Kisspeptin-10 binding to Gpr54 in osteoclasts prevents bone loss by activating Dusp18-mediated dephosphorylation of Src

Li, Zhenxi; Yang, Xinghai; Fu, Ruifeng; Wu, Zhipeng; Xu, Shengzhao; Jiao, Jian; Qian, Ming; Zhang, Long; Wu, Chunbiao; Xie, Tianying; Yao, Jiqiang; Wu, Zhixiang; Li, Wenjun; Ma, Guoli; You, Yu; Chen, Yihua; Zhang, Han-kun; Cheng, Yiyun; Tang, Xiaolong; Wu, Pengfei; Lian, Gewei; Wei, Haifeng; Zhao, Jian; Xu, Jianrong; Ai, Lianzhong; Siwko, Stefan; Wang, Yue; Ding, Jin; Song, Gaojie; Luo, Jian; Liu, Mingyao; Xiao, Jianru

doi:10.1038/s41467-024-44852-9

Download PDF

Article
Open access
Published: 12 February 2024

Kisspeptin-10 binding to Gpr54 in osteoclasts prevents bone loss by activating Dusp18-mediated dephosphorylation of Src

Zhenxi Li ORCID: orcid.org/0000-0002-7220-6177^1,2,3,4^na1^na2,
Xinghai Yang²^na1,
Ruifeng Fu^1,2^na1,
Zhipeng Wu²^na1,
Shengzhao Xu³,
Jian Jiao²,
Ming Qian²,
Long Zhang¹,
Chunbiao Wu^1,2,
Tianying Xie^1,2,
Jiqiang Yao²,
Zhixiang Wu²,
Wenjun Li³,
Guoli Ma³,
Yu You ORCID: orcid.org/0000-0002-0345-6201³,
Yihua Chen ORCID: orcid.org/0000-0003-1733-7980³,
Han-kun Zhang³,
Yiyun Cheng³,
Xiaolong Tang ORCID: orcid.org/0000-0002-4744-5846⁵,
Pengfei Wu ORCID: orcid.org/0000-0001-8297-3380⁶,
Gewei Lian⁶,
Haifeng Wei²,
Jian Zhao²,
Jianrong Xu ORCID: orcid.org/0000-0002-2168-2296⁷,
Lianzhong Ai¹,
Stefan Siwko⁸,
Yue Wang⁹,
Jin Ding¹⁰,
Gaojie Song ORCID: orcid.org/0000-0002-7787-6452³^na2,
Jian Luo ORCID: orcid.org/0000-0003-3583-0154¹¹^na2,
Mingyao Liu ORCID: orcid.org/0000-0001-7339-5048³^na2 &
…
Jianru Xiao^1,2,3^na2

Nature Communications volume 15, Article number: 1300 (2024) Cite this article

1694 Accesses
1 Citations
2 Altmetric
Metrics details

Subjects

Abstract

Osteoclasts are over-activated as we age, which results in bone loss. Src deficiency in mice leads to severe osteopetrosis due to a functional defect in osteoclasts, indicating that Src function is essential in osteoclasts. G-protein-coupled receptors (GPCRs) are the targets for ∼35% of approved drugs but it is still unclear how GPCRs regulate Src kinase activity. Here, we reveal that GPR54 activation by its natural ligand Kisspeptin-10 (Kp-10) causes Dusp18 to dephosphorylate Src at Tyr 416. Mechanistically, Gpr54 recruits both active Src and the Dusp18 phosphatase at its proline/arginine-rich motif in its C terminus. We show that Kp-10 binding to Gpr54 leads to the up-regulation of Dusp18. Kiss1, Gpr54 and Dusp18 knockout mice all exhibit osteoclast hyperactivation and bone loss, and Kp-10 abrogated bone loss by suppressing osteoclast activity in vivo. Therefore, Kp-10/Gpr54 is a promising therapeutic target to abrogate bone resorption by Dusp18-mediated Src dephosphorylation.

Metabolic rewiring promotes anti-inflammatory effects of glucocorticoids

Article 10 April 2024

Small extracellular vesicles from young plasma reverse age-related functional declines by improving mitochondrial energy metabolism

Article Open access 16 April 2024

The JAK/STAT signaling pathway: from bench to clinic

Article Open access 26 November 2021

Introduction

As we age, bone metabolism and homeostasis shift to favor over-activated osteoclasts, which leads to bone loss, a hallmark of human diseases such as osteoporosis^1,2. Osteoclasts, which have the only capacity to resorb bone, are formed from bone marrow monocytes induced by macrophage colony-stimulating factor (M-CSF) and the receptor activator of nuclear factor-κB ligand (RANKL)^3,4. Mechanically, both M-CSF and RANKL promote actin remodeling and bone resorption of osteoclasts, which mostly depends upon induction of Src kinase activation (phosphorylation at Y416)^5,6. Src consists of 4 functional regions: Src homology 4 domain (SH4), SH3, SH2, SH1 (catalytic domain) and is activated through auto-phosphorylation at tyrosine 416 upon SH3 ligand binding^7,8,9. Two main SH3 domain-binding motifs, proline/arginine-rich motifs (PR motifs), have been identified: R/KxxPxxP (class I) and PxxPxR/K (class II) (where K is lysine and x is any amino acid)^10,11,12,13. Even though Src is normally present in a broad variety of cell types, genetic knockout of the Src gene in mice leads to only one major phenotype - severe osteopetrosis due to impaired osteoclast function^{5,14,15,16,17}. Therefore, inhibition of Src kinase activity has been considered as a useful therapeutic strategy for osteoclast overactivation-mediated bone loss^{18,19,20,21,22}.

G protein-coupled receptors (GPCRs) are the most important drug targets. It is estimated that ∼35% of marketed drugs act directly on GPCRs^23,24. Src is activated by GPCRs via different ways including direct binding with Src through the SH3 binding motif in the intracellular domain^25,26,27,28, indirect phosphorylation of Src at Y416 by Gα_s/i²⁹ or recruitment of Src via arrestins³⁰. However, it is still entirely unclear how GPCRs adversely affect Src linase. GPR54, also named as KiSS1R (KiSS1 receptor), is a member of the GPCR superfamily³¹. Its natural ligands are Kisspeptins including Kp-54, −14, −13, and −10 encoded by the KiSS1 gene³². Biologically, Kisspeptins/GPR54 signaling in hypothalamic neurons is the gatekeeper of puberty which regulates hormone release via the hypothalamic-pituitary-gonadal axis^33,34. Kisspeptins/GPR54 triggers signaling cascades including Gq/11-PLCβ (phospholipase C β)-PKC (protein kinase C)/Ca²⁺ signal pathways, then the phosphorylation of MAP kinases, such as ERK1/2 and p38 are enhanced by PKC. In addition, KiSS1R activation recruits arrestin-1 and −2, which decrease and increase phosphorylated ERK1/2 levels respectively^35,36. There is a PR motif in the C terminus of human GPR54 (GPR54 CT)³⁷, which is conserved in terrestrial animals.

Here, we show Gpr54 recruits active Src and the phosphatase Dusp18 through the conserved PR motif upon activation by the ligand Kp-10. Furthermore, Kp-10/Gpr54 dose-dependently upregulates the expression of Dusp18, and Src (Y416) is dephosphorylated via Dusp18 upon Gpr54 activation by Kp-10, indicating that osteoclast activities are negatively regulated by Kp-10/Gpr54 at least partially through the dephosphorylation of Src (Y416) by Dusp18. In vivo, both whole-body (Kiss1^−/−, Gpr54^−/−, Dusp18^−/−) and osteoclast conditional knockout (Kiss1 cKO, Gpr54 cKO) mice exhibit bone loss and osteoclast hyperactivation. Finally, we develop a bone-targeting Kp-10 consisting of six repetitive sequences of aspartate and serine³⁸, (DSS)*6-Kp-10, that protects against bone loss in an ovariectomy (OVX)-induced osteoporosis model through blocking osteoclast activity. These results above suggest that Kp-10/Gpr54 plays a bone protective role as a negative osteoclast modulator during bone metabolism and may be a potent therapeutic target for the treatment of osteoclast-associated bone loss.

Results

Kp-10/Gpr54 govern osteoclast formation and bone resorption mainly by suppression of Src phosphorylation

The critical role of Src in osteoclast-mediated bone resorption has been shown by Src gene deletion in mice¹⁴. To examine the role of GPR54 in osteoclast, we detected changes in RANKL signal pathways when Gpr54 was deleted. In contrast to MAPKs and NF-κB signaling pathways, Gpr54-deletion lead to an obvious change in Src (Y416) phosphorylation in bone marrow monocytes (BMMs) (Fig. 1a, b). Consistently, treatment of Kp-10 effectively reduced the phosphorylation of Src (Y416) in Gpr54 WT osteoclasts, but failed to inhibit Src (Y416) phosphorylation in Gpr54^−/− osteoclasts (Fig. 1c, d). Furthermore, Src phosphorylation induced both by RANKL and M-CSF was suppressed after treatment with Kp-10 in WT osteoclasts, but not in Gpr54^−/− osteoclasts (Supplementary Fig. 1a, b). Additionally, levels of bone-derived Kisspeptins changed more significantly during osteoclast differentiation than in osteoblasts (Supplementary Fig. 1c). However, as the gatekeeper of puberty, Kisspeptins in serum declined in ovariectomized mice (considered as an age-related menopausal bone loss model) (Supplementary Fig. 1d).

**Fig. 1: Kp-10 /Gpr54 governs osteoclasts formation and bone resorption mainly via suppression of Src phosphorylation.**

Consistent with these findings, Gpr54-deletion enhanced osteoclast formation by TRAP staining (Fig. 1e) and the mean number of osteoclasts per well (Fig. 1f). Actin ring formation was also enhanced by Gpr54 deletion (Fig. 1g–i). Additionally, bone resorption was promoted when Gpr54 was deleted, which could be rescued upon ectopic expression of Gpr54 (Supplementary Fig. 2a, b). Furthermore, Kp-10 suppressed bone resorption in Gpr54-WT osteoclasts but did not have a significant effect in Gpr54^−/− osteoclasts (Fig. 1j, k). Remarkably, Gpr54 activation by Kp-10 also suppressed osteoclast formation in human giant cell tumor of bone (GCT) cells (Supplementary Fig. 2c, d). Consistently, Inhibition of Gpr54 by the GPR54 antagonist of GPR54 WB599 (2-acylamino-4,6-diphenylpyridines)³⁹ enhanced osteoclast formation (Supplementary Fig. 2e, f). In keeping with these results, Kiss1 loss also enhanced osteoclast formation as measured by the TRAP staining assay (Supplementary Fig. 2g) and the mean number of osteoclasts (Supplementary Fig. 2h). Furthermore, osteoclast resorption was promoted by Kiss1 deletion, which was effectively rescued by ectopic expression of Kiss1 (Supplementary Fig. 2i, j). Taken together, these results indicated that Kp-10/Gpr54 played a negative role in osteoclast formation and bone resorption mainly via inhibition of Src phosphorylation.

GPR54 activation by the ligand Kp-10 recruits the Src kinase via the PR motif in the GPR54 C-Terminus

By comparing multiple homologs of GPR54, it was observed that the SH3 binding motif was ubiquitous in the C-terminus (CT) of GPR54 in terrestrial vertebrates, and human GPR54 contains the most redundant SH3-binding sequence including two class I RxxPxxP motifs (GPR54^336–342 and GPR54^350–356) and two class II PxxPxR motifs (GPR54^339–344 and GPR54^345–350) (Fig. 2a). We screened SH3 domains to identify SH3 domain containing proteins that potentially bind to GPR54. C terminus of GPR54 (GPR54 CT) interacted with the SH3 domain of Src most obviously by SH3 domain proteins microarray assay (Fig. 2b). Of note, GPR54 CT dose-dependently bound with Src by surface plasmon resonance (SPR) analysis, and the binding affinity was calculated to be approximately 2.6 nM (Fig. 2c). We were not able to co-crystallize the SH3 domain or SH3-SH2 domains of Src with the whole CT of GPR54 or its PR motif, but a chimera construct embedding the PR motif (333–356) to the C-terminus of SH3-SH2 domains yielded crystals that diffracted to 3.54 Å. The structure reveals interactions formed between the SH3 domain and the N-terminal half of the PR motif, e.g., there are key hydrophilic interactions between GPR54 residues R336, P339, and P342, and SH3 residues Y190, Y136, and W118, respectively (PBD ID: 7YQE, Fig. 2d). Consistent with this structure, SPR showed that Src bound with the peptide of GPR54^336–356 with binding affinity of 4.24 μM (Supplementary Fig. 3a), the binding was only slightly reduced for the N-terminal half of the PR motif (GPR54^333–344, 28.27 μM, Supplementary Fig. 3b). Consistently, by pull-down assay, the R336A&P339A mutant of human GPR54 CT, which removed the N-terminal key proline and arginine, dramatically dampened the interaction of Src with GPR54 CT, and the △339–344 (deletion sign: △) mutant of GPR54 CT completely abolished the binding of Src with GPR54 CT (Fig. 2e, f).

**Fig. 2: GPR54 recruited Src via the PR motif in GPR54 C-Terminus.**

Consistently, the interaction of Gpr54 with Src was enhanced after treatment of RAW264.7 cells with Kp-10 (Fig. 2g, h) and also in 293 T cells transfected with HA-Src and GPR54-Flag constructs (Supplementary Fig. 3c, d). In addition, immunofluorescence (IF) staining assay by total internal reflection fluorescence (TIRF) microscopy demonstrated that Src co-localized on the membrane with Gpr54 especially after Kp-10 stimulation in pre-osteoclasts (Fig. 2i, j), IgG, Src and Gpr54 only are showing as control (Supplementary Fig. 3e). These findings coherently showed that GPR54 bound with Src via PR motif after Kp-10 treatment.

The phosphatase DUSP18 was recruited by GPR54 upon activation by the ligand Kp-10 via the PR motif in GPR54 C-Terminus

Our results above showed that Src phosphorylation was inhibited by Kp-10 /Gpr54. Next, we sought to determine whether one or more phosphatases co-immunoprecipitated with Gpr54 upon Kp-10 stimulation. Activities of total phosphatases co-immunoprecipitated with Gpr54 were enhanced by Kp-10 stimulation (Fig. 3a). In contrast to the phosphatases co-immunoprecipitated with GPR54 antibody, three increasing phosphatases including DUSP18, PTPN6 and PPP1CA were identified after Kp-10 stimulation by mass spectrometry analysis (Data are available via ProteomeXchange with identifier PXD038433) (Fig. 3b). Furthermore, Co-IP analysis of GPR54 CT with DUSP18, PTPN6 and PPP1CA were performed and the results showed that DUSP18 seemed to be a crucial tyrosin phosphatase which had the strongest interaction with GPR54 (Supplementary Fig. 3f, g). Notably, Western blotting showed that Dusp18, Kiss1 and Gpr54 were up-regulated during osteoclasts formation by Western blotting (Supplementary Fig. 4a, b). These results were confirmed by immunohistochemistry (IHC) assay in ovariectomy (ovx) -induced postmenopausal osteoporosis bone tissues comparing with that of sham-operated mice, and in giant cell tumor of bone (GCTB) characterized histologically by the presence of osteoclast-like giant cells (Supplementary Fig. 4c). Furthermore, to verify human anti-GPR54 antibody and anti-KiSS1 antibody in mouse, IF staining in Gpr54^+/+ and Gpr54^−/− osteoclasts (Supplementary Fig. 5a) and Kiss1^+/+ and Kiss1^−/− osteoclasts (Supplementary Fig. 5c), IHC assay in the femurs of Gpr54^+/+ and Gpr54^−/− mice (Supplementary Fig. 5b) and Kiss1^+/+ and Kiss1^−/− mice (Supplementary Fig. 5d), and immunoblots assay in Kiss1^+/+ and Kiss1^−/− BMMs (Supplementary Fig. 5e) were performed.

**Fig. 3: DUSP18 phosphatase was recruited by GPR54 after Kp-10 stimulation via the PR motif.**

Furthermore, Co-IP analysis also validated that Kp-10 dose-dependently induced the interaction of Dusp18 with Gpr54 in RAW264.7 cells (Fig. 3c, d) and in 293 T cells transfected with DUSP18-HA and GPR54-Flag (Supplementary Fig. 6a, b). IF staining assay by TIRF microscopy showed that Dusp18 colocalized with Gpr54 in the plasma membrane especially after treatment of Kp-10 in pre-osteoclasts (Fig. 3e, f).

By SPR analysis, we observed that human GPR54 CT dose-dependently bound with DUSP18 with a binding affinity of 40 nM (Fig. 3g). Similarly, we then used synthesized mouse Gpr54 peptides to test the binding with Dusp18. The peptide of Gpr54^336–342 which corresponds to the RxxPxxR motif bound to Dusp18 with a binding affinitiy of 1.8 μM (Fig. 3h), whereas the right-shifted peptide of Gpr54^339–344 which corresponds to the PxxRxR motif generated an unfitted SPR curve when titrate with Dusp18 (Supplementary Fig. 6c). Reversely, a human GPR54 CT double point mutation R336A&P339A which damaged the R³³⁶xxPxxP³⁴² motif and the P³³⁹xxPxR³⁴⁴ motif dampened its interaction with DUSP18, and a truncation (△339–344) which destroyed the two SH3 binding motifs in the left hand also abolished the binding with DUSP18 (Fig. 3i, j). Furthermore, GST pull-downs using GST proteins including GST, GST-GPR54 CT, GST-GPR54 CT (R350&P353) incubated separately with WCL of 293 T cells transfected with HA-Src or HA-DUSP18 were performed that GST-GPR54 CT (R350&P353) showed no loss of binding (Supplementary Fig. 6d, e), which also significantly strengthen the arguments for selectivity for the first SH3 binding motif. Therefore, GPR54 interacted with DUSP18 also via the left-hand side of the PR motif in GPR54 CT. Of note, by competitive pull-down assay, we found that DUSP18 competed with Src for binding to GPR54 CT (Fig. 3k, l). Hence, these results coherently supported that the GPR54 CT recruited both DUSP18 and Src via the PR motifs upon Kp-10 stimulation.

Src was dephosphorylated via DUSP18 when GPR54 was activated by its ligand Kp-10

By SPR analysis, we found that DUSP18 can also interacted with Src with a binding affinity of 5.9 nM (Fig. 4a). Interestingly, in contrast to WT-DUSP18, a mutation in the catalytic center of DUSP18 (C104S) eliminated the interaction with Src by Co-IP analysis (Fig. 4b, and Supplementary Fig. 6f). Purified WT-DUSP18 potently reduced the phosphorylation of Src (Y416) purified from Sf9 insect cells in vitro, but the enzymatically dead DUSP18 (C104S) mutant had no activity (Fig. 4c, d). The interaction of Dusp18 with Src was enhanced after Kp-10 stimulation in RAW264.7 cells by Co-IP analysis (Fig. 4e, f). Consistent with this data, IF staining showed that Dusp18 colocalized with Src in the plasma membrane especially after treatment with Kp-10 in pre-osteoclasts (Fig. 4g, h).

**Fig. 4: Src was dephosphorylated via DUSP18 following GPR54 activation by Kp-10.**

Notably, the complex formation of the heterotrimer including DUSP18, Src, and GPR54, was enhanced after Kp-10 stimulation in 293 T cells transfected with HA-Src, GPR54-Myc, and DUSP18-Flag (WT), but not when the catalytic center of DUSP18 was killed by introducing DUSP18 (C104S) mutation (Fig. 4i–k). In keeping with this finding, Kp-10 blocked Src phosphorylation in WT pre-osteoclasts but failed to do so in Dusp18-depleted BMMs (Fig. 4l, m). Therefore, bone resorption was suppressed in Dusp18 WT osteoclasts but not in Dusp18^−/− osteoclasts as measured by the pit formation assay (Fig. 4n) and quantitation of the pit depth (Fig. 4o). Furthermore, bone resorption enhanced by Dusp18 deletion was rescued upon ectopic expression of Dusp18 or knockdown of Src (Supplementary Fig. 6g, h). Phosphorylation of Src was enhanced by WB599 in WT BMMs but not in Dusp18^−/− BMMs (Supplementary Fig. 6i, j). These findings supported the notion that Dusp18 was a phosphatase of Src in this experimental setting, and Src was dephosphorylated via Dusp18 when Gpr54 was activated by Kp-10. Therefore, Kp-10/Gpr54 signaling suppresses osteoclast formation and bone resorption at least partially through Src dephosphorylation by its phosphatase Dusp18.

Kp-10/Gpr54 upregulated the expression of Dusp18 and recruited both active Src and its phosphatase Dusp18

Interestingly, Kp-10 (0.1, 1 nM) obviously upregulated the expression of Dusp18 as revealed by WB analysis (Fig. 5a, b) in RAW264.7 cells. Notably, the expression of Dusp18 was inhibited by the inhibitor of Gq/11 downstream signals including PKC (Staurosporine) and ERK (LY3214996) but not by the inhibitor of PLC (U73122), or P38 (SB203580) by qPCR assay (Fig. 5c). Additionally, the protein level of Dusp18 cannot be obviously up-regulated by Kp-10 when ERK1/2 was knocked down by siRNA in RAW264.7 cells (Supplementary Fig. 7a, b). These results supported the notion that Kp-10/Gpr54 upregulates the expression of Dusp18 at least partially through the Gq/11-PKC-ERK signaling pathway.

The interaction of GPR54 with Src (Fig. 5d, e), GPR54 with DUSP18 (Fig. 5f, g), and Src with DUSP18 (Fig. 5h, i) in 293 T cells transfected with indicated constructs and induced by Kp-10 were all obvioulsly dampened by Src kinase inhibitor (Saracatinib), but not by the inhibitors of Gq/11 downstream signals including PLC inhibitor (U73122), PKC inhibitor (Staurosporine), ERK inhibitor (LY3214996), and Ca2+/ CaMKII inhibitor (KN-93). Furthermore, the binding of GPR54 with DUSP18 promoted by Kp-10 was blocked upon Src siRNA knockdown in 293 T cells transfected with DUSP18-HA and GPR54-Flag (Supplementary Fig. 8a, b). However, the interaction of GPR54 with DUSP18 was still induced by Kp-10 when ERK1/2 was depleted via siRNA knockdown (Supplementary Fig. 8c, d). In summary, active Src and its phosphatase Dusp18 were recruited by Gpr54 upon Kp-10 stimulation.

Upon ligand activation, GPCRs trigger pathways via both G proteins and β-arrestins³⁰. Therefore, we explored whether Src dephosphorylation mediated by GPR54 was dependent on Gq/11, β-arrestin-1/2 or not. IB analysis showed that Kp-10 inhibited the phosphorylation of Src in WT BMMs, but failed to have a significant effect in Gq/11 KO BMMs (Fig. 5j, k). Futhermore, the phosphorylation of Src was still suppressed (Supplementary Fig. 9a, b), and the interaction of Gpr54 with Src was also enhanced (Supplementary Fig. 9c, d) after Kp-10 stimulation in Arrb1 and Arrb2 double-knockout MEFs. Moreover, Kp-10 still blocked osteoclast formation in Arrb1^−/− BMMs (Supplementary Fig. 9e, f) and in Arrb2^−/− BMMs (Supplementary Fig. 9g, h). Taken together, our findings demonstrated that the expression of Dusp18 was obviously upregulated by 0.1, 1 nM Kp-10 but not by 10 nM Kp-10. Furthermore, both active Src and Dusp18 were significantly recruited and the phosphorylation of Src was blocked along with the increase of Kp-10 dose, which is dependent on Gq/11 signaling but not relies on β-arrestin-1/2 (Fig. 5l).

Mice deficient in Kiss1, Gpr54, or Dusp18 exhibited bone loss and osteoclast hyperactivation

Osteoclast specific condition knockout of Gpr54 (Gpr54 cKO) mice, or Kiss1 (Kiss1 cKO) mice were obtained by crossing Gpr54 ^f/f or Kiss1^f/f mice with LysCre mice. The targeting strategies of Gpr54 ^f/f (Supplementary Fig. 10a) and Kiss1^f/f (Supplementary Fig. 10b) were shown. Comparing with the indicated wild-type mice, elisa assay showing the same level of testosterone, luteinizing hormone (LH) and follicle-stimulating hormone (FSH) in Gpr54 cKO mice (Supplementary Fig. 10c, d), and in Kiss1 cKO mice (Supplementary Fig. 10e, f). However, testosterone, LH and FSH obviously declined in whole -body Gpr54 knockout mice (Gpr54^−/−, Supplementary Fig. 11a, b) and in whole -body Kiss1 knockout mice (Kiss1^−/−, Supplementary Fig. 11c, d). Bone loss was observed in Gpr54 cKO mice (Fig. 6a–d), Kiss1 cKO mice (Fig. 6e–h) and the whole body knockout of Gpr54 mice (Supplementary Fig. 11e–h), Kiss1 mice (Supplementary Fig. 11i–l), and Dusp18 mice (Fig. 6i–l) by micro-CT and bone parameters analysis. Consistently, Dusp18 deletion induced bone mass was efficiently rescued by treatment of Src inhibitor KX2-391 but not by (DSS)*6-KP-10 (Fig. 6i–l).

Fig. 6: Osteoclast conditional knockout *Gpr54* mice (Gpr54 cKO) and *Kiss1* mice (*Kiss1* cKO), whole-body knockout mice of Dusp18 (*Dusp18*^−/−) mice exhibited bone loss and osteoclast hyperactivation.

Osteoclasts were hyperactivated in the femurs of Gpr54 cKO mice (Fig. 6m, n), Kiss1 cKO mice (Fig. 6o, p), the calvaria of Kiss1^−/− mice and Gpr54^−/−mice (Supplementary Fig. 12a, b), and the femurs of Dusp18^−/− mice (Fig. 6q, r) by TRAP staining and osteoclast parameters analysis. Furthermore, Dusp18 deletion induced osteoclast activity was efficiently rescued by the Src inhibitor KX2-391 but not by (DSS)*6-KP-10 (Fig. 6q, r). Taken together, our data provide strong evidence to support a bone-protective role of Kp-10/Gpr54 by negatively modulating osteoclast activities in vivo.

Physiologically, a stable bone mass was maintained by the balance between bone resorption by osteoclasts and bone formation by osteoblasts, and osteoclastogenesis were supported by osteoblast-derived RANKL and M-CSF⁴. Bone formation by osteoblast was also enhanced in Gpr54^−/− mice (Supplementary Fig. 13a, b), Kiss1^−/− mice (Supplementary Fig. 13c, d) but not in Gpr54 cKO (Supplementary Fig. 13e, f) and Kiss1 cKO mice (Supplementary Fig. 13g, h) by double calcian labeling assay. Goldner’s Masson trichrome staining showed more osteoid/hypomineralized areas (stained red) in Gpr54^−/− mice (Supplementary Fig. 13i, j), in Kiss1^−/− mice (Supplementary Fig. 13k, l) and in Dusp18^−/− mice (Supplementary Fig. 14a, d). Consistently, osteoblasts differentiation were promoted when Gpr54 or Kiss1 was deleted as determined by ALP staining (Supplementary Fig. 15a) and von Kossa staining (Supplementary Fig. 15b). Furthermore, osteoblast differentiation was dose-dependently suppressed upon Kp-10 stimulation (Supplementary Fig. 15c, d).

Kp-10 ameliorated OVX-induced bone loss

Our data above showed that Kp-10/Gpr54 negatively regulated osteoclast activity via Src dephosphorylation by Dusp18. Therefore, we explored whether Kp-10 could ameliorate bone loss in vivo. In ovariectomized mice, after intravenous injection of Kp-10 (1, 10 nmol/kg) and bone targeting Kp-10 ((DSS)*6-Kp-10) (1, 10 nmol/kg) twice per week for two months, we observed that mice with 1 or 10 nmol/kg (DSS)*6-Kp-10 showed better bone protective effect than 1 or 10 nmol/kg Kp-10 correspondingly as determined by Von Kossa staining (Supplementary Fig. 16a) and parameters of trabecular bone analysis (Supplementary Fig. 16b). Elisa assay showing the same level of FSH and LH after treatment with bone targeting Kp-10 ((DSS)*6-Kp-10) (10 nmol/kg) twice per week for two months in Sham mice and in OVX mice comparing with the indicated mice treated with vechile respectively (Supplementary Fig. 16c). Furthermore, bone mass increased in sham-operated mice as well as in OVX mice after treatment with 50 nmol/kg (DSS)*6-Kp-10 by micro-CT analysis (Fig. 7a–d). Consistent with these results, 50 nmol/kg (DSS)*6-Kp-10 treatment suppressed osteoclast activation both in sham-operated and OVX mice by TRAP staining (Fig. 7e) and the measurement of osteoclast parameters (Fig. 7f). Thus, these data coherently suggested that the Kp-10/Gpr54 signaling axis played a bone protective role both in vitro and in vivo via blocking osteoclastic bone resorption.

Discussion

Targeted disruption of the Src gene in mice leads to a predominant phenotype of osteopetrosis due to a defect in osteoclast function, which revealed that Src is essential for bone resorption by osteoclasts^5,14. Therefore, Src has been considered as a candidate drug target for anti-osteoporosis. Understanding the molecular mechanisms of Src is essential for a complete molecular-level understanding of bone resorption and for designing novel therapeutic approaches for treating bone disease. In this study, we identified Dusp18 as a phosphatase of Src in osteoclasts. Both active Src and Dusp18 were recruited by Gpr54 via the PR motif in the C terminus of Gpr54 upon activation by its ligand Kp-10. Therefore, we revealed a new mechanism of bone resorption: Kp-10/Gpr54 negatively regulated bone resorption mainly via Src dephosphorylation by Dusp18.

Osteoclasts emerged during the evolution from aquatic to terrestrial life. In adaptation to terrestrial life, the solid bones of aquatic vertebrates were changed by osteoclasts to a hollow architecture that has a superior strength-to-weight ratio^40,41. In the C terminus of GPR54, we found a conserved PR motif that emerged in terrestrial animals (Fig. 2a). Notably, aquatic vertebrates like zebrafish or tropical clawed frogs contain no PR motif in the corresponding position of each sequence, suggesting that the PR motif may have been acquired during the evolution from aquatic creatures to land animals and may be involved in some functions unique to terrestrial vertebrates. Our results showed that Kp-10/Gpr54 suppressed Src phosphorylation by recruitment of both active Src and Dusp18 via the PR motif in the GPR54 C terminus. Hence, the emergence of the PR motif in the GPR54 C terminus in terrestrial animals may have been an important adaptation for life on land by modulating Src activity in osteoclasts.

It is estimated that 30 to 50% of marketed drugs act directly on G protein-coupled receptors (GPCRs)^23,24, making GPCRs the most important class of drug targets. A typical example is the calcitonin receptor (CTR), which negatively regulates osteoclast resorption. Calcitonin, the ligand of CTR, has been in clinical use for conditions involving accelerated bone turnover, including Paget’s disease and osteoporosis^42,43. Our results coherently suggested that treatment with a bone targeting Kp-10, (DSS)*6-Kp-10, showed bone protection in the OVX-induced bone loss model by inhibiting osteoclast activity (Fig. 7). This suggests a potential value for targeting GPR54 in diseases characterized by bone loss.

GPCR signals are transduced through two different mechanisms with agonist dosage acting as the switch. For example, β2-adrenergic receptors (β2-ARs) activate the mitogen-activated protein kinase through Gαs at low concentrations of an agonist, whereas at higher concentrations Src was activated directly by β2-ARs independent of Gαs and β-arrestins. This dosage-dependent switch of GPCRs signaling has significant implications for GPCR intrinsic properties and desensitization²⁸.Src is activated by GPCRs through different ways including direct interaction via its SH3 binding motif in the intracellular domain^25,26,27,28, or indirect activation of Src via arrestins³⁰ or Gα_s/i²⁹. Gαs and Gαi did stimulate autophosphorylation of Src (Tyr416) directly, but Gα_q, Gα₁₂, and Gβγ cannot. In this study, phosphatase Dusp18 was upregulated at low concentration of Kp-10. Both active Src and phosphatase Dusp18 were recruited by the PR motif in the Gpr54 C terminus after treatment with dosage of Kp-10. Kp-10/Gpr54 mediated suppression of Src phosphorylation is dependent on Gq/11 signaling but not relies on beta-arrestin (Fig. 5h, i). However, how Gq/11 takes part in the process is still unclear, which warrants future in-depth investigation.

Kisspeptins/Gpr54 signaling in hypothalamus neurons is the switch of puberty by governing hormone release via the hypothalamic-pituitary-gonadal axis. Gonadotropin-releasing hormone (GnRH) is stimulated by Kisspeptins/Gpr54 and then acts on the anterior pituitary triggering the release of LH, and FSH. In addition, FSH and LH prompt the ovaries to begin producing the hormone estrogen and work together to get the testes to begin producing testosterone^31,32. Both estrogen and androgen play a role in bone protection^44,45,46. Our results showed that bone loss happened in mice with the whole-body knockout of Kiss1 or Gpr54, and both osteoblasts and osteoclasts were hyperactivated. This is reasonable because osteoclast activation needs to be supported by osteoblast-derived cytokines including M-CSF and RANKL. Consistent with our findings, Herber and Ingraham et al. found that ablating estrogen receptor alpha (ERα), thus removing the negative regulation of Kiss1 expression by ERα in the medial basal hypothalamus (Esr1^Nkx2-1Cre), promoted bone mass, which revealed that Kiss1 also played a bone protective role as described in this study⁴⁴. However, both osteoblasts and osteoclasts were activated in Esr1^Nkx2-1Cre mice, which was inconsistent with the phenotype of osteoblasts and osteoclasts in the whole-body knockout of Kiss1 or Gpr54 mice⁴⁴. Bone loss induced by the whole-body knockout of Kiss1 or Gpr54, and the Esr1^Nkx2-1Cre induced bone mass increase are supposed to be indirectly affected by hormones from the hypothalamic-pituitary-gonadal axis. Our results showed that Kiss1 or Gpr54 are highly expressed in osteoclasts (Supplementary Fig. 1c, Supplementary Fig. 4), osteoclast-specific knockout of Kiss1 or Gpr54 exhibited osteoclast-hyperactivation-mediated bone loss (Fig. 6a–h), and bone targeting Kp-10, (DSS)*6-Kp-10 showed better effects than Kp-10 on bone protection in osteoclast overactivated mice model (Supplementary Fig. 15a, b). This suggests osteoclastic Kp-10/Gpr54 played an important role in bone protection via suppression of osteoclast bone resorption.

Typically, GPCR activation with increasing of ligand concentration generates different signalings and phenotypes⁴⁵. In the working model of Kp-10/Gpr54-mediated suppression of Src phosphorylation, the expression of Dusp18 was obviously upregulated by 0.1, 1 nM Kp-10 but not by 10 nM Kp-10 (Fig. 5a). Howevere, Src and Dusp18 were more significantly recruited by Gpr54 upon activation by 10 nM Kp-10 (Fig. 2i, j, Fig. 3c, d, Fig. 4e, f, Fig. 5d–i), and Src phosphorylation was more obviously blocked by 10 nM Kp-10 (Fig. 1c, d, Fig. 4l–m, Fig. 5j, k, Supplementary Fig. 1a, b). Furthermore, we found that Kiss1 or Gpr54 deletion enhanced osteoblast differentiation in vivo (Supplementary Fig. 12) and in vitro (Supplementary Fig. 13a, b). Consistent with this, Kp-10 effectively suppressed osteoblast differentiation at 0.01 nM and 0.1 nM (Supplementary Fig. 13c, d). However, Son et al. described that KP-10 stimulated osteoblast differentiation in vitro at 5 and 50 μM⁴⁶, which was not consistent with the phenotype generated by Kiss1 or Gpr54 knockout.

Methods

Reagents and antibodies

The antibodies used in this study are listed in Supplementary Table 1. Recombinant mouse M-CSF protein (# 416-ML) and Recombinant mouse RANKL (462-TEC) were purchased from R&D systems. Peptides were from GL Biochem (Shanghai) LTD. Staurosporine (S1421), KN-93(S6787), U73122 (S8011), Saracatinib (S1006), LY3214996(S8534), SB203580 (S1076) were from Selleck.Puromycin (P8833), Pierce™ GST agarose (20211) and Pierce™ Protein A/G plus agarose (20423) were purchased from Thermo Fisher, USA. anti-HA-beads (IP0010) and Anti-FLAG-beads (F2426) were obtained from Sigma-Aldrich, USA.

Cell culture

293 T, MEFs, BMMs and RAW264.7 cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 100 mg/ml streptomycin. Sf9 cells were grown in GIBCO® insect culture media supplemented with 10% fetal bovine serum (FBS), 100 units/ml penicillin, and 100 mg/ml streptomycin. Arrb1 and Arrb2 double knockout MEFs were a gift from Dr. Robert J. Lefkowitz (Duke University). All cell lines were tested to be negative for mycoplasma contamination.

Transfections

Transfection of plasmid in 293 T cells was performed using PEI (Polysciences), siRNA was done in Raw264.7 cells and in 293 T cells with Lipofectamine™ LTX (Thermo Fisher) according to the manufacturer’s instructions.

Lentivirus generation

To generate lentivirus, 293 T cells were plated in 10-cm dishes and transfected with lentiviral plasmids and the lentiviral packaging plasmids pMD2.G and psPAX2 at a ratio of 1:0.5:1 after transfection for 48–72 h, the supernatant was collected using filtered (0.22 μm filter, Millipore, USA).

Kp-10 modification

Modified Kp-10 (D-Tyr–Asn-(D-Trp)-Asn-Ser-Phe-(azaGly)-Leu-Arg (Me)-Phe-NH2) was designed as previously described⁴⁷, which showed not only high metabolic stability but also excellent GPR54 agonistic activity. Bone targeting Kp-10 (Asp-Ser-Ser-Asp-Ser-Ser-Asp-Ser-Ser-Asp-Ser-Ser-Asp-Ser-Ser-Asp-Ser-Ser- D-Tyr–Asn-(D-Trp)-Asn-Ser-Phe-(azaGly)-Leu-Arg (Me)-Phe-NH2) was designed using six repetitive sequences of aspartate, serine, and serine, which is a bone surface-targeting delivery system as previously described³⁸.

Site-directed mutagenesis

Site-directed mutagenesis to generate various DUSP18 and C-terminus of GPR54 mutants was performed using the QuikChange XL Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions.

SH3 domain protein-binding array

SH3 domain protein-binding array was performed using TranSignal™ SH3 Domain Array kit (Cat. #MA3010). The kit was purchased from Panomics, and probed using GST-GPR54 CT. Purified different SH3 domain-containing proteins including the Src kinase family were spotted in duplicate on the membrane filter and tested for their binding to GST-GPR54 CT. Briefly, membrane filters were incubated with 30 mg/ml GST-GPR54 CT protein overnight at 4 °C. After washing the membrane, the GST antibody was incubated overnight at 4 °C. Protein binding was visualized by incubation with an HRP-conjugated antibody. Spots with stronger intensities indicated a higher binding affinity of GST-GPR54 CT with the SH3 domain-containing protein (s). SH3 domain proteins in the array were summarized in Supplementary Table 3.

Surface plasmon resonance (SPR)

SPR was determined using a Biacore T200 instrument (GE). SRC or DUSP18 protein was immobilized on the sensor chip (CM5) using the amine-coupling method according to standard protocols. Immobilization was performed according to the manufacturer’s recommendations. SRC protein (64 ug/mL, pH5.0) or DUSP18 protein (25 ug/mL, pH7.4) was diluted in 10 mM acetate buffer or 10 mM PBS buffer. Sh2-sh3 (100 ug/mL, pH5.0) was diluted in 10 mM acetate buffer. Immobilization was performed according to the manufacturer’s recommendations. The kinetics and affinity assay were examined at 25 °C at a flow rate of 30 µl/minute using PBS buffer with 0.05% Tween-20. The KD values were calculated with the kinetics analysis (1:1 model) of Biacore T200 evaluation software. The interaction of GPR54 CT, peptides of PR motifs with Src or DUSP18, and the interaction of DUSP18 and Src were analyzed respectively by regeneration with pH 2.0 Gly-HCl buffer.

Protein expression and purification

The C terminus of human GPR54 (H329- L398) and mouse Gpr54 (R331- L396) cDNAs were subcloned into a pGEX-4T2 vector. For purification of full-length WT human DUSP18 and DUSP18 (C104S) proteins, DUSP18 was cloned into pMCSG7 vector. For purification of Src (G85-L536) protein, cDNAs of human Src were subcloned into pFastBac HT B vector with an N-terminal 6xHis tag and expressed in Sf9 cells (Expression Systems) using the Bac-to-Bac Baculovirus Expression System (Invitrogen) for 48 h. For purification of the Src (G85-V247)-GPR54 (333–356 with C338S, C340S mutation) recombinant fusion protein, the C-terminus of GPR54 (333–356 with C338S and C340S mutation) was linked to the C terminus of Src SH3-SH2 domain (G85-V247), which was subcloned into the pMCSG7 vector.

Protein crystallization and structure determination

For crystallization, the C-terminus of GPR54 (333–356 with mutations C338S and C340S) was inserted into the C-terminus of Src SH3-SH2 domains (G85-V247), this fragment (Src^G85-V247–GPR54^333–356) was then subcloned into pMCSG7. The concentrated fusion protein was set up for crystallization using a hanging drop with NT8 (Formulatrix). Diffraction data for the chimera protein (Src^G85-V247–GPR54^333–356) were collected at a wavelength of 0.979 Å at beamline BL17U1 at SSRF, and indexed, integrated, and scaled using the automatic XIA2 software package⁴⁸. The structure was solved by the molecular replacement method using SH3 and SH2 domains of Src as a searching model. Refinement was carried out using Phenix⁴⁹ and with manual adjustments with Coot⁵⁰. Refinement parameters were summarized in Supplementary Table 4.

Immunoblots (IB)

Whole-cell proteins were extracted using 1x RIPA buffer (25 mM Tris, pH7.5, 150 mM NaCl, 0.5% Sodium deoxycholate, 1% Triton-X-100) supplemented with protease inhibitors (Complete Mini, Roche) and phosphatase inhibitors (phosphatase inhibitor cocktail set I and II, Calbiochem). Immunoprecipitation and immunoblotting with indicated antibodies were performed as described in Supplementary Table 1. Image Jsoftware (V1.52) was used for quantification analysis. Uncropped and unprocessed blots are presented in the Supplementary Information file.

Osteoclast differentiation

For osteoclast differentiation analyses in vitro, we isolated BMMs from femurs and tibias of 8-week-old WT and Kiss1^−/−, Gpr54^−/− and Dusp18^−/− mice using a 1 ml syringe with a 26 G needle. The differentiation experiments were conducted in triplicate. BMMs were seeded into 48-well plates at a concentration of 1 × 10⁴ cells per well. Cells were incubated with 50 ng/ml RANKL (R&D, 462-TEC) and 10 ng/ml M-CSF (R&D, 416-ML), and the differentiation medium was changed every other day for 5–7 days. Osteoclasts were fixed and stained using the TRAP staining kit (Sigma-Aldrich, 387A-1KT).

Actin-ring formation assay and pit assay

BMMs (5 × 10³ cells/well) were seeded into 96-well plates with a bone slice and incubated with M-CSF (10 ng/ml) and RANKL (50 ng/ml) with or without Kp-10, and the culture medium was changed every other day for 5–7 days. Osteoclasts were fixed and stained by phalloidin and DAPI. “Pits” on bone slice after osteoclast resorption were fixed with 4% Glutaraldehyde and stained with 1% toluidine blue, and pit depth was examined by laser-scanning confocal microscopy. For primary cultures of giant-cell tumor of bone (GCTB) cells, the use of all patient-derived tumor specimens was approved by the Institutional Review Board and the research ethics committee of Shanghai Changzheng Hospital, which appeared in the proceedings of the meeting of the Ethics Committee on 18 November 2014 (report number: 2014090). Informed consent obtained from all tissue donors was written. The GCTB cells were isolated from tumor samples derived from tumor resections in Shanghai Changzheng Hospital, 1 × 10⁶ GCTB cells were seeded in a 24-well plate. Cells were stimulated with indicated doses of Kp-10 for 5–7 days. The medium was changed every 2 days. Osteoclasts were fixed and stained using the TRAP-staining kit (Sigma-Aldrich, 387A-1KT).

Osteoblast differentiation

For osteoblast differentiation analyses in vitro, we isolated bone marrow mesenchymal stem cells (MSCs) from femurs and tibias of 8-week-old WT and Kiss1^−/−, Gpr54^−/− and Dusp18^−/− mice using a 1 ml syringe with a 26 G needle. MSCs were seeded into 12-well plates at a concentration of 1 × 10⁵ cells per well. Cells were incubated with 50 µg/mL ascorbic acid, 10 mmol/L beta-glycerophosphate and 10 nmol/L dexamethasone. The medium was replaced every 2 days during the incubation period. Alkaline phosphatase (ALP) activity was assayed using the assay mixtures containing 0.1 M 2-amino-2-methyl-1-propanol, 1 mM MgCl2, 8 mM p-nitrophenylphosphate disodium (Sigma). For determination of mineralization, cells were fixed with 95% ethanol and stained with AgNO3 by the von Kossa method.

In vitro phosphatase activity assay

For the total phosphatase activity assay, the Co-IP experiment was carried out after Kp-10 treatment of RAW264.7 cells for 20 min, followed by lysis and incubation with the Gpr54 antibody. The assay was performed according to the phosphatase assay kit (Sigma-Aldrich,17-313). For the DUSP18 phosphatase activity assay, His-DUSP18 and His-DUSP18 (C104S) were purified from E Coli, and His-Src was purified from Sf9 insect cells. His-DUSP18 and His-DUSP18 (C104S) were incubated with His-Src in 1x phosphatase buffer (20 mM HEPES, 20 mM MgCl2, 0.03% β-mercaptoethanol)⁵¹ for 30 min at 30 °C with gentle shaking. The reactions were stopped by the addition of 3× SDS sample buffer followed by boiling for 10 min and subjected to Western blotting using specific antibodies.

Mass spectrometry analyses

For mass spectrometry (MS) analysis, anti-Gpr54 IP was performed with the whole-cell lysates derived from two 10-cm dishes of RAW264.7 cells with or without Kp-10 treatment for 20 min. The protein complexes after Co-IP were extensively washed with PBS, followed by on-bead digestion. Mass spectra were acquired on a Q-Exactive mass spectrometer (Thermo Scientific, Bremen, Germany). The raw mass spectrometry data were searched against the mouse IPI databases (version 3.86, released on June 28, 2012) using the Proteome Discoverer software suite (Thermo Scientific, San Jose, USA) utilizing a label-free quantification feature. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE⁵² partner repository with the dataset identifier PXD038433.

Immunofluorescence (IF) staining

For endogenous IF staining, BMMs were seeded on confocal dishes and induced by 50 ng/ml RANKL and 10 ng/ml M-CSF for 2 days, and subsequently incubated with or without Kp-10 for 20 min. Cells were fixed in 10% TCA and incubated with anti-Gpr54 (Cell Signaling Technologies, 13776, 1:100), anti-Dusp18 (Santa Cruz., sc-376923, 1:100), or anti-Src (Cell Signaling Technologies, 2110, 1:400) or anti-Src (Cell Signaling Technologies, 2109, 1:400) overnight. IF staining of membrane colocation of Gpr54 with Src or Dusp18, and Src with Dusp18 were detected by Alexa Fluor™ 594 Tyramide SuperBoost™ Kit (Invitrogen, B40925) and Alexa Fluor™ 488 Tyramide SuperBoost™ Kit (Invitrogen, B40912) according to manufacturer’s instructions. The images were obtained by total internal reflection fluorescence (TIRF) microscopy (Ti2-E + H-TIRF, Nikon).

Knockdown of gene expression by shRNA and siRNA

Lentiviral shRNA plasmids and siRNA oligos were ordered from GENEWIZ (Suzhou, China). The shRNA sequence against mouse Scr is 5′- AGCCGCCAATATCCTAGTA −3′. The siRNA sequence against mouse ERK1/2, human ERK1/2, and human Src were listed in Supplementary Table 2.

Quantitative PCR analysis

Total RNA was extracted from RAW264.7 cells using TRIzol® (TaKaRa) and then reverse transcribed into cDNA using the PrimeScript RT-PCR Kit (TaKaRa, RR014) according to the manufacturer’s instructions. The cDNA products were used for quantitative PCR analysis by SYBR Mix (TaKaRa, RR064). Sequences of the indicated primers are described in Supplementary Table 2.

Kisspeptins Elisa assay

Conditional medium was obtained from the process of osteoclast and osteoblast differentiation. The same number of MSC or BMMs were seeded on every 10-cm dishe to induce osteoclast differentiation. Serum was from Sham-operated and ovariectomized mice two months after operation. Level of Kisspeptins was measured using a mouse Kisspeptin ELISA kit (LS-F11879-1, LSBio).

Micro-CT analyses

3D micro-CT analyses were performed as previously described⁵³. We scanned the femur using in vitro X-ray microtomography (Skyscan 1272, Bruker micro CT) at a pixel size of 9 µm, and analyzed the results according to the manufacturer’s instructions. Region-of-interest (ROI) was defined from 10 to 110 image slices, where the growth plate slice was defined as 0 mm. The contrast was defined from 68–255; 3D analysis, BMD, and 3D models were analyzed using CTAn software (Bruker micro CT). 3D models were adjusted in CT Vox software (Bruker micro CT).

Mice

Generation of Gpr54 mice (strain C57/BL/6) was obtained from Dr. Eric L. Gustafson at Schering-Plow Research Institute (Kenilworth, NJ, USA). Genotyping was conducted by PCR as previously described⁵⁴. Briefly, mutant mice (Gpr54^−/−) with a targeted disruption of a 52 bp fragment from exon 2 of the GPR54 gene and a replacement with an IRES-LacZ Neo insert were generated by Deltagen (Palo Alto, CA)⁵⁴. Generation of Gpr54^flox/flox mice (strain C57/BL/6) and Kiss1^flox/flox mice (strain C57/BL/6) were performed using the CRISPR/Cas9 system in the C57BL/6 J mouse strain from the Animal Center of East China Normal University. Edited alleles are generated by Cas9-mediated homologous recombination. Loxp sequences are inserted on each side flanking exon 2 of Gpr54 (left: 79755124–79755125, right: 79755550–79755551), and exon 2 of Kiss1 (left: 133256970–133256971, right: 133257493–133257494), which were described in Supplementary Fig. 10a (Gpr54 floxed mice) and Supplementary Fig. 10b (Kiss1 floxed mice). Generation of Kiss1^−/− mice was performed using the CRISPR/Cas9 system in the C57BL/6 J mouse strain from the Animal Center of East China Normal University. A sgRNA targeting CCTGGATCCACAGGTACGCAC of the Kiss1 gene was designed and 13 bp (CCTGGATCCACAG) of the Kiss1 gene was deleted. Genotyping was performed by PCR as described in Supplementary Table 2. Generation of Dusp18^−/− mice was performed using the CRISPR/Cas9 system in the C57BL/6 J mouse strain from the Animal Center of East China Normal University. Two 20-bp sgRNAs targeting TGCGAGAGGCCTCTGATCGAAGG and GCGACGGGCGCATCGACCACAGG were designed and 164 bp between 406 bp and 569 bp of the Dusp18 gene was deleted. Genotyping was performed by PCR as described in Supplementary Table 2. Generation of Arrb1^−/− and Arrb2^−/− mice (strain C57/BL/6) were described in a previous publication^55,56. G_qα^flox/flox:G₁₁α^−/− mice (strain C57/BL/6) wre obtained from Dr. Richard D Ye, at The Chinese University of Hong Kong (Shenzhen, China), in which the gene coding for Gαq, gnaq, is flanked with loxP sites⁵⁷ were crossed to the constitutively Gα11^−/− mice⁵⁸, and genotyping was conducted by PCR as previously described^57,58. LysM-Cre mice (strain C57BL/6) were described in ref. ⁵⁹. Gpr54^flox/flox mice, Kiss1^flox/flox mice and Gqα^flox/flox:G11α^−/− mice were crossed to LysM-Cre mice respectively to abtain osteoclast conditional knockout of Gpr54, Kiss1 or Gαq mice. Both male and female mice were used in all experiments, except for the OVX model that only used female mice. All of the mice were randomly assigned to groups. Animal study was approved by the Institutional Animal Care and Use Committee at East China Normal University (m20140907). Mice were maintained, bred and studied in compliance with approved protocols. Mouse euthanasia was done first by anesthesia and then followed by cervical dislocation. Animal experiments were conducted in accordance with the ARRIVE guidelines.

Histology

Bone tissue was removed of excess tissues and fixed with 4% formalin, decalcified with 0.5 M EDTA for 10–14 days, embedded with paraffin, sectioned, and stained using the TRAP staining kit (Sigma-Aldrich, 387A-1KT). The third lumbar spine vertebrae (L3) were fixed with 4% formalin, sectioned, and subjected to Von Kossa staining as described previously^60,61. For double calcian labeling assay, 4−5 week-old mice were administrated calcian (30 μg/mL) through intraperitoneal injection for the first time and the second time after 10 days. The third lumbar spine vertebrae (L3) were fixed with 4% formalin, sectioned, and subjected to Goldner’s Masson trichrome staining, or acquisition of fluorescence images. Histomorphometric measurements were made using the OsteoMeasure Analysis System (Osteometrics, Atlanta, GA, USA) according to standard criteria.

Treatment with Kp-10 and bone targeting Kp-10 ((DSS)*6-Kp-10) in vivo

For animal studies in vivo, mice were randomized for weight. For the OVX-induced bone loss model, 2-month-old female C57BL/6 mice were sham-operated (sham) or ovariectomized (OVX) and randomly divided into indicated groups. Vehicle, Kp-10 or (DSS)*6-Kp-10 was injected into the tail vein twice per week. After two months of treatment, the femurs and the L3 lumbrae were isolated for micro-CT or histomorphometric analysis. 3D micro-CT analyses were performed according to a standard protocol. BMD and bone volume were analyzed by CT-analysis software (CTAn, Bruker micro CT, Kontich, Belgium) and images were reconstituted by CT-volume software (CTvol, skyscan, CTAn, Bruker micro CT, Kontich, Belgium).

Statistical analyses

Data are represented as the mean ± standard error of the mean (SEM) or the mean ± standard deviation (SD) as indicated in the figure legends. The statistical significance of differential values between experiments and controls was calculated by GraphPad Prism V7. The statistical P values were determined by Student’s t-test or one-way ANOVA analysis as indicated in the manuscript.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

All relevant data are available in the main figures, supplementary information, and the source data file. Source data and full-length Western Blots are provided in the Source Data File. Mass spectrometry analysis data are available via ProteomeXchange with identifier PXD038433. Source data are provided with this paper.

References

Rachner, T. D., Khosla, S. & Hofbauer, L. C. Osteoporosis: now and the future. Lancet 377, 1276–1287 (2011).
Article CAS PubMed PubMed Central Google Scholar
Raisz, L. G. Pathogenesis of osteoporosis: concepts, conflicts, and prospects. J. Clin. Invest. 115, 3318–3325 (2005).
Article CAS PubMed PubMed Central Google Scholar
Boyle, W. J., Simonet, W. S. & Lacey, D. L. Osteoclast differentiation and activation. Nature 423, 337–342 (2003).
Article CAS PubMed ADS Google Scholar
Wada, T., Nakashima, T., Hiroshi, N. & Penninger, J. M. RANKL-RANK signaling in osteoclastogenesis and bone disease. Trends Mol. Med. 12, 17–25 (2006).
Article CAS PubMed Google Scholar
Miyazaki, T. et al. Src kinase activity is essential for osteoclast function. J. Biol. Chem. 279, 17660–17666 (2004).
Article CAS PubMed Google Scholar
Destaing, O. et al. The tyrosine kinase activity of c-Src regulates actin dynamics and organization of podosomes in osteoclasts. Mol. Biol. Cell 19, 394–404 (2008).
Article CAS PubMed PubMed Central Google Scholar
Mayer, B. J. SH3 domains: complexity in moderation. J. Cell Sci. 114, 1253–1263 (2001).
Article CAS PubMed Google Scholar
Jiang, Y. J., Zhou, C. J., Zhou, Z. R., Wu, M. & Hu, H. Y. Structural basis for recognition of the third SH3 domain of full-length R85 (R85FL)/ponsin by ataxin-7. FEBS Lett. 587, 2905–2911 (2013).
Article CAS PubMed Google Scholar
Musacchio, A., Saraste, M. & Wilmanns, M. High-resolution crystal structures of tyrosine kinase SH3 domains complexed with proline-rich peptides. Nat. Struct. Biol. 1, 546–551 (1994).
Article CAS PubMed Google Scholar
Feng, S., Chen, J. K., Yu, H., Simon, J. A. & Schreiber, S. L. Two binding orientations for peptides to the Src SH3 domain: development of a general model for SH3-ligand interactions. Science 266, 1241–1247 (1994).
Article CAS PubMed ADS Google Scholar
Xu, W., Harrison, S. C. & Eck, M. J. Three-dimensional structure of the tyrosine kinase c-Src. Nature 385, 595–602 (1997).
Article CAS PubMed ADS Google Scholar
Meng, Y., Pond, M. P. & Roux, B. Tyrosine kinase activation and conformational flexibility: lessons from Src-family tyrosine kinases. Acc. Chem. Res. 50, 1193–1201 (2017).
Article CAS PubMed PubMed Central Google Scholar
Lim, W. A., Richards, F. M. & Fox, R. O. Structural determinants of peptide-binding orientation and of sequence specificity in SH3 domains. Nature 372, 375–379 (1994).
Article CAS PubMed ADS Google Scholar
Lowe, C. et al. Osteopetrosis in Src-deficient mice is due to an autonomous defect of osteoclasts. Proc. Natl Acad. Sci. 90, 4485–4489 (1993).
Article CAS PubMed PubMed Central ADS Google Scholar
Jurdic, P., Saltel, F., Chabadel, A. & Destaing, O. Podosome and sealing zone: specificity of the osteoclast model. Eur. J. Cell Biol. 85, 195–202 (2006).
Article CAS PubMed Google Scholar
Heckel, T. et al. Src-dependent repression of ARF6 is required to maintain podosome-rich sealing zones in bone-digesting osteoclasts. Proc. Natl Acad. Sci. 106, 1451–1456 (2009).
Article CAS PubMed PubMed Central ADS Google Scholar
Horne, W. C., Sanjay, A., Bruzzaniti, A. & Baron, R. The role(s) of Src kinase and Cbl proteins in the regulation of osteoclast differentiation and function. Immunol. Rev. 208, 106–125 (2005).
Article CAS PubMed Google Scholar
Susva, M., Missbach, M. & Green, J. Src inhibitors: drugs for the treatment of osteoporosis, cancer or both? Trends Pharmacol. Sci. 21, 489–495 (2000).
Article CAS PubMed Google Scholar
Saylor, P. J., Lee, R. J. & Smith, M. R. Emerging therapies to prevent skeletal morbidity in men with prostate cancer. J. Clin. Oncol. 29, 3705–3714 (2011).
Article PubMed PubMed Central Google Scholar
Vandyke, K. et al. The tyrosine kinase inhibitor dasatinib dysregulates bone remodeling through inhibition of osteoclasts in vivo. J. Bone Miner Res. 25, 1759–1770 (2010).
Article CAS PubMed Google Scholar
Hannon, R. A. et al. Effects of the Src kinase inhibitor saracatinib (AZD0530) on bone turnover in healthy men: a randomized, double-blind, placebo-controlled, multiple-ascending-dose phase I trial. J. Bone Miner Res. 25, 463–471 (2010).
Article CAS PubMed Google Scholar
Sharma, S. V. et al. UCS15A, a non-kinase inhibitor of Src signal transduction. Oncogene 20, 2068–2079 (2001).
Article CAS PubMed Google Scholar
Davenport, A. P., Scully, C. C. G., de Graaf, C., Brown, A. J. H. & Maguire, J. J. Advances in therapeutic peptides targeting G protein-coupled receptors. Nat. Rev. Drug Discov. 19, 389–413 (2020).
Article CAS PubMed Google Scholar
Hauser, A. S., Attwood, M. M., Rask-Andersen, M., Schioth, H. B. & Gloriam, D. E. Trends in GPCR drug discovery: new agents, targets and indications. Nat. Rev. Drug Discov. 16, 829–842 (2017).
Article CAS PubMed PubMed Central Google Scholar
Yun, H. M. et al. The novel cellular mechanism of human 5-HT6 receptor through an interaction with Fyn. J. Biol. Chem. 282, 5496–5505 (2007).
Article CAS PubMed Google Scholar
Liu, J. et al. Src homology 3 binding sites in the P2Y2 nucleotide receptor interact with Src and regulate activities of Src, proline-rich tyrosine kinase 2, and growth factor receptors. J. Biol. Chem. 279, 8212–8218 (2004).
Article CAS PubMed Google Scholar
Cao, W. et al. Direct binding of activated c-Src to the beta 3-adrenergic receptor is required for MAP kinase activation. J. Biol. Chem. 275, 38131–38134 (2000).
Article CAS PubMed Google Scholar
Sun, Y. et al. Dosage-dependent switch from G protein-coupled to G protein-independent signaling by a GPCR. EMBO J. 26, 53–64 (2007).
Article PubMed Google Scholar
Ma, Y. C., Huang, J., Ali, S., Lowry, W. & Huang, X. Y. Src tyrosine kinase is a novel direct effector of G proteins. Cell 102, 635–646 (2000).
Article CAS PubMed Google Scholar
Pierce, K. L. & Lefkowitz, R. J. Classical and new roles of beta-arrestins in the regulation of G-protein-coupled receptors. Nat. Rev. Neurosci. 2, 727–733 (2001).
Article CAS PubMed Google Scholar
Seminara, S. B. et al. The GPR54 gene as a regulator of puberty. Obstet. Gynecol. Survey 59, 351–353 (2004).
Article Google Scholar
Pinilla, L., Aguilar, E., Dieguez, C., Millar, R. P. & Tena-Sempere, M. Kisspeptins and reproduction: physiological roles and regulatory mechanisms. Physiol. Rev. 92, 1235–1316 (2012).
Article CAS PubMed Google Scholar
Ohtaki, T. et al. Metastasis suppressor gene KiSS-1 encodes peptide ligand of a G-protein-coupled receptor. Nature 411, 613–617 (2001).
Article CAS PubMed ADS Google Scholar
Aparicio, S. A. Kisspeptins and GPR54-the new biology of the mammalian GnRH axis. Cell Metab. 1, 293–296 (2005).
Article CAS PubMed Google Scholar
Li, Z., Liu, J., Inuzuka, H. & Wei, W. Functional analysis of the emerging roles for the KISS1/KISS1R signaling pathway in cancer metastasis. J. Genet. Genom. 49, 181–184 (2022).
Article CAS Google Scholar
Ahow, M. et al. KISS1R signals independently of Galphaq/11 and triggers LH secretion via the beta-arrestin pathway in the male mouse. Endocrinology 155, 4433–4446 (2014).
Article PubMed PubMed Central Google Scholar
Evans, B. J. et al. Physical association of GPR54 C-terminal with protein phosphatase 2A. Biochem. Biophys. Res. Commun. 377, 1067–1071 (2008).
Article CAS PubMed Google Scholar
Zhang, G. et al. A delivery system targeting bone formation surfaces to facilitate RNAi-based anabolic therapy. Nat. Med. 18, 307–314 (2012).
Article PubMed Google Scholar
Kobayashi, T. et al. 2-acylamino-4,6-diphenylpyridine derivatives as novel GPR54 antagonists with good brain exposure and in vivo efficacy for plasma LH level in male rats. Bioorg. Med. Chem. 18, 5157–5171 (2010).
Article CAS PubMed Google Scholar
Tsukasaki, M. & Takayanagi, H. Osteoimmunology: evolving concepts in bone-immune interactions in health and disease. Nat. Rev. Immunol. 19, 626–642 (2019).
Article CAS PubMed Google Scholar
Xu, X. et al. Transforming growth factor-beta in stem cells and tissue homeostasis. Bone Res. 6, 2 (2018).
Article PubMed PubMed Central Google Scholar
MacIntyre, I. et al. Calcitonin for prevention of postmenopausal bone loss. Lancet 1, 900–902 (1988).
Article CAS PubMed Google Scholar
Hosking, D. J., Bijvoet, O. L., van Aken, J. & Will, E. J. Paget’s bone disease treated with diphosphonate and calcitonin. Lancet 1, 615–617 (1976).
Article CAS PubMed Google Scholar
Herber, C. B. et al. Estrogen signaling in arcuate Kiss1 neurons suppresses a sex-dependent female circuit promoting dense strong bones. Nat. Commun. 10, 163 (2019).
Article PubMed PubMed Central ADS Google Scholar
Civciristov, S. et al. Preassembled GPCR signaling complexes mediate distinct cellular responses to ultralow ligand concentrations. Sci. Signal 11, https://doi.org/10.1126/scisignal.aan1188 (2018).
Son, H. E., Kim, K. M., Kim, E. J. & Jang, W. G. Kisspeptin-10 (KP-10) stimulates osteoblast differentiation through GPR54-mediated regulation of BMP2 expression and activation. Sci. Rep. 8, 2134 (2018).
Article PubMed PubMed Central ADS Google Scholar
Asami, T. et al. Serum stability of selected decapeptide agonists of KISS1R using pseudopeptides. Bioorg. Med. Chem. Lett. 22, 6391–6396 (2012).
Article CAS PubMed Google Scholar
Winter, G., Lobley, C. M. & Prince, S. M. Decision making in xia2. Acta Crystallogr. Sec D Biol. Crystallogr. 69, 1260–1273 (2013).
Article CAS ADS Google Scholar
Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. Sec D Biol. Crystallogr. 66, 213–221 (2010).
Article CAS ADS Google Scholar
Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. Sec D Biol. Crystallogr. 66, 486–501 (2010).
Article CAS ADS Google Scholar
Chen, W. et al. Ppm1b negatively regulates necroptosis through dephosphorylating Rip3. Nat. Cell Biol. 17, 434–444 (2015).
Article CAS PubMed PubMed Central Google Scholar
Perez-Riverol, Y. et al. The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 50, D543–D552 (2022).
Article CAS PubMed Google Scholar
Luo, J. et al. Regulation of bone formation and remodeling by G-protein-coupled receptor 48. Development 136, 2747–2756 (2009).
Article CAS PubMed PubMed Central Google Scholar
Funes, S. et al. The KiSS-1 receptor GPR54 is essential for the development of the murine reproductive system. Biochem. Biophys. Res. Commun. 312, 1357–1363 (2003).
Article CAS PubMed Google Scholar
Luan, B. et al. Deficiency of a beta-arrestin-2 signal complex contributes to insulin resistance. Nature 457, 1146–1149 (2009).
Article CAS PubMed ADS Google Scholar
Shi, Y. et al. Critical regulation of CD4+ T cell survival and autoimmunity by beta-arrestin 1. Nat. Immunol. 8, 817–824 (2007).
Article CAS PubMed Google Scholar
Wettschureck, N. et al. Absence of pressure overload induced myocardial hypertrophy after conditional inactivation of Galphaq/Galpha11 in cardiomyocytes. Nat. Med. 7, 1236–1240 (2001).
Article CAS PubMed Google Scholar
Offermanns, S. et al. Embryonic cardiomyocyte hypoplasia and craniofacial defects in G alpha q/G alpha 11-mutant mice. EMBO J. 17, 4304–4312 (1998).
Article CAS PubMed PubMed Central Google Scholar
Zhang, Z. et al. Ferroportin1 deficiency in mouse macrophages impairs iron homeostasis and inflammatory responses. Blood 118, 1912–1922 (2011).
Article CAS PubMed Google Scholar
Li, Z. et al. Dual targeting of bile acid receptor-1 (TGR5) and farnesoid X receptor (FXR) prevents estrogen-dependent bone loss in mice. J. Bone Miner Res. 34, 765–776 (2019).
Article PubMed Google Scholar
Parfitt, A. M., Simon, L. S., Villanueva, A. R. & Krane, S. M. Procollagen type I carboxy-terminal extension peptide in serum as a marker of collagen biosynthesis in bone. Correlation with Iliac bone formation rates and comparison with total alkaline phosphatase. J. Bone Miner Res. 2, 427–436 (1987).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This work was supported by the grants National Key Research and Development Program of China (2019YFC1316000 to X.Y.), Shanghai Pujiang Talent Program (22PJ1416000 to Z.L.), Natural Science Foundation of Shanghai Science and Technology Program (20ZR1457500 to Z.L.), Construction project of Key research center of Shanghai Municipal Health Program (2022ZZ01013 to J.X.),Orthopedic clinical medical Research Center construction project of Shanghai Science and Technology Program (21MC1930100 to J.X.). The authors would like to thank Dr. Robert J. Lefkowitz and Dr. Wenyi Wei for sharing the Arrb1 and Arrb2 double knockout MEFs, Dr. Gang Pei for providing Arrb1, Arrb2 knockout mice, Dr. Richard D Ye for providing G_qα^flox/flox:G₁₁α^−/− mice, Lujian Liao for helping us with Mass Spectrometry assay.

Author information

These authors contributed equally: Zhenxi Li, Xinghai Yang, Ruifeng Fu, Zhipeng Wu.
These authors jointly supervised this work: Zhenxi Li, Gaojie Song, Jian Luo, Mingyao Liu, Jianru Xiao.

Authors and Affiliations

Institute of Orthopedic Biomedical and Device Innovation, School of Health Science and Engineering, University of Shanghai for Science and Technology, Shanghai, 200093, China
Zhenxi Li, Ruifeng Fu, Long Zhang, Chunbiao Wu, Tianying Xie, Lianzhong Ai & Jianru Xiao
Institute of Orthopedics, Department of Orthopedic Oncology, Shanghai Changzheng Hospital, Naval Medical University, Shanghai, 200003, China
Zhenxi Li, Xinghai Yang, Ruifeng Fu, Zhipeng Wu, Jian Jiao, Ming Qian, Chunbiao Wu, Tianying Xie, Jiqiang Yao, Zhixiang Wu, Haifeng Wei, Jian Zhao & Jianru Xiao
East China Normal University and Shanghai Changzheng Hospital Joint Research Center for Orthopedic Oncology, Shanghai Key Laboratory of Regulatory Biology, Institute of Biomedical Sciences and School of Life Sciences, East China Normal University, Shanghai, 200241, China
Zhenxi Li, Shengzhao Xu, Wenjun Li, Guoli Ma, Yu You, Yihua Chen, Han-kun Zhang, Yiyun Cheng, Gaojie Song, Mingyao Liu & Jianru Xiao
Department of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, 02215, USA
Zhenxi Li
School of Biomedical Sciences, Hunan University, Changsha, 410082, China
Xiaolong Tang
Department of Neurology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, 02215, USA
Pengfei Wu & Gewei Lian
Academy of Integrative Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai, 201203, China
Jianrong Xu
Department of Translational Medical Sciences, Institute of Biosciences and Technology, Texas A&M University Health Science Center, Houston, TX, USA
Stefan Siwko
Shanghai Key Lab of Cell Engineering; Translational Medicine Research Center, Naval Medical University, Shanghai, 200433, China
Yue Wang
Clinical Cancer Institute, Center for Translational Medicine, Naval Medical University, Shanghai, 200433, China
Jin Ding
Yangzhi Rehabilitation Hospital (Shanghai Sunshine Rehabilitation Center), Tongji University School of Medicine, Shanghai, China
Jian Luo

Authors

Zhenxi Li
View author publications
You can also search for this author in PubMed Google Scholar
Xinghai Yang
View author publications
You can also search for this author in PubMed Google Scholar
Ruifeng Fu
View author publications
You can also search for this author in PubMed Google Scholar
Zhipeng Wu
View author publications
You can also search for this author in PubMed Google Scholar
Shengzhao Xu
View author publications
You can also search for this author in PubMed Google Scholar
Jian Jiao
View author publications
You can also search for this author in PubMed Google Scholar
Ming Qian
View author publications
You can also search for this author in PubMed Google Scholar
Long Zhang
View author publications
You can also search for this author in PubMed Google Scholar
Chunbiao Wu
View author publications
You can also search for this author in PubMed Google Scholar
Tianying Xie
View author publications
You can also search for this author in PubMed Google Scholar
Jiqiang Yao
View author publications
You can also search for this author in PubMed Google Scholar
Zhixiang Wu
View author publications
You can also search for this author in PubMed Google Scholar
Wenjun Li
View author publications
You can also search for this author in PubMed Google Scholar
Guoli Ma
View author publications
You can also search for this author in PubMed Google Scholar
Yu You
View author publications
You can also search for this author in PubMed Google Scholar
Yihua Chen
View author publications
You can also search for this author in PubMed Google Scholar
Han-kun Zhang
View author publications
You can also search for this author in PubMed Google Scholar
Yiyun Cheng
View author publications
You can also search for this author in PubMed Google Scholar
Xiaolong Tang
View author publications
You can also search for this author in PubMed Google Scholar
Pengfei Wu
View author publications
You can also search for this author in PubMed Google Scholar
Gewei Lian
View author publications
You can also search for this author in PubMed Google Scholar
Haifeng Wei
View author publications
You can also search for this author in PubMed Google Scholar
Jian Zhao
View author publications
You can also search for this author in PubMed Google Scholar
Jianrong Xu
View author publications
You can also search for this author in PubMed Google Scholar
Lianzhong Ai
View author publications
You can also search for this author in PubMed Google Scholar
Stefan Siwko
View author publications
You can also search for this author in PubMed Google Scholar
Yue Wang
View author publications
You can also search for this author in PubMed Google Scholar
Jin Ding
View author publications
You can also search for this author in PubMed Google Scholar
Gaojie Song
View author publications
You can also search for this author in PubMed Google Scholar
Jian Luo
View author publications
You can also search for this author in PubMed Google Scholar
Mingyao Liu
View author publications
You can also search for this author in PubMed Google Scholar
Jianru Xiao
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

G.J.S., J.L., M.Y.L., J.R.X.(Jianru Xixao) and Z.X.L. conceived and designed the experiments; Z.X.L., X.H.Y., R.F.F. and Z.P.W. performed most of the experiments with assistance from S.Z.X., J.J., M.Q., L.Z., C.B.W.; T.Y.X., J.Q.Y., Z.X.W., W.J.L., G.L.M., Y.Y., J.R.X. (Jianrong Xu); Y.H.C. and H.K.Z. helped to synthesis Kisspeptins and WB599; Y.Y.C. designed the bone targeting Kp-10; X.L.T., P.F.W., G.W.L., H.F.W., J.Z., L.A.,Y.W., J.D. discussed some results; S.S. discussed some results and modified the language, Z.X.L., X.H.Y., R.F.F. and Z.P.W. analyzed and organized the data and wrote the manuscript.

Corresponding author

Correspondence to Zhenxi Li.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Jiake Xu, Yingzi Yang, and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Li, Z., Yang, X., Fu, R. et al. Kisspeptin-10 binding to Gpr54 in osteoclasts prevents bone loss by activating Dusp18-mediated dephosphorylation of Src. Nat Commun 15, 1300 (2024). https://doi.org/10.1038/s41467-024-44852-9

Download citation

Received: 10 November 2021
Accepted: 05 January 2024
Published: 12 February 2024
DOI: https://doi.org/10.1038/s41467-024-44852-9

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.