color indicates a non-significant effect. The significance threshold line is set at Bonferroni corrected α < 0.05 level for multiple comparison testing.
Neuronal expression of Httex1.Q120 causes a marked reduction of viability measured as the number of eclosing HD flies compared to non-HD control siblings16. By analyzing the effects of DUB mutants on mHtt-induced reduced viability we found that overexpression of Yod1 (P = 5.29 × 10–7) or reduction of CG4968 (P = 1.9 × 10–4), Usp1 (P = 3.7 × 10–8), Usp5 (P = 3.12 × 10–10), Usp30 (P = 1.98 × 10–5), or Uch-L5 (P = 1.02 × 10–5) increased viability while reduction of CG3251 (P = 1.2 × 10–7), Usp7 (P = 3.7 × 10–5) or Usp8 (P = 3.7 × 10–5) reduced viability (Fig. 1B).
Expression of Httex1.Q120 significantly reduces the lifespan of flies16,17. By longevity analysis we found that overexpression of Yod1 (P = 7 × 10–4) or reduction of duba (P = 3 × 10–4), CYLD (P = 5 × 10–4), DUBAI (P = 6.4 × 10–13), puf (P = 2 × 10–13), Usp1 (3 × 10–13), Usp5 (P = 5 × 10–4), Usp32 (P = 3.4 × 10−10), Uch (P = 5.9 × 10–6) or Uch-L5 (P = 3.8 × 10–6) increased while reduction of Usp7 (P = 1 × 10–4) decreased the median lifespan of HD flies (Fig. 1C).
Finally, we investigated the effects of DUB mutants on the impaired motor activity of HD flies16 by climbing assays and found that the climbing activity of HD flies overexpressing Yod1 was significantly increased (P = 0.0013) (Fig. 1D).
Thus, in our screen genetic manipulation of two DUB genes, Yod1 and Usp1, had significant effects on at least three of the analyzed disease phenotypes and we considered these HD modifier candidates. Yod1 encodes for the dYOD1 ubiquitinyl hydrolase enzyme whose closest human ortholog is the YOD1 deubiquitinase (sequence identity: 42%, similarity: 58%). The Yod1EY07831 allele that suppressed HD induced pathology carries a P{EPgy2} element in the 5’-UTR region of the gene that drives the over-expression of Yod1 in the presence of a GAL4 driver. Usp1 encodes for a deubiquitinase whose closest human ortholog is the ubiquitin specific peptidase 1 protein (USP1, sequence identity: 24%, similarity: 38%). The Usp1JF02992 transgenic strain used in the tests carries a P{TRiP.JF02992} transgene that provides a GAL4 dependent down-regulation of Usp1 by RNAi.
To validate our findings with Yod1 and Usp1 we tested independent lines with similar functional effects on gene activity. In the case of Yod1 we generated a transgenic UAS-Yod1.flag strain by φC31 integrase mediated site-specific integration of a pTWF.attB-Yod1 construct in the third chromosomal ZH-86Fb docking site and tested the effects of this element on mHtt-induced phenotypes. Over-expression of UAS-Yod1.flag transgene significantly ameliorated all analyzed phenotypes. In the eye the average number of rhabdomeres per ommatidia in flies co-expressing Httex1.Q120 and Yod1 increased to 6.36 ± 0.03 (average ± SEM) from 5.77 ± 0.03 in Httex1.Q120 expressing controls (P = 3.59 × 10–10, n = 10/10, Fig. 2A). Relative viability increased 3.5-fold from 26.1% in Httex1.Q120 expressing controls to 90.7% in flies co-expressing Httex1.Q120 and Yod1 (P = 1.02 × 10–15, n = 824, Fig. 2B) and median lifespan increased to 9.94 days from 5.81 days in controls (P = 8.9 × 10–13, n of the experimental category (nexp) = 224, n of the control category (ncont) = 75, Fig. 2C). Motor activity was also significantly increased (P = 4.08 × 10–6, Fig. 2D) in Yod1 overexpressing HD flies as they climbed a larger distance vertically in 5 s (median: 17.1 mm, mean 23.5 mm, n = 83) than Httex1.Q120 expressing controls (median: 0 mm, mean: 5.6 mm, n = 75). We also tested the effects of Yod1 in flies expressing a non-pathological HTT transgene, Httex1.Q25, that produces a similar protein as Httex1.Q120 but with a 25 residues long polyQ repeat. Neither flies expressing Httex1.Q25 alone, nor ones co-expressing Httex1.Q25 and Yod1 showed signs of retinal neurodegeneration (Supplementary Fig. S2A) or reduced viability (Supplementary Fig. S2B). Flies co-expressing Yod1 and Httex1.Q25 climbed a significantly (P = 0.008) larger vertical distance in 4 s (median: 37.8 mm, mean: 37 mm, n = 50) than their Httex1.Q25 expressing siblings (median: 28 mm, mean: 26.4 mm, n = 50) (Supplementary Fig. S2C). Thus, overexpression of Yod1 increased climbing speed in “healthy” flies, although the scale of this increase was not as large either in absolute or relative terms as in HD flies.
Overexpression of Yod1 rescues mHtt-induced phenotypes. (A) Neuronal (elav-GAL4 (eG4) driven) overexpression of the Yod1.flag transgene significantly reduces degeneration of photoreceptor neurons (P = 3.59 × 10–10, n = 10/10). Boxes show 25th, 50th and 75th quartiles of the average number of rhabdomeres per ommatidia in compound eyes, whiskers represent 10th and 90th quartile values. (B) Flies expressing mHtt under the influence of the neuronal elav-GAL4 driver have lower viability than non-expressing control siblings (gray). Simultaneous overexpression of Yod1 improves viability of HD flies close to wild-type levels (P = 1.02 × 10–15, n = 824). (C) Overexpression of Yod1 significantly increases the median lifespan of mHtt expressing flies (P = 8.9 × 10–13, nexp = 224, ncont = 75). (D) Overexpression of Yod1 significantly ameliorates motor dysfunction of HD flies (P = 4.08 × 10–6, nexp = 83, ncon = 75). Datapoints show vertical distances climbed by individual flies in 5 s, horizontal lines and error bars indicate population mean values and the standard error of mean, respectively. *** indicates P < 0.001.
In the case of Usp1 we used a PBac{PB} transposon induced loss-of-function allele, Usp1c05664, for validation and found that this allele had minor and conflicting effects: it improved the number of eclosed flies but reduced their climbing ability, and did not have a significant modulatory effect on either neurodegeneration or longevity (Supplementary Fig. S3).
Yod1 has mixed effects in a genetic Alzheimer’s disease model
We were curious to find out whether the modulatory effects of Yod1 were specific for mutant Htt induced pathology or similar effects could be observed in other protein misfolding disease models. Therefore, we tested the effects of Yod1 overexpression in an Alzheimer’s disease (AD) model, which is based on the expression of human amyloid beta peptide (Aβ, amino acids 1–42)19. Neuronal expression of UAS-Aβ transgene does not reduce the number of eclosed adults, but shortens lifespan, impairs motor activity19, and causes neurodegeneration. We tested the effects of Yod1 co-expression on the latter three phenotypes using the Yod1.flag transgene and found that although it increased the lifespan of Aβ expressing flies (median lifespan increased to 29.4 days from 26.47 days in controls, P = 2.8 × 10–8, nexp = 175, ncont = 212, Fig. 3A), it significantly enhanced neurodegeneration (P = 5.8 × 10–4, n = 10/10) in the eyes of 10-day-old flies to 5.84 ± 0.06 (average ± SEM) from 6.11 ± 0.03 in controls (Fig. 3B). Its effect on the motor activity of 10-day-old AD flies was not significant (P = 0.085, nexp = 59, ncont = 47, Fig. 3C).
Overexpression of Yod1 has mixed effects on Aβ induced phenotypes. (A) Simultaneous neuronal overexpression of the Yod1.flag transgene significantly increases the median lifespan of Aβ expressing flies (P = 2.8 × 10–8, nexp = 175, ncont = 212), (B) but it also significantly increases the degeneration of photoreceptor neurons (P = 5.8 × 10–4, n = 10/10). Boxes show 25th, 50th and 75th quartiles of the average number of rhabdomeres per ommatidia in compound eyes, whiskers indicate 10th and 90th quartile values. (C) Overexpression of Yod1.flag does not have a significant effect on the climbing ability of Aβ expressing flies. Data points show vertical distances climbed by individual flies in 5 s, horizontal lines and error bars indicate population mean values and the standard error of mean, respectively. *** indicates P < 0.001.
We repeated these experiments using the Yod1EY07831 overexpression allele and got similar results: significantly improved lifespan but reduced neuronal survival with no significant change in climbing speed (Supplementary Fig. S4). As the all-round phenotypic improvements that we observed in the HD model upon Yod1 overexpression were not characteristic for the AD model we concluded that the effects of Yod1 are rather specific to mHtt-induced pathology than having a generic positive effect in response to accumulation of misfolded proteins.
Yod1 overexpression moderately affects the size distribution of mHtt aggregates
mHtt is an aggregation prone protein and disease modifying mechanisms might lead to alteration in the aggregation properties of mHtt. To investigate whether the positive effects of Yod1 overexpression on disease pathology concur with changes in mHtt aggregation we expressed a UAS-HTT.96Q.Cerulean transgene, encoding the first exon of human HTT with 96 residue long polyQ region fused with a Cerulean fluorescent protein, either alone or simultaneously with Yod1EY07831 and analyzed the number and size of mHtt aggregates in salivary gland cells via confocal microscopy (Fig. 4, Supplementary Fig. S5). We found no significant difference in the average number of visible aggregates per cell (100 ± 6 (average ± SEM), n = 96 in flies co-expressing mHtt and Yod1, and 96.1 ± 3.6, n = 74 in mHtt expressing controls, P = 0.48) (Fig. 4A). However, we could observe a mild but statistically significant shift towards larger aggregates as the ratio of aggregates with apparent size of > 2 µm increased to 22.1 ± 0.8% from 17 ± 0.8% in controls (P = 5 × 10–6, Wilcoxon Sum of Ranks test) (Fig. 4B,C).
The effect of Yod1 overexpression on mHtt aggregation. (A) Overexpression of Yod1 does not alter the total number of mHtt aggregates (P = 0.48, nexp = 96, ncont = 74). (B) The distribution of the number of mHtt aggregates of different apparent diameters in flies expressing HTT.96Q.Cerulean alone or co-expressing HTT.96Q.Cerulean and Yod1. (C) Yod1 overexpression moderately increases the proportion of larger (> 2 μm) aggregates (P = 5 × 10–6, Wilcoxon Sum of Ranks test). The effect on the aggregation of HTT.96Q.Cerulean protein was analyzed in larval salivary gland cells via confocal microscopy. Boxes show 25th, 50th and 75th quartiles, whiskers mark 10th and 90th quartile values. *** indicates P < 0.001.
Yod1 overexpression results in partial restoration of the transcriptional program in HD flies
To identify molecular pathways that are modulated in mHtt expressing flies upon Yod1 overexpression we performed transcriptome analysis. We applied RNA-sequencing on head samples of 5-day-old female flies carrying the elav-GAL4 driver alone (control), or overexpressing Httex1.Q120, Yod1, or Httex1.Q120 and Yod1 simultaneously under the influence of elav-GAL4. The data validated significant overexpression of Yod1 in elav-GAL4/+; Yod1EY07831/+ and elav-GAL4/+ ; Httex1.Q120/+; Yod1EY07831/+ flies (Supplementary Fig. S6A) and also proved that the expression level of mutant Huntingtin is not reduced in elav-GAL4/+; Httex1.Q120/+; Yod1EY07831/+ flies (Supplementary Fig. S6B), implying that the phenotypic effects observed in genetic interaction tests are not due to the downregulation of the Httex1.Q120 transgene.
Yod1 overexpression had relatively mild effects on transcription. It led to altered expression of 427 genes compared to the elav-GAL4 control, out of which 135 genes were downregulated and 292 genes were upregulated at adjusted significance level of α = 0.05 (Fig. 5A, Supplementary file S2). Httex1.Q120 expressing HD flies showed a more profound transcriptomic response: 1441 genes were downregulated while 1873 were upregulated, altogether 3314 genes had altered expression levels (Fig. 5A, Supplementary file S2). In flies co-expressing Httex1.Q120 and Yod1 985 genes were downregulated and 907 were upregulated (1892 genes total) compared to the elav-GAL4 control (Fig. 5A, Supplementary file S2). Thus, overexpression of Yod1 led to a 43% reduction in the number of dysregulated genes in HD flies. Furthermore, we found that a surprisingly large set of 250 genes showed altered transcript levels in both Yod1 and Httex1.Q120 overexpressing flies (Fig. 5B). The considerable overlap between the mHtt and Yod1 sets suggests that Yod1 overexpression modulates molecular processes that are also affected by the presence of mHtt.
RNA-seq analysis indicates partial restoration of transcriptional dysregulation upon Yod1 overexpression in HD flies. (A) While overexpression of Yod1 have moderate transcriptional effects, overexpression of mHtt leads to the dysregulation of 3314 genes. Overexpression of Yod1 in HD flies reduces the number of dysregulated genes by 43%. The graph shows the number of genes showing altered expression compared to elav-GAL4 control at significance level α < 0.05. (B) Venn diagrams show the number of genes having significantly altered transcript levels compared to the elav-GAL4 control in the three experimental genotypes.
We performed Gene Set Enrichment Analysis (GSEA) and found that the most significantly affected biological processes by Yod1 overexpression are related to protein biosynthesis and folding, including Gene Ontology Biological Process (GO BP) terms cytoplasmic translation (GO:0002181, P = 5.58 × 10–44), ribosome assembly (GO:0042255, P = 9.43 × 10–7), 'de novo' posttranslational protein folding (GO:0051084, P = 4.37 × 10–5), ribonucleoprotein complex assembly (GO:0022618, P = 4.47 × 10–4), cellular response to topologically incorrect protein (GO:0035967, P = 0.0012), and response to unfolded protein (GO:0006986, P = 0.0012), among others (Supplementary file S3). GSEA also indicated that the transcriptional changes observed in Yod1 overexpressing flies are significantly enriched in datasets of models of two human diseases, HD (P = 0.017) and Machado-Joseph disease (Spinocerebellar Ataxia 3, P = 0.041), another polyQ induced neurodegenerative disorder. This finding, together with the above described significant overlap between mHtt and Yod1 induced transcriptomic changes suggests that overexpression of Yod1 influences molecular pathways that are important in mHtt-induced pathology.
The transcriptional changes in Httex1.Q120 expressing HD flies showed significant enrichment in gene datasets of models of neurodegenerative diseases, such as HD (P = 6.37 × 10–8), Parkinson's disease (P = 7.49 × 10–8), and tauopathy (P = 1.22 × 10–6), among others, validating the HD model (Supplementary file S3). The genes upregulated in HD flies were enriched in GO BP terms related to antimicrobial defense, chromatin assembly, protein synthesis, and protein metabolism and clearance (Fig. 6A, Supplementary file S3). The set of downregulated genes in HD flies were enriched in GO BP terms related to neuronal development and plasticity, protein modifications, response to light stimulus, and vesicular transport (Fig. 6B, Supplementary file S3).
Overexpression of Yod1 partially restores biological processes affected by mHtt. (A) Top 20 most significantly enriched GO biological process terms (colored based on functional categories) of genes upregulated or (B) downregulated in head samples of mHtt expressing flies vs. non-expressing siblings. (C) Top 20 most significantly enriched GO biological process terms of genes whose expression was fully or partially restored by downregulation or (D) upregulation in Yod1 co-expressing HD flies compared to HD flies. Overlaps between functional categories enriched in A/C or B/D indicate that overexpression of Yod1 restores the expression of genes dysregulated as a result of mHtt expression. Gene set enrichment analysis was performed using FlyEnrichr, adjusted P values were calculated by applying Benjamini–Hochberg correction for multiple hypothesis testing, z-score corresponds to the deviation from the expected rank20.
To directly analyze the effects of Yod1 on mHtt-induced transcriptional alterations we compared RNA-seq data of flies expressing Httex1.Q120 only with those of flies co-expressing Httex1.Q120 and Yod1. We found that co-expression of Yod1 in HD flies led to the significant downregulation of 1674 genes, and upregulation of 1381 genes (at α = 0.05) compared to flies expressing Httex1.Q120 alone (Supplementary file S2). The top five upregulated genes were Integrator 12 (encodes a protein involved in snRNA transcription), CG4611 (encodes a predicted tRNA binding protein), CG18577 (encodes a protein of unknown function), yellow (encodes a protein involved in melanization), and CG31219 (encodes a predicted serine-type endopeptidase); while the top 5 downregulated genes were hoka (encodes an endothelial barrier protein), Lsp1alpha (encodes a larval storage protein), Mucin 68Ca (encodes a mucin protein), Cecropin C (encodes an antibacterial protein), and Induced by Infection (encodes a micropeptide that responds to wasp infection)21. In case of 59.3% of the 3055 differentially expressed genes overexpression of Yod1 fully or partially restored the level of transcription in HD flies, i.e. we measured upregulation of genes that were downregulated in HD flies compared to elav-GAL4 control (748 genes), or conversely, we measured downregulation of genes that were upregulated in HD flies compared to elav-GAL4 control (1065 genes). Not surprisingly, the sets of genes with restored expression showed most significant enrichments of similar GO BP terms that were described earlier as enriched among dysregulated genes in HD flies, i.e. terms related to antimicrobial defense, protein synthesis, and protein metabolism and clearance in the set of genes downregulated upon Yod1 co-overexpression (Fig. 6C, Supplementary file S3), and terms related to response to light stimulus, neuronal development and plasticity, protein modifications, and vesicular transport in the set of genes upregulated upon Yod1 co-expression in HD flies (Fig. 6D, Supplementary file S3).
Another interesting group contains sets of those genes, which were not dysregulated in HD flies but show altered expression in Yod1 co-expressing HD flies compared to HD siblings. Specifically, we identified 615 genes, which were upregulated, and 545 genes, which were down-regulated as a response to Yod1 overexpression in HD flies but were not dysregulated in mHtt expressing flies compared to elav-GAL4 controls. The upregulated genes are enriched in GO BP categories related to regulation of transcription, mRNA processing, morphogenesis and synaptic transmission (Fig. 7A, Supplementary file S3), while the downregulated genes are enriched in GO BP terms related to protein synthesis, mitochondrial ATP synthesis, metabolic processes, and muscle cell development (Fig. 7B, Supplementary file S3). We hypothesize that altered regulation of these processes might play a role in the suppression of HD pathology and phenotypes upon Yod1 overexpression.
Overexpression of Yod1 in HD flies influences biological processes that might contribute to the suppression of symptoms. (A) Top 20 most significantly enriched GO biological process terms (colored based on functional categories) of genes that are not dysregulated in HD flies but upregulated or (B) downregulated in head samples of flies co-expressing Yod1 and mHtt expressing flies vs. HD siblings. Gene set enrichment analysis was performed using FlyEnrichr, adjusted P values were calculated by applying Benjamini–Hochberg correction for multiple hypothesis testing, z-score corresponds to the deviation from the expected rank20.
Discussion
Accumulation of misfolded proteins is a characteristic feature of numerous neurodegenerative diseases indicating that dysfunction of the cellular protein clearance system is a common theme in these disorders22. One of the major protein clearance mechanisms of eukaryotic cells is the ubiquitin–proteasome system that participates in protein quality control by degrading misfolded proteins23. Deubiquitinase enzymes are critical components of the UPS as they are required both for the release of Ub monomers during Ub protein synthesis and for the hydrolysis of conjugated Ub from protein substrates24. Hence, DUBs make a substantial contribution to the preservation of the monoubiquitin pool, regulating proteolysis and ensuring proper proteostasis. Unsurprisingly, DUB enzymes were implicated in the pathology of various neurodegenerative disorders, including Alzheimer’s disease, Parkinson’s disease (PD), Amyotrophic lateral sclerosis (ALS), and HD25. In the case of HD, previous studies indicated the involvement of at least four deubiquitinases in pathology, ataxin-326, YOD127, Usp1228, and Usp1929.
Here we described a project aimed at the identification of DUBs capable of modulating pathology in an animal model of HD. We tested genetic interactions of a mutant Htt transgene with 32 genes encoding deubiquitinases belonging to five DUB protein families and found that overexpression of Yod1, a DUB belonging to the OTU (ovarian tumor) superfamily of cysteine proteases, reduced the degeneration of photoreceptor neurons, and improved motor performance, viability and longevity of HD flies. Yod1 overexpression did not have a similarly overall positive effect on the phenotypes of Aβ1-42 expressing AD flies, suggesting that its effects might be at least in part specific to mHtt induced pathology in the fly model.
Its human ortholog, YOD1 (protein identity: 42%, similarity: 58%), is an enzymatically active cysteine protease with K11-, K48- and K63-linked ubiquitin-specific deubiquitinase activity30,31. YOD1 participates in several biological processes that can be linked to protein misfolding induced neurodegeneration, including ER-associated degradation (ERAD), autophagic clearance of damaged lysosomes (Endo-Lysosomal Damage Response, ELDR), immunomodulation, and regulation of the Hippo and NF-κB signaling pathways30,32,33,34,35. The most-well characterized role of YOD1 is the one it plays in ERAD. Several lines of evidence indicate that YOD1 plays a role in ERAD dependent degradation of both ubiquitinated and non-ubiquitinated proteins30,31,36,37. Depending on the protein substrate YOD1 is involved in (at least) two distinct steps of ERAD: retro-translocation of the misfolded protein to the cytosol and subsequent proteasomal degradation36. One of the main interacting partners of YOD1 in ERAD related functions is ATPase p97/Valosin-containing protein (VCP) that participates in the retro-translocation of misfolded proteins from the ER to the cytosol. In case of ubiquitinated proteins YOD1 is required for the deubiquitination of Ub-conjugated ERAD substrates and reduced YOD1 activity results in the accumulation of Ub-conjugated forms of these proteins through disturbing p97-associated functions30,37. In contrast, the effect of YOD1 on non-ubiquitinated protein substrates, such as cholera toxin A1 (CTA1) and nonglycosylated yeast pro-α factor, is dissimilar as it antagonizes their retro-translocation via a mechanism not involving substrate ubiquitination31. This suggests that this effect might be a consequence of regulating the ubiquitination state of the components of the ERAD machinery. In the case of proteins that are dislocated from the ER in a p97 and YOD1 independent manner, YOD1 with p97 was shown to be required for cytosolic deglycosylation and targeting to the proteasome36.
YOD1 was shown previously to be upregulated upon various stress conditions in vitro, including inhibition of proteasome, ER stress, uncoupling of mitochondrial oxidative phosphorylation, and by the expression of mutant Htt (HttQ74)27. Excess YOD1 reduced the level of HttQ74 protein in a cell culture model of HD, and also attenuated HttQ74, α-synuclein, and synphilin-1 induced decreased cell viability in a deubiquitinase activity dependent manner27. In human brain samples YOD1 was shown to co-localize with α-synuclein-positive Lewy bodies in PD patients but it did not co-localize with senile plaques and neurofibrillary tangles in AD patients, nor with neuronal nuclear inclusions in HD patients27, suggesting that in the latter disorders YOD1 does not exert its effects on the aggregated forms of disease related proteins. Our aggregate analysis corroborates these observations as we could detect only a very mild effect on mHtt aggeragates in Yod1 overexpressing flies.
To shed light on the biological processes that are adjusted along with the Yod1-dependent suppression of HD pathology, we applied RNA-seq analysis. Neuronal overexpression of Yod1 even in wild-type flies provided clues suggesting that it might modulate molecular processes important in HD pathology. By performing GSEA we found that differentially expressed genes (DEGs) in Yod1 overexpressing flies are enriched in protein folding related GO BP terms that are also enriched in human presymptomatic HD striatal and cortical tissues, including 'de novo' posttranslational protein folding, chaperone-mediated protein folding, and response to unfolded protein8. GSEA also showed that DEGs in Yod1 overexpressing flies are significantly enriched in datasets of models of only two human disorders, Huntington’s disease and Machado-Joseph disease (Spinocerebellar Ataxia Type 3), both of which are polyglutamine-induced neurodegenerative disorders38. Furthermore, by comparing our RNA-seq datasets we also found that DEGs in HD flies were enriched among DEGs in Yod1 overexpressing flies.
In HD flies, Yod1 overexpression reduced the number of DEGs by 43% and fully or partially restored the expression of a number of genes involved in biological processes that are also significantly affected in human HD brain samples. Thus, it led to a substantial improvement of mHtt-induced dysregulation of gene activity indicating a profound cellular effect. Interestingly, DEGs whose expression was normalized by upregulation are enriched in several GO BP categories that also show enrichment in late striatal HD patient samples (BP terms related to axonal guidance, neuronal differentiation, synaptic transmission), while DEGs whose expression was normalized by downregulation are enriched in several GO BP categories that show enrichment in presymptomatic HD patient samples (BP terms related to immune effector, and apoptotic processes)8. These findings indicate, that increased Yod1 activity results in fundamental changes in cellular physiology that influence not only protein homeostasis but also the transcriptional program, thereby having a profound positive impact on mHtt-induced pathology.
However, as the activities of Yod1 are not directly related to transcription, we believe that its effect on transcript levels might be indirect. Ubiquitylation/deubiquitylation regulates the stability and/or activity of a variety of factors directly regulating transcription39, therefore figuring out which of these factors and/or processes have significant importance in Yod1-dependent rescue of HD pathology will require further studies. Some promising leads for these inquiries can be the Hippo pathway and chromatin structure regulation by histone methylation. Based on KEGG pathway analysis components of the Hippo signaling pathway, which is dysregulated in HD40 and regulated by YOD135, are significantly enriched (Padj. = 0.0071) among genes differentially expressed in HD + Yod1 vs. HD flies (these genes are: Act87E, Act42A, aPKC, app, baz, bsk, dlg1, crb, dco, fred, Gug, l(2)gl, lft, Patj, sd, sdt, tws, wgn, and 14-3-3zeta). Another possible lead is related to the regulation of chromatin structure. Based on GSEA analysis using Flyenrichr with the “Transcription Factors from DroID 2015” dataset genes that are regulated by the histone H3 lysine K4 specific, activating histone methyltransferase trx are enriched (Padj. = 1.037 × 10–140), while genes that are regulated by the histone H3 lysine K27 specific, repressing histone methyltransferase E(z) are depleted (Padj. = 3.617 × 10–34) among genes differentially expressed in HD + Yod1 vs. HD flies. In one of our previous studies, we showed that the availability of these methyltransferase enzymes influences HD pathology41. Thus, we find it conceivable that Yod1 exerts its pathology-modifying effects, at least in part, by influencing the stability or activity of proteins and macromolecular complexes directly regulating chromatin structure and/or transcription.
Materials and methods
Drosophila stocks and husbandry
Drosophila stocks were maintained on standard Drosophila medium (3% dry yeast, 4% cornmeal, 2% wheat flour, 9% glucose, 0.7% agar, 0.15% Tegosept) at 18 °C and expanded at 25 °C. Crosses were made at 25 °C unless noted otherwise.
The w; UAS-Httex1.Q120 and w; UAS-Httex1.Q25 stocks16 were kind gifts of J. Lawrence Marsh (University of California, Irvine, CA, USA).
The following stocks: w1118; P{w+mGT = GT1}Rpn11BG01694/CyO, w1118; PBac{w+mC = PB}Usp1c05664, y1 v1; P{y+t7.7 v+t1.8 = TRiP.JF02992}attP2, y1 w67c23; P{y+mDint2 w+mC = EPgy2}Yod1EY07831, w*; P{w+mC = UAS-HTT.96Q.Cerulean}2, and y1 M{RFP3xP3.PB GFPE.3xP3 = vas-int.Dm}ZH-2A w*; M{3xP3-RFP.attP}ZH-86Fb, and w*; PBac{w+mC = UAS-Abeta.1-42}VK00033 were from the Bloomington Drosophila Stock Center.
The following stocks: w1118; P{GD11368}v21894, P{KK100532}VIE-260B, w1118; P{GD10916}v34574, w1118; P{GD11489}v21978, w1118; P{GD3255}v7113, P{KK108078}VIE-260B, w1118; P{GD7628}v18231, P{KK100733}VIE-260B, P{KK108313}VIE-260B, P{KK102888}VIE-260B, P{KK101035}VIE-260B, w1118; P{GD13944}v42609, w1118; P{GD5871}v18981/TM3, P{KK100775}VIE-260B, w1118; P{GD4739}v15340, w1118; P{GD14040}v28960, P{KK101867}VIE-260B, P{KK101319}VIE-260B, and P{KK100377}VIE-260B were from the Vienna Drosophila Resource Center.
The following stocks: w1118; P{RS3}notCB-5509-3, yd2 w1118 P{ey-FLP.N}2 P{5xglBS-lacZ.38-1}TPN1; P{neoFRT}82B P{lacW}CSN5L4032/TM6B, P{Car20y}TPN1 Tb1 were from the Kyoto Stock Center.
Generation of Usp52 deletion mutants were described in42. Deletion null alleles for Yod1 and Duba were generated by standard P-element remobilization technique43. In brief, flies carrying the P-element were crossed to flies expressing the P{Δ2-3} transposase. Jump starter progeny males carrying both the P-element and the transposase were crossed to w; TM3, Sb e/TM6B, Tb Hu e balancer lines. Approximately 200 mutant candidate progenies were selected for each experiment and crossed to balancers to establish stocks. Candidate stocks were screened by PCR for deletions and the identified deletions were sequenced by Sanger sequencing. The origin of P-elements and the nature of mutations are in Supplementary Table S1. Indel null alleles of DUB genes were generated by an optimized CRISPR–Cas9 mutagenesis tool for Drosophila genome engineering44. For each gene, a single guide RNA targeted site was chosen in exons considering the minimal off-target effect and shortest possible distance from the START codon. Targeting sequences of 20 bp were cloned into pCFD3 guide RNA expressing vector (Addgene, cat. no. 49410). Fly stocks constitutively expressing the guide RNA were established and crossed to nanos-Cas9 flies (Bloomington ID: 54591). G0 flies expressing both Cas9 and gRNA were crossed individually to balancer lines and four candidate progeny from each G0 line were selected and stocks were established. Approximately 100 candidate stocks for each gene were established. Insertions/deletions were identified by sequencing. The nature of mutations is on Supplementary Table S2.
To generate UAS-Yod1.flag lines the coding sequence of Yod1 was amplified from genomic DNA template using Q5 DNA polymerase (New England Biolabs, NEB) and forward and reverse primers with KpnI and EcoRI restriction sites (fw: GGTACCAAAATGACGGGTTCGTTCA, rev: GAATTCGCAATCTCTCCAAAGTTCT), respectively. The amplified Yod1 coding sequence (CDS) was cloned to pJET1.2 vector using CloneJET PCR Cloning Kit (Thermo Fisher Scientific, TFS), then subcloned to pENTR3C using KpnI, EcoRI and T4 DNA ligase (TFS). From this entry clone Yod1 CDS was recombined to a modified, φC31 attB site containing pTWF.attB vector using Gateway LR Clonase II Enzyme mix (TFS). The pTWF.attB-Yod1 expression clone was injected to y1 M{RFP3xP3.PB GFPE.3xP3 = vas-int.Dm}ZH-2A w*; M{3xP3-RFP.attP}ZH-86Fb Drosophila embryos for φC31 mediated site-specific transgenesis. Homozygous w; UAS-Yod1-3xFLAG transgenic strains carrying the Yod1 construct in the third chromosomal ZH-86Fb docking site were established from F1 progeny expressing the mini-white marker gene.
Viability and longevity analysis
Second or third chromosomal DUB mutants were crossed to elav-GAL4; Sp/SM6b or elav-GAL4; Sb/ TM6 Hu females, respectively, then elav-GAL4; DUB/Sp or elav-GAL4; DUB/Sb F1 male progeny were crossed to w; UAS-Httex1.Q120 females in vials. Crosses were kept at 25 °C and passed once after seven days. F2 progeny were collected for five days after the beginning of eclosion and the number of flies belonging to different genotype categories were recorded. Viability was expressed as relative eclosion of the DUB mutation carrying mHtt expressing category ((elav-GAL4 > Q120 DUB/elav-GAL4 > Q120)/(Q120 DUB/Q120)).
For longevity analysis freshly eclosed elav-GAL4 > mHtt DUB females and elav-GAL4 > mHtt control females were transferred to fresh vials, at most 30 flies per vial. Flies were kept at 25 °C, passed to fresh vials twice a week, and the number of perished flies was recorded daily.
Neurodegeneration assay
Degeneration of photoreceptor neurons was followed by the pseudopupil assay18. For this, flies were decapitated with a razor blade and their heads were fixed in a ~ 45° angle in a drop of colorless nail polish on a surface of a microscope slide. After the nail polish solidified heads were covered with immersion oil (Merck), and the structure of compound eyes was visualized using a Nikon Eclipse 80i compound microscope with 50 × oil objective. Each ommatidium of the eye of wild-type flies contains seven visible rhabdomeres, light gathering structures of photoreceptor neurons, the number of which is reduced upon degeneration of neurons. To measure the level of neurodegeneration we determined the average number of intact rhabdomers per ommatidium by counting the number of rhabdomeres in at least 20 ommatidia per compound eye of at least 10 animals per genotype.
Climbing assay
Fruit flies exhibit negative geotaxis and climb upwards on vertical surfaces that allows the quantitation of their motor abilities. Climbing assays of groups of three-day-old female flies were performed in empty glass vials. Flies were tapped to the bottom of the vial and their upward climb was recorded on video. The distance climbed in 5 s after tapping was determined by manual curation.
Immunohistochemistry
The salivary glands of wandering L3 larvae were dissected in PBS and mounted on microscope slides. The presence of HTT.96Q.Cerulean aggregates was visualized in at least 10 biological replicates with an Olympus Fluoview Fv10i confocal microscope using 60 × oil objective. 10–12 successive optical slices (slice thickness = 1.54 µm) were taken from each sample and the number of visible aggregates belonging to distinct size categories per cell (nexp = 96, ncont = 74) were determined using the ROI manager tool of ImageJ Fiji software.
RNA-sequencing and data analysis
Total RNA was isolated from heads of 50 five-day-old females, three biological replicates per genotype (elav-GAL4/+, elav-GAL4/+; Httex1.Q120/+, elav-GAL4/+; Yod1EY07831/+, and elav-GAL4/+; Httex1.Q120/+; Yod1EY07831/+) using Monarch Total RNA Miniprep Kit (NEB). The integrity and concentration of RNA samples were determined with an Agilent 2100 Bioanalyzer instrument using Agilent RNA 6000 nano kit. PolyA-RNA samples were prepared from 800 ng total RNA with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB), then indexed, strand-specific RNA-sequencing libraries were generated using NEBNext Ultra II Directional RNA Library Prep with Sample Purification Beads (NEB) and NEBNext Multiplex Oligos for Illumina (NEB) according to the manufacturer’s protocol. Sequencing libraries were validated and quantitated with Agilent 2100 Bioanalyzer instrument using Agilent DNA 1000 kit. Equimolar amounts of indexed libraries were pooled, denatured and sequenced in three technical replicate sequencing runs in an Illumina MiSeq instrument using MiSeq Reagent Kit v3-150 kits generating 2 × 75 bp paired-end reads. Base calling and quality score generation were done by on-board Real Time Analysis (RTA 1.18.54.0) software while demultiplexing and FASTQ file generation were done by MiSeq Reporter 2.6.2.3. The average read count was 4.3 million reads per biological replicate. TrimGalore/Cutadapt was used for adapter trimming and quality based trimming of sequencing reads. Sequences were aligned to the Drosophila melanogaster reference genome r6.45 with HISAT2 (parameters: –rna-strandness RF)45 and gene specific read counts were calculated in R using the summarizeOverlaps function of Bioconductor. DESeq246 was applied for differential gene expression analysis with cpm > 1 read count filter. For gene enrichment analysis FlyEnricher20 was used with the Human_Disease_from_FlyBase_2017 and GO_Biological_Process_2018 gene set libraries.
Statistical analysis
We used Shapiro–Wilk test for testing normal distribution of data. In multiple comparison testing of data from the genetic screen we applied Bonferroni correction and used corrected α = 0.05 level (= 0.001428 for data shown on Fig. 1) as significance threshold. We used Χ2 test to analyze eclosion data. Differences in median lifespan were tested using Fischer’s exact test. Mann–Whitney U test was used to analyze unpaired samples not following normal distribution (climbing and aggregation data), pseudopupil data were analyzed using two-tailed, unpaired t-test.
Data availability
RNA-seq sequence files generated and analyzed during the current study are available in the NCBI Sequence Read Archive repository under accession PRJNA991110 (https://www.ncbi.nlm.nih.gov/sra/PRJNA991110). Other datasets used and analyzed during the current study are available from the corresponding author on reasonable request.
References
Candelise, N. et al. Protein aggregation landscape in neurodegenerative diseases: Clinical relevance and future applications. Int. J. Mol. Sci. 22, 6016 (2021).
Saudou, F. & Humbert, S. The Biology of Huntingtin. Neuron 89, 910–926 (2016).
Riguet, N. et al. Nuclear and cytoplasmic huntingtin inclusions exhibit distinct biochemical composition, interactome and ultrastructural properties. Nat. Commun. 12, 6579 (2021).
Jimenez-Sanchez, M., Licitra, F., Underwood, B. R. & Rubinsztein, D. C. Huntington’s disease: Mechanisms of pathogenesis and therapeutic strategies. Cold Spring Harb. Perspect. Med. 7, (2017).
The Huntington’s Disease Collaborative Research Group. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosomes. Cell 72, 971–983 (1993).
Ortega, Z. & Lucas, J. J. Ubiquitin-proteasome system involvement in Huntington’s disease. Front. Mol. Neurosci. 7, 77 (2014).
Harding, R. J. & Tong, Y. Proteostasis in Huntington’s disease: Disease mechanisms and therapeutic opportunities. Acta Pharmacol. Sin. 39, 754–769 (2018).
Malla, B., Guo, X., Senger, G., Chasapopoulou, Z. & Yildirim, F. A Systematic review of transcriptional dysregulation in huntington’s disease studied by RNA sequencing. Front. Genet. 12, 1898 (2021).
Lee, H. S., Simon, J. A. & Lis, J. T. Structure and expression of ubiquitin genes of Drosophila melanogaster. Mol. Cell Biol. 8, 4727–4735 (1988).
Nenoi, M., Ichimura, S. & Mita, K. Interspecific comparison in the frequency of concerted evolution at the polyubiquitin gene locus. J. Mol. Evol. 51, 161–165 (2000).
Redman, K. L. & Rechsteiner, M. Identification of the long ubiquitin extension as ribosomal protein S27a. Nature 338, 438–440 (1989).
Deák, P. & Boros, I. M. Ubiquitylation: Its role and medical significance. Acta Biol. Szegediensis 59, 261–273 (2015).
Sadowski, M., Suryadinata, R., Tan, A. R., Roesley, S. N. A. & Sarcevic, B. Protein monoubiquitination and polyubiquitination generate structural diversity to control distinct biological processes. IUBMB Life 64, 136–142 (2012).
Mevissen, T. E. T. & Komander, D. Mechanisms of deubiquitinase specificity and regulation. Annu. Rev. Biochem. 86, 159–192 (2017).
Sap, K. A., Geijtenbeek, K. W., Schipper-Krom, S., Guler, A. T. & Reits, E. A. Ubiquitin-modifying enzymes in Huntington’s disease. Front. Mol. Biosci. 10, (2023).
Barbaro, B. A. et al. Comparative study of naturally occurring huntingtin fragments in Drosophila points to exon 1 as the most pathogenic species in Huntington’s disease. Hum. Mol. Genet. 24, 913–925 (2015).
Zsindely, N., Nagy, G., Siági, F., Farkas, A. & Bodai, L. Dysregulated miRNA and mRNA expression affect overlapping pathways in a Huntington’s disease model. Int. J. Mol. Sci. 24, 11942 (2023).
Song, W. et al. Morphometric Analysis of Huntington’s Disease Neurodegeneration in Drosophila. in Tandem Repeats in Genes, Proteins, and Disease 41–57 (Humana Press, Totowa, NJ, 2013). https://doi.org/10.1007/978-1-62703-438-8_3.
Jonson, M., Pokrzywa, M., Starkenberg, A., Hammarstrom, P. & Thor, S. Systematic Aβ analysis in drosophila reveals high toxicity for the 1–42, 3–42 and 11–42 peptides, and emphasizes N- and C-terminal residues. PLOS ONE 10, e0133272 (2015).
Kuleshov, M. V. et al. modEnrichr: A suite of gene set enrichment analysis tools for model organisms. Nucleic Acids Res. 47, W183–W190 (2019).
Gramates, L. S. et al. FlyBase: a guided tour of highlighted features. Genetics 220, iyac035 (2022).
de la Fuente, A. G. et al. Novel therapeutic approaches to target neurodegeneration. Br. J. Pharmacol.
Li, Y., Li, S. & Wu, H. Ubiquitination-proteasome system (UPS) and autophagy two main protein degradation machineries in response to cell stress. Cells 11, 851 (2022).
Snyder, N. A. & Silva, G. M. Deubiquitinating enzymes (DUBs): Regulation, homeostasis, and oxidative stress response. J. Biol. Chem. 297, 101077 (2021).
Liu, B. et al. Deubiquitinating enzymes (DUBs): Decipher underlying basis of neurodegenerative diseases. Mol. Psychiatry 27, 259–268 (2022).
Tsou, W.-L. et al. The deubiquitinase ataxin-3 requires Rad23 and DnaJ-1 for its neuroprotective role in Drosophila melanogaster. Neurobiol. Dis. 82, 12–21 (2015).
Tanji, K. et al. YOD1 attenuates neurogenic proteotoxicity through its deubiquitinating activity. Neurobiol. Dis. 112, 14–23 (2018).
Aron, R. et al. Deubiquitinase Usp12 functions noncatalytically to induce autophagy and confer neuroprotection in models of Huntington’s disease. Nat. Commun. 9, 3191 (2018).
He, W.-T. et al. HSP90 recognizes the N-terminus of huntingtin involved in regulation of huntingtin aggregation by USP19. Sci. Rep. 7, 14797 (2017).
Ernst, R., Mueller, B., Ploegh, H. L. & Schlieker, C. The otubain YOD1 is a deubiquitinating enzyme that associates with p97 to facilitate protein dislocation from the ER. Mol. Cell 36, 28–38 (2009).
Bernardi, K. M., Williams, J. M., Inoue, T., Schultz, A. & Tsai, B. A deubiquitinase negatively regulates retro-translocation of nonubiquitinated substrates. Mol. Biol. Cell 24, 3545–3556 (2013).
Liu, C. et al. The otubain YOD1 suppresses aggregation and activation of the signaling adaptor MAVS through Lys63-linked deubiquitination. J. Immunol. (Baltimore, Md.: 1950) 202, 2957–2970 (2019).
Papadopoulos, C. et al. VCP/p97 cooperates with YOD1, UBXD1 and PLAA to drive clearance of ruptured lysosomes by autophagy. EMBO J. 36, 135–150 (2017).
Schimmack, G. et al. YOD1/TRAF6 association balances p62-dependent IL-1 signaling to NF-κB. eLife 6, (2017).
Park, J.-H., Kim, S.-Y., Cho, H.-J., Lee, S.-Y. & Baek, K.-H. YOD1 Deubiquitinates NEDD4 involved in the Hippo signaling pathway. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 54, 1–14 (2020).
Sasset, L., Petris, G., Cesaratto, F. & Burrone, O. R. The VCP/p97 and YOD1 proteins have different substrate-dependent activities in endoplasmic reticulum-associated degradation (ERAD). J. Biol. Chem. 290, 28175–28188 (2015).
Locke, M., Toth, J. I. & Petroski, M. D. Lys11- and Lys48-linked ubiquitin chains interact with p97 during endoplasmic-reticulum-associated degradation. Biochem. J. 459, 205–216 (2014).
Bunting, E. L., Hamilton, J. & Tabrizi, S. J. Polyglutamine diseases. Curr. Opin. Neurobiol. 72, 39–47 (2022).
Mark, K. G. & Rape, M. Ubiquitin-dependent regulation of transcription in development and disease. EMBO Rep. 22, e51078 (2021).
Mueller, K. A. et al. Hippo signaling pathway dysregulation in human Huntington’s disease brain and neuronal stem cells. Sci. Rep. 8, 11355 (2018).
Song, W., Zsindely, N., Faragó, A., Marsh, J. L. & Bodai, L. Systematic genetic interaction studies identify histone demethylase Utx as potential target for ameliorating Huntington’s disease. Hum. Mol. Genet. 27, 649–666 (2018).
Kovács, L. et al. Role of the deubiquitylating enzyme DmUsp5 in coupling ubiquitin equilibrium to development and apoptosis in Drosophila melanogaster. PLoS One 10, e0120875 (2015).
Oh, S.-W. et al. A P-element insertion screen identified mutations in 455 novel essential genes in Drosophila. Genetics 163, 195–201 (2003).
Port, F., Chen, H.-M., Lee, T. & Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc. Natl. Acad. Sci. U S A 111, E2967-2976 (2014).
Kim, D., Paggi, J. M., Park, C., Bennett, C. & Salzberg, S. L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 37, 907–915 (2019).
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Acknowledgements
The authors thank Zita Kóra for technical assistance. We thank Prof. J. Lawrence Marsh (University of California, Irvine) for providing Drosophila stocks.
Funding
This research was funded by National Research, Development and Innovation Office [HU] grants GINOP-2.3.2-15-2016-00032 and GINOP-2.3.2-15-2016-00034. L.B. was supported by the János Bolyai Research Scholarship (BO/00522/19/8) of the Hungarian Academy of Sciences and by the ÚNKP-21-5-SZTE-574—New National Excellence Program of the Ministry for Innovation and Technology from the source of the National Research, Development and Innovation Fund. Open access publishing costs were covered by the University of Szeged Open Access Fund grant 6303. The funding bodies had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.
Author information
Authors and Affiliations
Contributions
A.F. performed Drosophila experiments and participated in the acquisition, analysis, and interpretation of data, and reviewing the manuscript. N.Z.: performed RNA-seq experiments, participated in the interpretation of data, and reviewed the manuscript., G.N.: performed bioinformatic and statistical analysis of data, and reviewed the manuscript, L.K. performed Drosophila experiments and revised the manuscript, P.D. participated in experiment design, interpretation of data, and reviewing the manuscript., L.B. participated in the study conception and design of experiments, statistical analysis, and interpretation of data, and wrote the manuscript draft. All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Farkas, A., Zsindely, N., Nagy, G. et al. The ubiquitin thioesterase YOD1 ameliorates mutant Huntingtin induced pathology in Drosophila. Sci Rep 13, 21951 (2023). https://doi.org/10.1038/s41598-023-49241-8
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-023-49241-8
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
