Abstract
Piwi-interacting RNAs (piRNAs) are genomically encoded small RNAs that engage Piwi Argonaute proteins to direct mRNA surveillance and transposon silencing. Despite advances in understanding piRNA pathways and functions, how the production of piRNA is regulated remains elusive. Here, using a genetic screen, we identify casein kinase II (CK2) as a factor required for piRNA pathway function. We show that CK2 is required for the localization of PRG-1 and for the proper localization of several factors that comprise the ‘upstream sequence transcription complex’ (USTC), which is required for piRNA transcription. Loss of CK2 impairs piRNA levels suggesting that CK2 promotes USTC function. We identify the USTC component twenty-one-U fouled-up 4 (TOFU-4) as a direct substrate for CK2. Our findings suggest that phosphorylation of TOFU-4 by CK2 promotes the assembly of USTC and piRNA transcription. Notably, during the aging process, CK2 activity declines, resulting in the disassembly of USTC, decreased piRNA production, and defects in piRNA-mediated gene silencing, including transposons silencing. These findings highlight the significance of posttranslational modification in regulating piRNA biogenesis and its implications for the aging process. Overall, our study provides compelling evidence for the involvement of a posttranslational modification mechanism in the regulation of piRNA biogenesis.
Similar content being viewed by others
Introduction
Piwi-interacting RNAs (piRNAs) associate with Piwi-clade Argonautes in metazoans1,2. piRNAs regulate diverse biological processes including virus defense3, sex determination4, male fertility5 and genome stability2. In C. elegans, piRNAs engage thousands of germline-expressed mRNAs6 and are required for recognizing and silencing newly-introduced foreign transgenes7.
In C. elegans, piRNAs are also known as 21 U-RNAs. 21 U-RNAs are transcribed by RNA polymerase II (Pol II) from thousands of genomic locations8. There are generally two types of 21 U-RNA loci, type 1 loci appear dedicated to the production of piRNAs and are located in huge clusters on chromosome IV (LGIV), while type 2 piRNAs are produced often bidirectionally at most pol II transcription start sites, including those producing longer transcripts such as mRNAs or ncRNAs. Both types of piRNAs are transcribed as capped short RNAs (piRNA precursors) of approximately 27 nts in length. Type 1 piRNA genes contain an 8 nt sequence element called the Ruby motif9 located approximately 40 nts upstream of their transcription start sites. Expression of type 1 (but not type 2) piRNA precursors depends on components of the ‘upstream sequence transcription complex (USTC)’—including PRDE-1, SNPC-4, TOFU-4 and TOFU-510. After transcription piRNA precursors are trimmed by the PUCH complex which executes 5’ end piRNA precursor cleavage11. The conserved exonuclease PARN-1 trims piRNA 3’ ends from the piRNA precursors to generate the mature 21 nt piRNAs12.
Casein kinase II (CK2) is a conserved serine/threonine kinase involved in many cellular processes including transcriptional regulation, DNA repair and cell survival13,14. Phosphorylation mediated by CK2 affects protein-protein interaction, for example, the phosphorylation of Rap1 by CK2 promotes Rap1/Bqt4 interactions to facilitate telomere protein complex formation15.
Aging in animals is associated with extensive functional decline, ranging from a decline in tissue integrity, motility, learning and memory, and immunity16. These changes are correlated with and likely caused at least partially by remodeling of the epigenome. However, the mechanisms underlying the loss of heterochromatin during the aging process remain largely unknown. Investigating the factors and mechanisms that contribute to the age-related loss of heterochromatin will provide valuable insights into the molecular basis of aging and its associated functional decline.
Here we show that CK2 is required for piRNA mediated silencing in C. elegans. Depletion of CK2 affects piRNA biogenesis. Furthermore, we demonstrate that CK2 is required for phosphorylation of the USTC component TOFU-4, which was previously reported to promote piRNA transcription10. We observed that this phosphorylation process is impaired during the aging process, resulting in disruptions to piRNA-mediated gene silencing. Collectively, our findings strongly indicate that CK2-mediated phosphorylation of TOFU-4 plays a critical role in regulating USTC assembly, promoting piRNA transcription, and is required for effective piRNA-mediated gene silencing during the aging process.
Results
CK2 promotes piRNA mediated silencing
In C. elegans extensive forward genetic screens have identified genes required for piRNA silencing. However, a limitation of these previous studies is that they require the resulting strains to be both piRNA silencing defective and viable. We reasoned that many important regulators of piRNA biogenesis might also function in pathways essential to development and viability. To identify such factors, we performed an RNAi-based screen of genes previously determined to be essential for viability. To do this we used a sensor system expressing a bright easily scored GFP transgene whose silencing requires an active piRNA pathway (Fig. 1a)17. In wild type worms, the sensor GFP signal is silenced within the pachytene zone of the ovary. However, in Piwi pathway mutants, bright GFP signal expands throughout the pachytene zone in the sensor animals (Fig. 1a, b).
Sensor animals were exposed to RNAi by feeding groups of about 100 worms on petri plates seeded with individual bacterial strains each expressing a dsRNA targeting one of 945 essential genes (Supplementary Data 1). This screen identified 39 positives, including several pathways that were previously described as essential for both viability and piRNA silencing (Supplementary Data 2). For example, the piRNA reporter was desilenced when hda-1 and smo-1 were depleted17, as well as depletion of the integrator complex, which has been shown to terminate C. elegans piRNA transcription18. Furthermore, we found that other genes, such as splicing factors and nuclear pore complex components, were also capable of desilencing the piRNA reporter. Of these genes, we were particularly intrigued to discover that knockdown of components of the Cassien Kinase 2 (CK2) complex led to desilencing of the piRNA sensor. For example, we found that RNAi of kin-10 (a regulatory subunit) and of kin-3 (a catalytic subunit) desilenced the piRNA sensor (Fig. 1c). To confirm the RNAi findings, we used an auxin-inducible degron system to conditionally deplete KIN-3 and KIN-10. Using CRISPR we inserted sequences encoding 46 amino acids corresponding to the plant degron into the endogenous kin-3 and kin-10 genes in a strain expressing the plant F-box protein TIR1 which upon auxin binding associates with the DEGRON domain to recruit the proteosome machinery19. Exposure of this strain to auxin at 1 mM completely desilenced the piRNA sensor (Fig. 1b–d), and upon prolonged exposure caused lethality as expected.
We next examined whether piRNA mediated silencing of transposable elements is disrupted in CK2 mutants. We examined the line2h and turmoil1 transposons, which are transposons silenced by piRNA pathway20,21. As expected, expression of the line2h and turmoil1 transposon mRNAs were increased in prg-1 and kin-3 mutants (Fig. 1e). Together, these findings suggest that the CK2 complex promotes piRNA mediated silencing.
CK2 promotes the levels of both mature and precursor piRNAs
We next wished to explore the effect of CK2 on piRNA levels. The levels of both mature and precursor piRNAs were determined as previously described22 by deep sequencing small RNA populations from 2 biological replicates of kin-3 degron animals after auxin exposure. For comparison we also analyzed small RNAs sequenced from wild type animals and from prg-1 and prde-1 mutants which are required respectively for stabilizing mature piRNAs and for promoting transcription of piRNA precursors. As previously shown22, mature piRNAs were dramatically reduced compared to wild type levels in both prg-1 and prde-1 mutants (Fig. 2a, b) and were also dramatically reduced in kin-3 depleted animals (Fig. 2a, b). Moreover, comparison of type 1 piRNAs in kin-3 and prg-1 mutants revealed similar levels of depletion across all ~15,000 species (Supplementary Fig. 1). Examination of type 2 piRNA levels revealed that kin-3 caused at most a partial reduction in levels, an effect similar to that of prde-1, which is required for transcription of type 1 but not type 2 piRNAs (Fig. 2c)22.
Libraries prepared to enrich for the small capped RNAs that represent piRNA precursors revealed that piRNA precursor levels were reduced in the kin-3 depleted libraries to levels similar to those found in prde-1 mutants (Fig. 2d, e). Taken together, these findings suggest that CK2 is required for the production or stability of piRNA precursors.
CK2 promotes the localization of USTC factors
Previous studies have shown that both PRG-1 protein levels and its localization to peri-nuclear nuage, P granules, are reduced in mutants that disrupt expression of piRNA precursors, while PRG-1 mRNA levels remain unaffected23. These findings suggest that PRG-1 like some other Argonaute proteins such as Ago2 becomes unstable when unloaded24. Consistent with these previous findings we found that in kin-3 depleted animals, PRG-1 mRNA levels were not reduced compared to wild type (Supplementary Fig. 2a), while in contrast, GFP::PRG-1 failed to localize in P-granules and instead localized diffusely in the cytosol (Fig. 3a). We observed an identical change in GFP::PRG-1 localization in animals with mutations in tofu-4 (Fig. 3a), a gene previously shown to be required for piRNA transcription and for PRG-1 protein stability10. When assayed by western blotting with GFP-specific antibodies in kin-3 and tofu-4 mutants, the band corresponding to full-length GFP::PRG-1 protein was strongly reduced and a 30KD band, corresponding in size to free GFP, became prominent (Fig. 3b). This finding suggests that the N-terminal GFP tag is proteolytically released from GFP::PRG-1 during the PRG-1 instability induced by kin-3 and tofu-4 mutations, and suggest that persistence of this proteolytic fragment explains the cytoplasmic GFP fluorescence observed in the mutants. We also monitored GFP::PGL-3, a P-granule marker whose localization in nuage does not depend on piRNA biogenesis (Supplementary Fig. 2b, c), and found that GFP::PGL-3 is localized properly in the nuage of kin-3 depleted animals.
SNPC-4 and PRDE-1 are two USTC factors required for piRNA biogenesis in C. elegans10. In germline nuclei, they form foci that co-localize with the piRNA gene clusters on LGIV. We found that kin-3-depleted animals and as previously reported tofu-4 mutants10 failed to form subnuclear foci of SNPC-4::GFP and mCHERRY::PRDE-1 (Fig. 3c, d). These findings suggest that CK2 acts along with TOFU-4 to promote SNPC-4 and PRDE-1 localization to piRNA clusters where transcription occurs. GFP::KIN-3 localizes broadly to somatic and germline nuclei where it appears enriched on chromatin, including within the pachytene region of the germline (Fig. 3e), a localization consistent with a possible role in piRNA expression. Indeed, we can see the colocalization between KIN-3 and PRDE-1. However, we did not detect any enriched signal of GFP::KIN-3 in PRDE-1 foci. Additionally, we did not identify any changes of GFP::KIN-3 localization in tofu-4 mutants (Supplementary Fig. 2d, e).
CK2 directly Phosphorylates USTC factor TOFU-4
The USTC is thought to bind the promoters of piRNA genes to drive their expression in the C. elegans germline. TOFU-4 is a component of the USTC and KIN-3 was identified as a yeast two-hybrid (Y2H) binding partner of TOFU-410. We therefore asked if CK2 interacts with TOFU-4. We found that KIN-3 co-immunoprecipitated TOFU-4 (Fig. 4a). Since CK2 is a conserved serine/threonine kinase, we examined whether CK2 can phosphorylate TOFU-4 in vitro. TOFU-4, KIN-3 and KIN-10 proteins were purified from E.coli (Supplementary Fig. 3a), and in vitro kinase assays were performed. Incubation of KIN-3/KIN-10 (CK2 complex) with TOFU-4 resulted in a strong phosphorylation signal in in vitro phosphorylation assays (Fig. 4b), but KIN-3/KIN-10 failed to phosphorylate the Glutathione S-transferase (GST) protein (Fig. 4d). Thus, CK2 directly and specifically phosphorylates TOFU-4. Phosphorylation was dependent on CK2 activity, as inhibition of CK2 activity by addition of 4,5,6,7-tetrabromobenzotriazole (TBB), a CK2 inhibitor, reduced phosphorylation (Fig. 4b). A C. elegans phosphoproteome dataset25 identified three phosphorylation sites in TOFU-4, each containing a consensus CK2 phosphorylation motif ([S/T]-X-X-[D/E]) (Fig. 4c). We found that synthetic TOFU-4 peptides containing either serine 131 (S131) or serine 229 (S229), were phosphorylated by CK2 in vitro (Fig. 4d). While a peptide containing serine 92(S92) was not phosphorylated. Using AlphaFold, we predicted the structure of TOFU-4 and discovered that S131 and S229 are in a disordered region and relatively conserved in nematodes (Supplementary Fig. 3b, c). Consistent with the idea that S131 and S229 are the predominant phosphorylation sites, a mutation of both the S131 and S229 to alanine in a bacterially-expressed full-length TOFU-4 protein greatly reduced phosphorylation of TOFU-4 in an in vitro CK2 kinase assay (Fig. 4b). In some instances, phosphorylation of a protein can cause a shift in mobility on an SDS gel26. To ask if phosphorylation of TOFU-4 by CK2 in vitro, or in vivo alters TOFU-4 mobility we used the previously published phos-tag gel method27. However, no significant shift was observed even for the in vitro phosphorylated TOFU-4 (Supplementary Fig. 4a).
To determine whether CK2 phosphorylation of TOFU-4 promotes piRNA silencing, we used CRISPR to introduce phosphoacceptor mutants in TOFU-4. As expected, based on the lack of phosphorylation in in vitro kinase assays, S92A mutants had no defect in piRNA silencing (Fig. 4e). The S131A and S229A lesions, on the other hand, each caused partial de-silencing individually, and complete desilencing when combined in tofu-4(S131A S229A) double mutant worms (Fig. 4e). We also generated tofu-4(S131D), tofu-4(S229D), and tofu-4(S131D S229D), in which the potential phospho-acceptor residues were replaced with aspartic acid, a negatively charged residue that can sometimes mimic the phosphorylated state of a protein. We found that aspartic acid single and double mutants failed to preserve TOFU-4 function, causing de-silencing of the piRNA reporter, although at intermediate levels (Supplementary Fig. 4b), suggesting that the aspartic acid substitutions fail to precisely mimic the activities required to fully restore TOFU-4 function in piRNA silencing.
To ask if CK2 mediated phosphorylation of TOFU-4 affects piRNA production, we performed small RNA sequencing. We observed that the levels of both mature piRNAs and of piRNA precursors were reduced in the tofu-4(S131A S229A) mutants (Fig. 4f, g). Collectively, these findings suggest that CK2-mediated phosphorylation of TOFU-4 promotes piRNA production.
CK2 Phosphorylation of TOFU-4 promotes USTC assembly
To explore the stability and protein interactions of the TOFU-4 phospho-acceptor mutants we performed Western blot and Co-IP studies. PRDE-1 and TOFU-4 protein levels appeared wild type, as measured by Western blotting, in tofu-4(S131A S229A) mutants (Fig. 5a). To further characterize the effect of these mutations on USTC assembly, we examined their effects on TOFU-4/PRDE-1 protein-protein interactions in vivo. We found that PRDE-1 co-precipitated with wild type TOFU-4 (Fig. 5b). However, TOFU-4(S131A S229A) did not co-precipitate PRDE-1 while TOFU-4(S131D S229D) exhibited decreased levels of co-precipitation (Fig. 5b).
In wild type worms, PRDE-1 and TOFU-4 form subnuclear foci in germline cells and colocalize with each other (Fig. 5c). We therefore examined whether and how the putative phospho-acceptor lesions affected their localization. Introduction of TOFU-4(S131A S229A) in an otherwise wild type strain caused mCHERRY::PRDE-1 and GFP::TOFU-4 to no longer co-localize and to instead become diffusely localized in nuclei (Fig. 5d), while in tofu-4(S131D S229D) mutants, mCHERRY::PRDE-1 and GFP::TOFU-4 are still co-localized in nuclear foci, albeit with smaller foci (Fig. 5e). Taken together these data suggest that phosphorylation of TOFU-4 by CK2 promotes the co-assembly of TOFU-4 with PRDE-1 and their co-localization at sites of piRNA transcription in C. elegans.
Reduced CK2 activity contributes to piRNA mediated gene silencing defects in the aging process
Lastly, we monitored CK2 localization and activity in the aging process since a previous study showed that downregulation of CK2 activity promotes the expression of age-related biomarkers in C. elegans28. We examined the localization of GFP::KIN-3, which showed widespread expression, with a stronger presence in the nucleus. However, we found that during the aging process, the distinct pattern diminished (Fig. 6a). Subsequently, we investigated if the catalytic activity of CK2 in C. elegans was influenced in the aging process. The phosphotransferase activity of CK2 exhibited a 70% decline in worms at day 7 as compared to those at day 1 (Fig. 6b and Supplementary Fig. 4c). To further investigate the consequences of reduced CK2 activity, we examined the localization of USTC components. Consistent with our hypothesis, we observed the disappearance of GFP::TOFU-4 and mCHERRY::PRDE-1 foci (Fig. 6c, d). We also investigated the localization of GFP::PRG-1 and noted the loss of its perinuclear pattern (Fig. 6e). Moreover, western blotting analysis revealed a substantial reduction in the band corresponding to full-length GFP::PRG-1 protein in worms at day 7 (Fig. 6f). Consistently, we found the mature piRNA and the piRNA precursor levels were reduced in the aging process (Fig. 6g, h). Finally, we assessed whether the aging process affected our piRNA reporter and transposable elements. Our findings indicated significant desilencing of the piRNA reporter and notable increases in the line2h and turmoil1 transposons (Fig. 6i–k). Taken together, these results are consistent with the possibility that declining CK2 activity contributes to the piRNA-mediated gene silencing defects observed during the aging process.
Discussion
A sensitized reporter to screen mutants involved in piRNA mediated gene silencing
In diverse metazoans piRNAs play maintain genome integrity by silencing transposons and have also been implicated in the transgenerational regulation of gene expression29. While significant progress has been made in understanding piRNA biogenesis and function, many gaps in understanding persist, especially around elements of the pathway that are shared by other essential germline pathways. Here we constructed a sensitized reporter strain and used it to screen a library of 945 known essential C. elegans genes for RNAi-induced loss of piRNA silencing phenotypes. This screen identified 39 positive hits including previously identified genes required for piRNA biogenesis and function, including components of chromatin remodeling complexes, splicing factors, nuclear export factors, and transcription factors. Our screen identified about 20 genes not previously known to function in the piRNA pathway and here we have focused on characterizing one of these, kin-10, which along with kin-3 comprise components of the CK2 kinase complex.
TOFU-4 phosphorylation by CK2 promotes piRNA mediated gene silencing
The biogenesis of piRNAs involves a complex series of events, including transcription, processing, and loading into piRNA effector complexes. Previous studies have shown that USTC containing PRDE-1, SNPC-4, TOFU-4, and TOFU-5 is required for the expression of piRNA precursors10. Yet, little is known about how piRNA biogenesis is regulated. Here we have shown that the C. elegans casein kinase II, whose major subunits are encoded by the kin-3 and kin-10 genes, is required for piRNA mediated silencing. Mechanistically, our findings suggest that CK2 functions upstream of USTC assembly. TOFU-4 is a direct CK2 substrate and mutation of presumptive CK2 phosphorylation sites in TOFU-4 did not affect its interaction with KIN-3 (Supplementary Fig. 4d), but instead reduced the association of TOFU-4 with the USTC component PRDE-1. In the CK2 mutants USTC failed to assemble and piRNA biogenesis was defective (Fig. 7). A search within the phosphorylation database25 focusing on the USTC factors (PRDE-1, SNPC-4, TOFU-4 and TOFU-5), in addition to the recently identified chromodomain factor UAD-2 which localizes to piRNA cluster chromatin30, revealed that among these factors, TOFU-4 is the sole protein displaying detectable phosphorylation. While there could be additional piRNA biogenesis factors like UAD-2 subject to CK2 phosphorylation, our study suggests that posttranslational modification of TOFU-4 by CK2 is important for assembly of the piRNA biogenesis machinery and for piRNA pathway function.
Our findings suggest that phosphorylation of TOFU-4 promotes its association with PRDE-1 and the co-assembly of the two proteins on piRNA cluster genes where along with other components of the USTC they promote piRNA transcription. In S. pombe, CK2 directed phosphorylation of a component of the shelterin telomere protein complex, Rap1, promotes interactions with factors that regulate proper telomere tethering to the inner nuclear envelop and the formation of the silenced chromatin structure at chromosome ends15. In the C. elegans pachytene germline PRDE-1 foci colocalize with large regions of chromosome IV where the majority of piRNA genes reside and become positioned near the nuclear periphery22. The transcription of piRNA genes is thought to occur within chromatin marked by H3K27me3, a mark also found in telomeric chromatin31. It will be interesting to learn whether CK2 phosphorylation of TOFU-4 promotes the co-localization of the huge megabase-scale clusters of piRNA genes perhaps to coordinate piRNA transcription with piRNA export and processing.
Aging and piRNA mediated gene silencing
During the aging process, loss of heterochromatin is a consistent trend in species ranging from humans to fungi32. How and why heterochromatin is lost in the aging process is not known and the mechanisms are complex and generally cell-type specific. Since piRNA pathways promote the maintenance and installation of heterochromatin in diverse animal germlines it is possible that CK2 promotes heterochromatin maintenance, at least in part, through the maintenance of piRNA activity. Considering that heterochromatin maintenance is implicated in lifespan regulation32, further work is needed to explore all the possible relationships between CK2 activity, piRNAs and lifespan.
In summary, our work has uncovered a role for CK2 in the regulation of piRNA biogenesis in C. elegans and provides a starting point for a more detailed examination of the role of post-translational modifications in piRNA biogenesis in the aging process.
Methods
C. elegans Strains and Bacterial Strains
All the strains in this study were derived from Bristol N2 and cultured at 20 oC on Nematode Growth Media (NGM) unless otherwise indicated33. The strains used in this study are listed in Supplementary Data 3.
RNAi screen
RNAi screen was performed against all 945 genes in the embryo lethal subset of the C. elegans RNAi collection (Ahringer). Synchronized L1 animals of the reporter strain were plated onto RNAi feeding plates with about 100 worms per plate and were grown at 20 °C. The desilencing phenotype was scored when the worms grew to L4 or young adult stage.
CRISPR/Cas9 genome editing
For CRISPR/Cas9 experiments, Cas9 ribonucleoprotein (RNP) editing was used to generate the CRISPER lines34. Cas9 genome editing mixture containing Cas9 protein (0.5 μl of 10 µg/µl), two crRNAs (each 1.4 μl of 0.4 μg/μl), annealed PCR donor (25 ng/μl), and PRF4::rol-6(su1006) plasmid (0.8 μl of 500 ng/μl) was incubated at 37 °C for 15 mins before injecting animals. Guide RNA sequences and donors used in this study are listed in Supplementary Data 4.
RNAi inactivation experiments in C. elegans
For RNAi inactivation, single-stranded RNAs (ssRNAs) were transcribed from SP6-flanked PCR templates. ssRNAs were then annealed and injected into animals carrying various reporters. Injected animals were placed on fresh plates overnight. The progeny was analyzed.
In vitro pull-down assays
cDNAs encoding full-length or mutated TOFU-4 was cloned into pET-28a (for His tagging) or pGEX-6P-1 (for GST fusion). GST fusion proteins were incubated with His-tagged proteins and Glutathione beads (for GST fusion proteins). Bound proteins were analyzed by Western blot using an anti-His antibody. 30% of the fusion protein used for pull-down is shown as input.
Auxin treatment
The auxin-inducible degron system was as described35. The degron-tagged worms were placed on NGM plates with 1 mM indole-3-acetic acid (IAA; Alfa Aesar, 10171307), and then collected for further analysis.
Co-IP and western blotting
Synchronous adult worms were collected and washed three times with M9 buffer. The worms were then homogenized in a FastPrep-24 benchtop homogenizer (MP Biomedicals). Worm extracts were centrifuged at 14000 × g for 15 mins at 4 °C. The worm extracts were incubated with anti-FLAG or GFP trap beads for 2 hrs at 4 °C on a rotating shaker. The beads were washed three times and subjected to SDS-PAGE. Signals were detected using corresponding primary and secondary antibodies.
Small RNA cloning and data analysis
The small RNA cloning was conducted as the previous paper22. Total RNAs were extracted by Trizol (Sigma Alrich) and small RNAs were enriched by a mir-Vana miRNA isolation kit (Thermo Scientific). For mature piRNA sequencing, samples were treated with homemade PIR-1 for 2hs. For piRNA precursor sequencing, samples were pretreated with 5’ Pyrophosphohydrolase (RppH, NEB) for 1 h, and purified with RNA purification kit, then treated with homemade PIR-1 for 2hs. The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1. The ligated products were reverse transcribed using SuperScript III (Thermo Fisher Scientific). The cDNAs were amplified by PCR and the libraries were sequenced using the HiSeq systems (Illumina) platform at the UMass Medical School Deep Sequencing Core Facility.
The small RNA sequencing data were analyzed as described22.
Briefly, adaptors were trimmed from fastq files. Reads were trimmed to retain only 18–30 nts. The reads were mapped to piRNAs or piRNAs precursors with an arbitrary length of overhanging sequence either side of the 21U sequence using the exact matches. Reads were normalized to the total reads mapped to the genome.
Protein expression and purification
All genes were amplified by PCR and cloned into the pET.28a vector to produce His6-tag-fused recombinant proteins, or the pGEX-6P-1 vector to produce GST-tag-fused recombinant proteins. All recombinant proteins used in this study were expressed in E. coli BL21-CodonPlus (DE3) induced by 0.3 mM IPTG for 16 h at 20 °C and collected by sedimentation.
To purify His-KIN-3, His-KIN-10, His-TOFU-4, HIS-TOFU-4(S131A S229A) GST-KIN-3 and GST-tagged TOFU-4 fragments, the E. coli cells were resuspended in binding buffer (50 mM Tris-Cl pH 7.9, 500 mM NaCl and 10 mM imidazole), lysed with a high-pressure homogenizer and sedimented at 18000 rpm for 30 min at 4 °C. The supernatant lysates were purified on Ni-NTA agarose beads (for His6-tagged proteins, Qiagen) or Glutathione High Capacity Magnetic Agarose Beads (for GST-tagged proteins, SIGMA). After 2 extensive washing with binding buffer, the proteins were eluted with His6 elution buffer (50 mM Tris-Cl pH 7.9, 500 mM NaCl and 500 mM imidazole, for His6-tagged proteins) or GST elution buffer (50 mM Tris-Cl pH 7.9, 500 mM NaCl and 10 mM GSH, for GST-tagged proteins). All the eluted proteins were concentrated by centrifugal filtrations (Millipore), loaded onto desalting columns (GE Healthcare), then eluted with PBS buffer (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4). The eluted proteins were stored in aliquots at -80 °C.
In vitro phosphorylation assays using ATP-γS
The in vitro phosphorylation assays using ATP-γS was conducted as the previous paper36. To detect whether a protein is directly phosphorylated by CK2 complex, the His-KIN-3 and His-KIN-10 proteins purified from E. coli were used for the kinase assay. Recombinant His-TOFU-4, GST, GST-TOFU-4(S92), GST-TOFU-4(S131) and GST-TOFU-4(S229) proteins purified from E. coli were used as substrates. The reaction mixtures containing 500 μM ATP-γS were incubated for 1 h at 30 °C in kinase assay buffer (30 mM HEPES, 50 mM potassium acetate, 5 mM MgCl2). For detection by anti-thiophosphate-ester antibody, the reaction mixtures were further supplemented with 2.5 mM p-nitrobenzyl mesylate (PNBM). The alkylating reactions were allowed to proceed for 1 h at 25 °C. The reaction systems were terminated with SDS sample buffer and boiled before analysis by SDS-PAGE.
To detect CK2 activity in worms, the assay was conducted following a previously described protocol28. Briefly, worms were lysed, the protein concentration in supernatant was measured and adjusted. The in vitro phosphorylation assay was conducted using ATP-γS. GST-TOFU-4(S229) proteins purified from E. coli were used as substrates The reactions were initiated by adding worm lysates and incubated for 30 min.
Reagents and kits
Refer to Supplementary Data 5 for details.
Statistical analysis
GraphPad Prism 7 or Microsoft Excel was used for all statistical analysis. All data are shown as mean ± SD. Unpaired two tailed t tests were performed for statistical analysis. a P-value less than 0.01 was considered significant (**).
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
The data supporting the findings of this study are available from the corresponding authors upon request. The small RNA sequencing data is available from the NCBI BioProject database under accession code PRJNA998474. Phosphorylation database in this study can be found in this paper25(https://doi.org/10.1038/s41467-021-24816-z). Source data are provided as a Source Data file. Source data are provided with this paper.
References
Girard, A., Sachidanandam, R., Hannon, G. J. & Carmell, M. A. A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 442, 199–202 (2006).
Houwing, S. et al. A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in Zebrafish. Cell 129, 69–82 (2007).
Schnettler, E. et al. Knockdown of piRNA pathway proteins results in enhanced Semliki Forest virus production in mosquito cells. J. Gen. Virol. 94, 1680–1689 (2013).
Kiuchi, T. et al. A single female-specific piRNA is the primary determiner of sex in the silkworm. Nature 509, 633–636 (2014).
Gou, L. T. et al. Ubiquitination-deficient mutations in human Piwi cause male infertility by impairing histone-to-protamine exchange during spermiogenesis. Cell 169, 1090–1104.e1013 (2017).
Shen, E.-Z. et al. Identification of piRNA binding sites reveals the argonaute regulatory landscape of the C. elegans Germline. Cell 172, 937–951.e918 (2018).
Shirayama, M. et al. piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline. Cell 150, 65–77 (2012).
Batista, P. J. et al. PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans. Mol. Cell 31, 67–78 (2008).
Ruby, J. G. et al. Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans. Cell 127, 1193–1207 (2006).
Weng, C. et al. The USTC co-opts an ancient machinery to drive piRNA transcription in C. elegans. Genes Dev. 33, 90–102 (2019).
Podvalnaya, N. et al. piRNA processing by a trimeric Schlafen-domain nuclease. Nature 622, 402–409 (2023).
Tang, W., Tu, S., Lee, H. C., Weng, Z. & Mello, C. C. The RNase PARN-1 Trims piRNA 3’ ends to promote Transcriptome Surveillance in C. elegans. Cell 164, 974–984 (2016).
Ahmed, K., Gerber, D. A. & Cochet, C. Joining the cell survival squad: an emerging role for protein kinase CK2. Trends Cell Biol. 12, 226–230 (2002).
Pinna, L. A. Protein kinase CK2: a challenge to canons. J Cell Sci 115, 3873–3878 (2002).
Inoue, H., Horiguchi, M., Ono, K. & Kanoh, J. Casein kinase 2 regulates telomere protein complex formation through Rap1 phosphorylation. Nucleic Acids Res. 47, 6871–6884 (2019).
Zhang, S., Li, F., Zhou, T., Wang, G. & Li, Z. Caenorhabditis elegans as a useful model for studying aging mutations. Front. Endocrinol. 11, 554994 (2020).
Kim, H. et al. HDAC1 SUMOylation promotes Argonaute-directed transcriptional silencing in C. elegans. Elife 10, e63299 (2021).
Berkyurek, A. C. et al. The RNA polymerase II subunit RPB‐9 recruits the integrator complex to terminate Caenorhabditis elegans piRNA transcription. EMBO J. 40, e105565 (2021).
Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T. & Kanemaki, M. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat. Methods 6, 917–922 (2009).
Bagijn, M. P. et al. Function, targets, and evolution of Caenorhabditis elegans piRNAs. Science 337, 574–578 (2012).
Goh, W. S. et al. A genome-wide RNAi screen identifies factors required for distinct stages of C. elegans piRNA biogenesis. Genes Dev. 28, 797–807 (2014).
Weick, E.-M. et al. PRDE-1 is a nuclear factor essential for the biogenesis of Ruby motif-dependent piRNAs in C. elegans. Genes Dev. 28, 783–796 (2014).
Belicard, T., Jareosettasin, P. & Sarkies, P. The piRNA pathway responds to environmental signals to establish intergenerational adaptation to stress. BMC Biol. 16, 103 (2018).
Smibert, P., Yang, J.-S., Azzam, G., Liu, J.-L. & Lai, E. C. Homeostatic control of Argonaute stability by microRNA availability. Nat. Struct. Mol. Biol. 20, 789–795 (2013).
Li, W. J. et al. Insulin signaling regulates longevity through protein phosphorylation in Caenorhabditis elegans. Nat. Commun. 12, 4568 (2021).
Nishioka, K., Kato, Y., Ozawa, S. I., Takahashi, Y. & Sakamoto, W. Phos-tag-based approach to study protein phosphorylation in the thylakoid membrane. Photosynth. Res. 147, 107–124 (2021).
O’Donoghue, L. & Smolenski, A. Analysis of protein phosphorylation using Phos-tag gels. J. Proteomics 259, 104558 (2022).
Park, J. H. et al. Downregulation of protein kinase CK2 activity induces age-related biomarkers in C. elegans. Oncotarget 8, 36950–36963 (2017).
Weick, E.-M. & Miska, E. A. piRNAs: from biogenesis to function. Development 141, 3458–3471 (2014).
Huang, X. et al. A chromodomain protein mediates heterochromatin-directed piRNA expression. Proc. Natl Acad. Sci. USA 118, e2103723118 (2021).
Jamieson, K. et al. Telomere repeats induce domains of H3K27 methylation in Neurospora. Elife 7, e31216 (2018).
Gorbunova, V. et al. The role of retrotransposable elements in ageing and age-associated diseases. Nature 596, 43–53 (2021).
Brenner, S. The genetics of Caenorhabditis elegans. Genetics 77, 71–94 (1974).
Dokshin, G. A., Ghanta, K. S., Piscopo, K. M. & Mello, C. C. Robust genome editing with short single-stranded and long, partially single-stranded DNA donors in Caenorhabditis elegans. Genetics 210, 781–787 (2018).
Zhang, L., Ward, J. D., Cheng, Z. & Dernburg, A. F. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142, 4374–4384 (2015).
Shah, K. & Shokat, K. M. A chemical genetic approach for the identification of direct substrates of protein kinases. Methods Mol. Biol. 233, 253–271 (2003).
Seth, M. et al. The coding regions of germline mRNAs confer sensitivity to argonaute regulation in C. elegans. Cell Rep. 22, 2254–2264 (2018).
Acknowledgements
We thank members of Mello lab for discussions, Caenorhabditis Genetics Center (CGC) for providing strain, Dr. Weifeng Gu for providing the PIR-1 protein for preparing small RNA sequencing libraries. This work was supported by the following grants to C.C.M.: NIH grants (GM058800 and HD078253), C.C.M. is a Howard Hughes Medical Institute Investigator.
Author information
Authors and Affiliations
Contributions
G.M.Z. and C.C.M. designed the experiments. G.M.Z. and Y.H.D performed the experiments. C.W.Z analyzed the sequencing results. G.M.Z. and C.C.M. wrote the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Communications thanks Shouhong Guang and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Source data
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Zhang, G., Zheng, C., Ding, Yh. et al. Casein kinase II promotes piRNA production through direct phosphorylation of USTC component TOFU-4. Nat Commun 15, 2727 (2024). https://doi.org/10.1038/s41467-024-46882-9
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-024-46882-9
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.