Metabolic regulation of proteome stability via N-terminal acetylation controls male germline stem cell differentiation and reproduction

François, Charlotte M.; Pihl, Thomas; Dunoyer de Segonzac, Marion; Hérault, Chloé; Hudry, Bruno

doi:10.1038/s41467-023-42496-9

Download PDF

Article
Open access
Published: 23 October 2023

Metabolic regulation of proteome stability via N-terminal acetylation controls male germline stem cell differentiation and reproduction

Nature Communications volume 14, Article number: 6737 (2023) Cite this article

2946 Accesses
3 Citations
5 Altmetric
Metrics details

Subjects

Abstract

The molecular mechanisms connecting cellular metabolism with differentiation remain poorly understood. Here, we find that metabolic signals contribute to stem cell differentiation and germline homeostasis during Drosophila melanogaster spermatogenesis. We discovered that external citrate, originating outside the gonad, fuels the production of Acetyl-coenzyme A by germline ATP-citrate lyase (dACLY). We show that this pathway is essential during the final spermatogenic stages, where a high Acetyl-coenzyme A level promotes NatB-dependent N-terminal protein acetylation. Using genetic and biochemical experiments, we establish that N-terminal acetylation shields key target proteins, essential for spermatid differentiation, from proteasomal degradation by the ubiquitin ligase dUBR1. Our work uncovers crosstalk between metabolism and proteome stability that is mediated via protein post-translational modification. We propose that this system coordinates the metabolic state of the organism with gamete production. More broadly, modulation of proteome turnover by circulating metabolites may be a conserved regulatory mechanism to control cell functions.

Transient loss of Polycomb components induces an epigenetic cancer fate

Article Open access 24 April 2024

Sex differences orchestrated by androgens at single-cell resolution

Article 10 April 2024

Nuclear mRNA decay: regulatory networks that control gene expression

Article 18 April 2024

Introduction

Successful execution of the germline differentiation program requires intrinsic signals as well as paracrine and endocrine signalling among germ cells, supporting somatic cells, and other organs^1,2. In the testes, many growth factors produced by somatic cells influence germ cell development by direct contact or by indirect, ligand-mediated signalling. In addition to the known peptide signals mediating germline-soma communication, products of intracellular metabolic pathways are also detected in the circulatory system. Recent work has revealed that tissues can use and sometimes require such exogenous, circulating metabolites for function^3,4,5,6. For example, by examining the fluxes of circulating metabolites in mice, Hui and colleagues⁴ established that the contribution of glucose to intrinsic tricarboxylic acid (TCA) metabolism is primarily indirect, via circulating lactate, in all tissues except the brain. There is therefore growing interest in exploring the possible action of metabolites on tissue growth and homeostasis. In the context of germline development^7,8, outside of a known role for energy metabolism in germ cell differentiation, the significance of metabolic pathways remains largely unknown⁸, this question is of particular interest given that fertility is affected by nutrition and the availability of energy reserves in most animal species^9,10,11,12.

We recently discovered sex differences in intestinal carbohydrate metabolism, which are extrinsically controlled by the adjacent testis, and govern food intake through gut-derived citrate¹³. During the course of these experiments, we also noticed that this inter-organ communication impacts sperm production, suggesting that citrate from the extracellular milieu might contribute to gametogenesis¹³. One outstanding question is to determine if the role of gut-derived citrate in sustaining sperm production is independent of its role in stimulating appetite. Especially if circulating citrate is imported into the germline cells and regulates directly spermatogenesis. Although mitochondrial production of citrate seems to be the primary source for most cells, citrate plasma concentrations are relatively high¹⁴. The functional importance of exogenous citrate transport by cells is still unclear and has therefore gathered increasing interest. For example, up-regulation of the citrate transporter expression has been reported in patients with non-alcoholic fatty liver disease. Accordingly, knockdown of the citrate transporter encoding gene (Slc13a5) prevents diet-induced non-alcoholic fatty liver disease in mice^15,16. Slc13a5-knockout mice have also increased hepatic mitochondrial biogenesis, higher lipid oxidation, and energy expenditure, which protect the mice from obesity and insulin resistance¹⁷. Finally, citrate import is particularly important in human and mouse new-borns; mutations in Slc13a5 causing SLC13A5-epilepsy, a type of early-onset epileptic encephalopathy^18,19. Yet, the exact molecular mechanisms by which the functional deficiency of Slc13a5, and circulating citrate, influence these diverse phenotypes remain to be fully elucidated.

Here, we use Drosophila melanogaster spermatogenesis to investigate how a metabolic signal from the extracellular environment - citrate - instructs germline differentiation and homeostasis. We show that a protein post-translational modification couples the male metabolic state to the dynamics of germline stem cell differentiation. This original type of regulatory mechanism, mediated by circulating citrate and NatB-dependent N-terminal protein acetylation, controls the stability of a portion of the male germline proteome essential for spermatid individualisation.

Results

Citrate import is essential for male germline differentiation but not as a bioenergetics source

Sex differences in intestinal citrate homeostasis¹³, and effects of citrate on male gamete differentiation, prompted us to investigate the potential role of this metabolite in male gonads. Cellular citrate is found in two separate pools: a mitochondrial one, where citrate is a substrate in the TCA cycle, its oxidation fuelling ATP production; and a cytosolic one, where citrate is broken down by the ATP-citrate lyase (dACLY, in flies also known as ATPCL) to produce Acetyl-coenzyme A (Acetyl-CoA) and oxaloacetate (OAA)²⁰. Our initial hypothesis was that the requirement for citrate reflected the need for energy during spermatogenesis, and we therefore expected that citrate was required for TCA metabolism in the mitochondria.

To test this idea, we used the male fertility rate as a physiological readout for a genetic screen. We knocked down metabolic genes in the male germline, reasoning that the inhibition of citrate metabolising enzymes would reduce the male fertility rate if the metabolic pathway corresponding to this enzyme is essential for sperm production. Surprisingly, knocking down the 32 genes coding for the TCA cycle enzymes, using 44 different short hairpin RNA (shRNA) and RNA interference (RNAi) lines, did not affect male fertility (Fig. 1a and Table S1). As a positive control of our screen, we identified Succinyl-coenzyme A synthetase β subunit, ADP-forming (ScsβA) as the only TCA cycle gene essential for spermatogenesis. This TCA cycle component is known to carry a crucial moonlighting function in the male germline, having a structural role in spermatids, that can be uncoupled from its metabolic function²¹. These results being unexpected, we functionally validated the efficacy of our knockdowns, via ubiquitous expression in the soma (Fig. S1a). Importantly, all the tested lines, targeting enzymes for all the eight steps of the TCA cycle, efficiently knocked down expression of the corresponding enzymes, inducing lethality, as anticipated for genes coding for essential TCA cycle enzymes.

**Fig. 1: Citrate import is essential for male germline differentiation but not as a bioenergetics source.**

To further validate that the TCA cycle is dispensable for germline differentiation, we perform additional loss-of-function experiments, focusing on the first step of the TCA cycle, in which Acetyl-CoA condensates with OAA to form citrate. The fly genome encodes for two citrate synthase genes: dCS and CG14740²². While dCS is ubiquitous, CG14740 is expressed exclusively in the male germline²³. Immunohistochemical analyses confirmed that this enzyme localises to the spermatid mitochondria (Fig. S1b). We engineered, by CRISPR-Cas9, a null mutant for this testis-specific citrate synthase. Our allele fully abolished CG14740 expression (Fig. S1c), yet male fertility was unaffected (Fig. 1b). We also performed double knockdown experiments to rule out potential redundancy between the two citrate synthases, using validated effective RNAi lines (Fig. S1d). Males remained fertile (Fig. 1c), further confirming that the TCA cycle is dispensable for the production of sperm.

We therefore turned to the second way in which citrate is utilised, a pathway involving the dACLY enzyme and leading to cytosolic Acetyl-CoA production. Genetic manipulations, interfering with this route of citrate consumption via knockdown of dACLY (Fig. S1e), lead to male sterility (Fig. 1d). This finding shows that citrate is a key metabolite in the male germline and is used as fuel for the production of Acetyl-CoA.

To explore the origin of the citrate used by dACLY, we employed a genetic approach. From our previous results, we anticipated that cell-intrinsic production would not be a significant source of citrate. We indeed found that depleting the mitochondrial citrate transporter (dCIC, in flies known as scheggia (sea))^24,25 failed to affect male fertility (Fig. 1e, f). Using a genetically encoded GFP-based citrate sensor²⁶ expressed in the male germline, we verified that dCIC/sea or citrate synthase knockdowns did not impact the cytosolic citrate level (Fig. S1f, g). These results confirmed that germline mitochondria were not the source of the essential cytosolic citrate and that an alternative mechanism was involved. To investigate external import, we silenced by RNAi the three predicted citrate transporters (Fig. S1h), exclusively expressed in the male germline: CG7309, CG33934, and I’m not dead yet 2 (Indy-2)^22,23. Single downregulation of citrate transporter failed to affect male fertility (Figs. 1e, g, and S1i). However, while remaining fertile, males with all double and triple loss-of-function manipulations displayed a fertility rate divided by a factor of two and three, respectively (Fig. 1g). In contrast, parallel ectopic over-expression of one specific citrate transporter rescued male fertility to amounts comparable to those detected in wild-type males (Fig. 1g). These results indicate that male fertility depends on the extracellular import of citrate. Furthermore, the level of citrate entering in the male germline correlates with the degree of male fertility.

Altogether, these findings show that male germline differentiation relies on cytosolic citrate as an Acetyl-CoA precursor, but not as a bioenergetics source. Furthermore, while cell-autonomous citrate production in the germinal mitochondria is dispensable, the transport of germline-extrinsic citrate plays a critical role in sperm production.

Metabolic signalling through the conversion of citrate into Acetyl-CoA plays a key role in spermatid differentiation

To determine the cause of the male sterility induced by dACLY down-regulation, we examined the process of sperm differentiation. In flies, the testes exhibit a tubular organisation with a continuum of differentiating sperm cells arranged chronologically, allowing the simultaneous observation of all spermatogenic stages^27,28,29. These stages include stem cell daughter cells called gonialblasts, which undergo transit-amplifying divisions and produce interconnected spermatogonial precursors. These spermatogonia then differentiate into spermatocytes and grow dramatically in size, before dividing twice by meiosis. The final stage, spermiogenesis, results in haploid elongated spermatids interconnected in a syncytium. The production of single motile sperm requires the encapsulation of each spermatid by an independent plasma membrane and the elimination of most sperm cytoplasm. This apoptosis-like process, known as sperm individualisation, relies on caspase activity^30,31 and is characterised by membrane-enclosed structures termed waste bags where the discarded cytoplasm accumulates,. The spermatozoa are then released from the testes into the seminal vesicles (SVs), where the sperm matures under the influence of seminal fluid and becomes motile.

To examine whether a decrease in cytosolic Acetyl-CoA levels disrupted this process, we reduced cytosolic Acetyl-CoA production in testes by germline-specific dACLY knockdown, and then characterised the impact on spermatogenesis using twenty-five protein reporters^{32,33,34,35,36,37,38,39}, expressed in various cellular components and stages of sperm differentiation. We could not detect any effect on mitotic spermatogonia, spermatocyte growth, nor spermatid elongation (Figs. 2a and S2a). However, our immunohistochemical analyses revealed that only the last step of sperm differentiation, the individualisation, was massively compromised (Fig. 2a). Indeed, motile sperm in the seminal vesicles (SVs, dashed lines in the Dj^GFP marker) and waste bags with an activated version of the caspase-3-like effector caspase, cleaved Death caspase-1 (cDcp-1) (WBs, asterisks in the cDcp-1 staining) at the end of the elongated axonemes were missing (Fig. 2a).

**Fig. 2: Metabolic signalling through the conversion of citrate into Acetyl-CoA plays a key role in spermatid individualisation.**

To confirm that the phenotypes were specific to the loss of dACLY, we investigated whether the shRNA-induced phenotypes could be reversed by re-expression of dACLY. We generated a synthetic shRNA-resistant transgene for this genetic complementation test, which bears minimal sequence identity with the shRNA but encodes a wild-type dACLY protein. Expression of this shRNA-refractory construct rescued all the previously identified defects, including male fertility (Fig. 2b, c), mature sperm presence in the SVs (Fig. 2d, e), and waste bag formation (Fig. 2e, f).

To determine whether the defects induced by dACLY loss were confined to the final stages of sperm differentiation, we investigated two events, happening, just before individualisation: post-meiotic transcription and histone-to-protamine transition. In fly, post-meiotic transcription occurs just before protamines can be detected in spermatid nuclei³³, and is restricted to twenty comet and cup genes⁴⁰. Germline-specific dACLY knockdowns did not affect comet and cup gene transcription (Fig. S2b) nor protamine incorporation (Fig. 2a). Thus, loss of dACLY affects individualisation itself, not the steps leading up to it.

We then sought to define the temporal window of dACLY requirement during the differentiation of the male germline stem cell lineage. To do so, we uncoupled the induction of dACLY knockdown from the re-expression of the shRNA-immune rescue construct. During spermatogenesis, there are three main stages of transcriptional activity: one in stem cells, another in spermatogonia, and the last one in spermatocytes^27,29. Toward the end of the spermatocyte stage, transcriptional activity is arrested and the chromatin is condensed for meiotic divisions. We reduced dACLY expression using a genetic tool active in spermatogonia (bam-Gal4⁴¹) driving dACLY shRNA (Fig. 2g–i) and at the same time delivered our rescue transgene in late spermatocytes (using the promoter of matotopetli, topi)⁴², just before the transcriptional arrest. In this experimental setup, dACLY loss-of-function phenotypes were not observed and male fertility was restored (Fig. 2g–i). In parallel, stem cell-specific expression of dACLY RNAi (using the nanos-Gal4⁴³) did not cause male sterility (Fig. 2j). We obtained similar results with another RNAi line targeting a different exon of dACLY. Spermatogonial-specific expression of this RNAi caused male sterility, and was rescued by re-expression of dACLY in late spermatocytes only (Fig. 2k). These data establish that dACLY is dispensable during the early steps of spermatogenesis, but necessary during the last step, consistent with the individualisation defects observed.

We then investigated whether the enzymatic activity of dACLY is essential for male fertility. We generated three dACLY variants presenting mutations in the catalytic site (H772 > A)^44,45, and in the two substrates binding domains (citrate binding domain (R379A)⁴⁴, and the CoA binding pocket (D1038A)⁴⁴) (Fig. 2l), and performed a rescue-based structure-function analysis. The three mutant versions of dACLY were properly expressed in testes (Fig. S2c), but all failed to rescue the dACLY loss-of-function phenotypes (Fig. 2l–n). These results support the idea that the essential function of dACLY during male germline differentiation is mediated by its Acetyl-CoA synthetase catalytic activity.

Acetyl-CoA is a key player with diverse roles in metabolism. Besides citrate, it can also derive from other precursors, such as, acetate, fatty acids, and amino acids^46,47. We therefore wondered whether other Acetyl-CoA biosynthesis pathways may compensate, fully or partially, for dACLY inactivation. None of the other enzymes, generating Acetyl-CoA, drove male sterility upon germline-specific inactivation (Fig. S2d), nor were they transcriptionally up-regulated following dACLY knockdown (Fig. S2e). These results indicate that the different routes of Acetyl-CoA production act independently in the male germline and the alternative pathways do not normally compensate for loss of the main dACLY-dependent one. Possible explanations for this lack of compensation between different pools of Acetyl-CoA could be due to subcellular compartmentalisation and to the relative expression level of these Ac-CoA-producing enzymes. Interestingly, dACLY, among the cytosolic enzymes, has the highest expression level⁴⁸.

Together, our data reveal a metabolic regulatory pathway in which circulating citrate, which is imported into the male germline by citrate transporters, is cleaved by dACLY into Acetyl-CoA. This dACLY-dependent cytosolic Acetyl-CoA production is essential to promote spermatid individualisation.

N-terminal protein acetylation is essential for sperm production

We then explored the Acetyl-CoA potential biological roles during spermatid individualisation. The accumulation of Acetyl-CoA in the cytoplasm is known to fuel lipid synthesis and histone acetylation^{49,50,51,52,53,54,55,56,57}. Both processes depend on dACLY activity in many cell types^{58,59,60,61,62,63,64,65}. We hypothesised that the depletion of key enzymes using Acetyl-CoA should mimic dACLY sterility phenotype if the targeted pathway is the main route of Acetyl-CoA consumption. To test this hypothesis, we knocked down 25 genes involved in fatty acid (FA) synthesis and 19 acetyltransferases with enriched expression in adult testes (Table S2).

Very interestingly, among all the 44 tested genes encoding Acetyl-CoA utilising enzyme, only the silencing of two genes (Fig. S3a, b), belonging to the same NatB complex, dNAA20 and dNAA25 (in fly also called psidin), induced male sterility (Fig. 3). By contrast, knocking down genes coding for the FA biosynthesis enzymes did not impact male fertility (Fig. 3). Previous research^66,67,68 suggested that fatty acid supplementation could partially rescue the phenotype of ubiquitous dACLY mutation at the larval stages. In the male germline, fatty acid supplementation did not restore sperm individualisation (Fig. S3c, f) or mature sperm presence in the seminal vesicles (Fig. S3d, f). Even though males were given fatty acids, they remained sterile (Fig. S3e), indicating that the observed defects following dACLY-dependent cytosolic Acetyl-CoA production inhibition are not due to a decrease in the supply of fatty acids. RNAi-mediated silencing of 9 histone acetyltransferases (HATs), and 2 α-tubulin acetyltransferases (TATs) all failed to affect male fertility (Fig. 3), suggesting that these enzymes were unlikely the key players using Acetyl-CoA. These results are in agreement with our previous findings. Indeed, the histone-to-protamine transition requires a massive histone hyper-acetylation (on H4 and H3)^69,70 and this process is not affected by dACLY loss (Fig. 2a). Furthermore, in lysates of dissected testes acetylation of histone H3 was not reduced upon dACLY silencing (Fig. S3g). Under some conditions, Acetyl-CoA can also be used in the biosynthesis of ketone bodies, acetoacetate, and β-hydroxybutyrate⁴⁶. But again, knocking down the 7 enzymes involved in ketogenesis did not induce male sterility (Fig. 3).

**Fig. 3: N-terminal protein acetylation is essential for sperm production.**

Testis-enriched paralogs of more broadly-expressed genes are common^71,72,73,74. Interestingly, two duplicate genes, CG31851 and CG31730, paralogs of dNAA20, are exclusively expressed in testes^22,23. Although our RNAi screen did not identify CG31851 and CG31730 individually as essential genes for male germline differentiation (Fig. 3), we tested whether these paralogs could act in a redundant manner, as alternative NatB catalytic subunits. Testis-specific expression was confirmed by engineering HA-tagged knock-in for CG31851 followed by immunohistochemical analyses (Fig. S3h). We then generated a deletion removing CG31851 and CG31730 by CRISPR-Cas9. This mutation fully abolished the expression of both genes (Fig. S3i) and males carrying this deletion remained fertile (Fig. S3j, k). No defect in spermatid individualisation (Fig. S3l), nor mature sperm formation was observed (Fig. S3m). Even though these two proteins are divergent from dNAA20, with 60% of their residues being different, we tested their ability to rescue dNAA20 loss-of-function. Both proteins individually could not rescue dNAA20 knockdown phenotype indicating that dNAA20 is the only essential NatB catalytic subunit active in the male germline (Fig. S3n).

These data suggest that imported citrate, cleaved by dACLY to produce cytosolic Acetyl-CoA, is consumed, at least partially, to support N-terminal (Nt) protein acetylation mediated by the NatB complex.

N-terminal protein acetylation mediated by NatB is essential for spermatid differentiation

We therefore focused our attention on characterising NatB function during spermatogenesis. The NatB complex is formed by the catalytic subunit dNAA20 and the auxiliary subunit dNAA25^75,76. It co-translationally acetylates N-termini starting with methionine, followed by an acidic residue (MD-, ME-) or their amide (MN-, MQ-)⁷⁷. NatB substrates represent approximately 20% of the fly proteome and 90% of the proteins of this substrate class are irreversibly acetylated⁷⁷. Although the majority of eukaryotic proteins are subjected to Nt acetylation^75,76, there is no specific evidence of Nt protein acetylation function during male germline differentiation. More broadly, the biological relevance of Nt protein acetylation in the context of animal development remains poorly understood.

To explore how Nt protein acetylation controls male gamete formation, we started by characterising dNAA20 loss-of-function phenotypes. We engineered the first complete dNAA20 null mutant in flies using CRISPR-Cas9. This mutant allele fully abolished dNAA20 expression (Fig. 4a) and was lethal. This lethality is rescued by ubiquitous re-expression of a wild-type form of dNAA20 (Fig. S4a). Since, dNAA20 null mutant is lethal, we generated two different FRT-flanked knock-in alleles, with tagged or untagged rescue transgenes. The FLAG-tagged knock-in revealed that dNAA20 protein is ubiquitously expressed in the somatic tissues (Fig. S4b). In the male germline, dNAA20 is also expressed and co-localises with a marker of individualising spermatids (Fig. 4b, see zooms). Next, focusing on the function in the germline, we combined our new FRT-flanked knock-in alleles with germline-specific FRT recombinase (Flp) to produce germinal mutant cells. As observed with RNA silencing: males were sterile (Fig. 4c). Furthermore, mature sperm were absent in the SVs (Fig. 4d, e), and waste bag formation was abolished (Fig. 4e, f). All these results together strongly indicate that dNAA20 is essential for spermatid individualisation.

**Fig. 4: dNAA20 is essential for male germline differentiation.**

Using rescue experiments, we then determined the temporal requirement for NatB function and whether its enzymatic activity is essential for male fertility. Germline-specific NatB subunit (dNAA20 and dNAA25) knockdowns revealed a specific impairment in spermatid individualisation (Fig. S5a, b), similar to the defects caused by dACLY knockdown and dNAA20 knock-out. Re-expression experiments using RNAi-resistant dNAA20 and dNAA25 transgenes rescued all the previously identified defects, including male fertility (Fig. 5a, b, e, f), mature sperm presence in the SVs (Fig. 5c, g, i), and waste bag formation (Fig. 5d, h, i). Furthermore, we found that the phenotypes caused by inactivation of dNAA20 and dNAA25 in spermatogonia could be reversed by specific expression of rescue transgenes in late spermatocytes (Fig. 5a–d, e–h, i and Fig. S5c, d). Finally, knockdown of NatB subunits via RNAi in early germline stem cells did not affect spermatogenesis or male fertility (Fig. 5j, k). Thus, like dACLY, NatB activity is required during late spermatogenesis for individualisation. We next made a series of four point mutations in dNAA20 (Fig. 5l) to determine if the Nt acetyltransferase activity of the NatB complex was necessary to drive wild-type germline differentiation. We mutated the catalytic^78,79,80, Acetyl-CoA binging^81,82, and dNAA20-dNAA25 interaction sites^78,79 (Fig. 5l). Disruption of these sites completely abolished the capacity of dNAA20 to support spermatid individualisation and male fertility (Fig. 5l–n).

**Fig. 5: NatB-mediated N-terminal protein acetylation is essential for spermatid individualisation.**

Together, these experiments show that the N-acetyltransferase activity of NatB complex is necessary for spermatid individualisation, but is dispensable during the early steps of male germline differentiation. Our results reveal that Nt protein acetylation is physiologically essential for animal germline homeostasis.

NatB-mediated N-terminal-acetylation blocks protein degradation

Next we investigated which of the processes regulated by Nt protein acetylation is critical for spermatid individualisation. Like other post-translational modifications, Nt protein acetylation can influence many aspects of protein functions, including protein-protein interactions, protein complex formation, protein subcellular targeting, or protein folding^75,76. In addition, Nt protein acetylation was shown to play a role in the regulation of protein turnover through proteasomal degradation pathways^83,84,85. Indeed, biochemistry analyses showed that N-terminally acetylated proteins are targeted for degradation via an Ac/N-end rule pathway^86,87, whereas unacetylated proteins are targeted by an Arg/N-end rule pathway^88,89. However, more recent proteomic studies from yeast^90,91 and human cells⁹² argue against the involvement of the N-end rule pathways in the regulation of proteome stability and suggest instead that Nt acetylation status is rarely used as a degradation signal. Furthermore, although NatB acetylates hundreds of different substrates in flies⁷⁷, nothing is known about the functional and physiological relevance of these acetylation events.

To assess the possible contribution of protein degradation in the context of spermatogenesis, we performed immunoblot analyses using an antibody specific for lysine 48 (K48)-linked polyubiquitinylated conjugates. K48-linked polyubiquitin chains are the most abundant and the canonical signals for protein degradation by the proteasome. We first compared the levels of ubiquitinated proteins in wild-type and dNAA20 RNAi knockdown testes. Analysing lysates from dissected testes (Fig. 6a), we observed a dramatic increase in polyubiquitinylated proteins in knockdown male testes (Fig. 6a). Similar results were observed using the FK2 antibody⁹³ specific for mono- and polyubiquitinylated conjugates (Fig. 6b). Furthermore, the effect of dNAA20 RNAi on global protein turnover could also be recapitulated using the germline-specific dNAA20 knockout (Fig. 6c). These results demonstrate an increase in protein degradation by the 26 S proteasome in the absence of NatB-mediated Nt acetylation, suggesting that Nt-protein acetylation may function to increase overall proteome stability.

**Fig. 6: NatB-mediated N-terminal-acetylation blocks protein poly-ubiquitination.**

To test if this effect of NatB loss-of-function is indeed driven by the direct lack of NatB-mediated Nt-acetylation we re-expressed wild-type and catalytically dead versions of dNAA20. While wild-type dNAA20 was capable of rescuing protein stability (Fig. 6d), as shown by the decrease in K48-linked polyubiquitinylated proteins, the catalytic dead dNAA20 mutant (ERY) was not (Fig. 6e). These results indicate that Nt-acetylation is required for preventing an increase in K48-linked polyubiquitylation.

Finally, we found that this dNAA20 function is also dependent on dNAA25 since (1) expression of a dNAA20 variant unable to bind dNAA25 was not capable to promote target stability (Fig. 6f) and (2) germline-specific dNAA25 RNA silencing similarly increased protein polyubiquitylation (Fig. 6g).

These data establish that NatB-mediated Nt-acetylation directly and positively promotes protein stability. Furthermore, they suggest that spermatogenesis offers a unique opportunity to investigate the physiological relevance, in animals, of proteome stability regulation by Nt protein acetylation.

The N-recognin dUBR1 targets non-Nt acetylated NatB substrates for degradation

We tested if NatB function during spermatid individualisation is indeed mediated by the stabilisation of its targets. Non-Nt acetylated proteins are targeted for degradation by UBR-box ubiquitin E3 ligases, called N-recognins, which recognise non-Nt acetylated protein N-termini^{94,95,96,97,98,99} and catalyse their K48-linked polyubiquitylation. The Drosophila genome encodes three N recognins (dUBR1, dUBR4 also called poe, and dUBR5 also called hyd). We reasoned that, if the dNAA20 germline mutant phenotype is indeed mediated by increased protein degradation, inhibition the E3 enzymes targeting NatB substrates would increase male fertility. We therefore tested whether knockdown of dUBR1, dUBR4, or dUBR5 could rescue male fertility in flies lacking dNAA20 in the germline (Figs. 7a and S6a). Astonishingly, knockdown of the E3 ligase, dUBR1 (Fig. S6b), rescued male fertility (Fig. 6a, b), mature sperm presence in the SVs (Fig. 7c, d), and to a lesser extent waste bag formation (Fig. 7d, e). dUBR1 inactivation also rescued the loss-of-function phenotypes caused by loss of the auxiliary subunit dNAA25 (Fig. 7f–j). Consistent with this rescue of male spermatogenesis at the cellular- and tissue-level, dUBR1 inactivation also led to a reduction in K48-linked polyubiquitinylated proteins (Fig. 7k), and mono- and polyubiquitinylated conjugates (Fig. 7l). We used two GFP reporters to confirm that dUBR1-mediated K48 poly-ubiquitination triggers targets to the proteasome for degradation. Upon proteolytic cleavage, these markers expose either a stabilising amino acid (methionine, Met-GFP) or a destabilising amino acid targeted by the NatB complex (asparagine, Asn-GFP)¹⁰⁰. The absence of methionine in the second reporter replicates a lack of N-terminal acetylation. The results demonstrated that the Met-GFP reporter protein produces a strong signal in the male germline (Fig. S6c), while the Asn-GFP marker is weak (Fig. S6c) and requires dUBR1 knockdown for stabilisation (Fig. S6d). Combined together, these data indicate that the only biological role of NatB-mediated Nt acetylation is shielding a key fraction of spermatid proteome from proteasomal degradation by the specific ubiquitin ligase, dUBR1. The data further suggest that Nt acetylation is a critical mechanism that couples the dynamics of sperm production with the male metabolic state.

Finally, we asked whether the regulatory pathway we discovered was active in other cellular contexts. We first asked whether this pathway is also required in the somatic gonad. We reduced the expression of all components of the pathway in the somatic part of the testes (using traffic jam-Gal4 (tj-Gal4) to downregulated dACLY, dNAA20, and dNAA25 expression in somatic gonadal cells¹⁰¹) (Fig. S6e). None of these genetic manipulations affected male fertility, indicating that activity of this metabolic signalling pathway in the somatic cells of the male gonad is dispensable for male fertility. We then asked whether this pathway may also explain the lethality caused by global loss of dNAA20. However, we found that inactivation of dUBR1 in all the somatic tissues outside the gonad could not rescue the developmental lethality caused by the global knockdown of dNAA20 (Fig. S6f), suggesting that another molecular mechanism is also at play. Lastly, we asked whether this pathway may also regulate female fertility. We found that silencing of dACLY, dNAA20, or dNAA25 in the female germline (Fig. S6g) had no effect on female fertility.

Altogether, our results indicate that Nt protein acetylation plays a critical role in controlling proteome stability and differentiation in a sex- and cell-type-specific manner.

Discussion

Together, our data reveal a regulatory cascade whereby circulating citrate, which is imported into the male germline by citrate transporters, is cleaved by dACLY into Acetyl-CoA. The cytosolic Acetyl-CoA supports NatB-mediated Nt-protein acetylation. The imprinting of a fraction of the male germline proteome by acetylation controls the stability of key target proteins, essential for spermatid individualisation. This unique pathway of cellular proteostasis couples sperm production and male fertility with the internal metabolic state. At least two aspects of this metabolic regulation are remarkable: its specificity and the signals involved.

Previous work has provided conflicting evidence regarding the role of Nt acetylation in the regulation of protein stability. Our data show that this function of Nt acetylation in regulating protein degradation is stage-, cell type-, and sex-specific, being essential during late spermatogenesis, but dispensable in germline stem cells, the somatic part of the male sex organs and in the female germline. Moreover, the role of Nt acetylation during spermatogenesis is encoded exclusively by NatB. Indeed, NatA¹⁰², NatC (Fig. 3), and NatE^103,104 catalytic subunits are dispensable in the male germline. Even in the somatic tissues outside the gonads, where NatB is essential during development, a different molecular mechanism appears to be in place. Thus, the function of Nat enzymes is cell and tissue-specific.

These results raise another question: how can a ubiquitous enzyme, like NatB, nevertheless control the differentiation of the male germline using a unique mechanism? The context-dependent function of NatB-mediated Nt protein acetylation could be determined by testis-specific factors. Interestingly, the three transmembrane citrate transporters, Indy-2, CG7309, and CG33934, are not only expressed exclusively in the male germline but are restricted to the late steps of spermatogenesis (Fig. S6h). dNAA20 expression is also enriched at these stages, suggesting that these restricted expression patterns could underlie the specific requirement of Nt protein acetylation for spermatid individuation during germline differentiation.

Our results, looking at the stability of a set of NatB targets (Fig. S6i), combined with the restricted phenotype of NatB loss-of-function, indicate that this proteostasis pathway likely controls a relatively small fraction of the proteome. The specific substrates of NatB in male germ cells remain to be identified and may well include testis-specific targets. Given that, at this time, Nt protein acetylation can only be detected by mass-spectrometry, cell type-specific analyses of differentiating fly male germline are challenging. Furthermore, full characterisation of this pathway may require further analysis of the degradative apparatus downstream of NatB. As with other UBR family members¹⁰⁵, the dUBR1 interaction with E2 ubiquitin-conjugating enzymes may depend on an additional specific E3 ubiquitin ligase factor, perhaps one of numerous uncharacterised E3 ligases presenting testis-specific expression^106,107. A unique male germline-specific dUBR1-E3 protein complex could target the key unacetylated NatB substrates for degradation, and may provide another level of specificity.

Our data also provide further support for the idea that circulating citrate, a metabolite best known for its roles in mitochondria as a TCA cycle intermediate, can have systemic effects outside producing cells. Indeed, our experiments show clearly that the TCA cycle is dispensable for sperm differentiation in flies and that the germline depends on external citrate import for differentiation. Similarly, in mammals, somatic Sertoli cells also act as a paracrine source of metabolites for the developing gametes^108,109. Furthermore, citrate is found in human blood at high levels, but very little is known about its role as a signal across organs.

Citrate signalling may also exhibit context-dependent specificity. We have previously shown that carbohydrate handling is male-biased in a specific portion of the fly adult intestine and triggers citrate secretion specifically in males¹³. Interestingly, the reduction of gut-derived citrate production results in a significant decrease in individualising spermatids¹³, mirroring, the phenotype obtained by NatB or citrate transporters (Fig. S6j) germline-specific loss-of-functions. But this manipulation does not sterilise males, suggesting that other organs contribute to the circulating citrate pool.

The biological significance of metabolite shuttling has been recognized since the discovery of the Cori cycle¹¹⁰. However, our findings that intestinal-produced citrate is taken up by testes cells extend this notion to another metabolite and organs. The instructive role of citrate in inter-organ communication may well extend to other biological contexts. Indeed, a recently-published atlas of inter-organ metabolite exchange in pigs, shows that the kidney specifically uptakes circulating TCA cycle intermediates, the most abundant of which is citrate⁶. Further work will be needed to determine the physiological role of this exchange.

Nt acetylation is one of the most common, but least understood post-translational modifications of eukaryotic proteins. In animals, its biological roles remain a mostly unexplored territory. In yeast, some NatB targets have been identified and characterised^111,112. For example, NatB-mediated Nt acetylation of Tropomyosin1p (Tpm1p) is required for Tpm1p association with actin filaments^113,114. However, until now, studies examining the role of acetylation during sperm production have been limited to internal lysine acetylation¹¹⁵. To our knowledge, our work provides the first evidence of the functional importance of Nt acetylation for spermatogenesis and reproduction.

Could the role of Nt protein acetylation during male gametogenesis be conserved in mammals? Interestingly, the human hACLY (Fig. S6l and S66k) and hNAA20 (Fig. S6m–p) orthologs could rescue the loss of the corresponding fly proteins, suggesting a potential functional conservation of this pathway during evolution. Moreover, active novel retrogenes of NAT catalytic subunits are predominantly expressed in the mouse¹¹⁶ and human testes¹¹⁷ and the mouse citrate transporter homolog is also specifically expressed in the testis, the liver, and the brain¹¹⁸. A recent report identified pathogenic hNAA20 variants causing human diseases¹¹⁹. However, pleiotropic developmental defects could preclude the detection of male infertility, and tissue-specific analyses in rodents would be required to directly test the role of the mammalian NAA20 in sperm differentiation.

Our findings reveal that Nt-protein acetylation regulates male germline stem cell differentiation through proteome turnover (Fig. S7). The notion that Nt acetylation confers stability at the proteome level has been challenged recently. For example, Kats and colleagues tested the effect of all possible N-terminal di-residue combinations on the stability of a reporter protein in yeast⁹⁰. From the 400 possible reporters only 10 were destabilised in NatB mutants, suggesting that, globally, Nt acetylation rarely controls protein abundance and turnover. Proteomic studies in yeast and human cells yielded similar results^91,92,120. By contrast, our data identify a cell type, where NatB-mediated Nt acetylation shields key proteins from proteasomal degradation by the specific ubiquitin ligase, dUBR1. In this biological context, this is clearly the only essential function of the Nt protein acetylation. Indeed, inhibition of protein degradation fully rescues the defects in germline differentiation caused by the loss of NatB activity.

The regulatory mechanism we discovered may play an important role in sustaining germline homeostasis under fluctuating environmental conditions. In this regard, it would be interesting to extend our study to conditions of metabolic imbalance, like dietary restriction. In plants, Nt acetylation has been studied more extensively and is known to play a critical role in stress responses. For example, it is required for pathogen tolerance¹²¹, adaptation to osmotic stress⁸⁹ in Arabidopsis thaliana, and drought tolerance^122,123. In Drosophila, gametogenesis is highly sensitive to the availability of dietary amino acids^9,10,11,12. It would be of interest to investigate if a stress-mediated down-regulation of Acetyl-CoA, the co-substrate of NatB, affects both the efficacy of Nt acetylation and germline proteome turn-over.

Thus far, studies examining the influence of cell metabolism on cell fate have focused mainly on metabolic-dependent epigenetic changes affecting the transcriptome. Indeed, recent studies provide compelling evidence that changes in Acetyl-CoA production can impact transcriptional programs through histone acetylation^{49,50,51,52,53,54,55,56,57}. Changes in cellular proteome stability due to metabolic shifts, encoded in post-translational modifications, could be a more direct and adaptable molecular mechanism for adjusting cell differentiation based on environmental conditions. Interestingly, the NatB complex displays a relatively low affinity to Acetyl-CoA, compared to HATs, with a Michaelis constant (Km) that is 50 times greater. This difference in Km values is a potential regulatory factor that could explain why, during spermatogenesis, genetically induced alterations in intracellular Acetyl-CoA level affect NatB function before impacting HAT activities. Therefore, metabolic regulation through Acetyl-CoA level alterations could signal primarily through modulation of Nt acetylation to modify protein and cell functions, a hypothesis that awaits further exploration.

Methods

Reagents

See Table 1 for details of antibodies, experimental organisms, oligonucleotides, software and algorithms

Table 1 Reagents and resources

Full size table

Fly strains and media

Reporters: Mapmodulin^GFP (BDSC: 51556, FlyBase ID: FBti0099819), Ncd^GFP (BDSC: 60738, FlyBase ID: FBti0167130), Sm^GFP (BDSC: 59815, FlyBase ID: FBti0178480), Dj^GFP (BDSC: 5417, FlyBase ID: FBti0013334), ProtA^GFP (gift from B. Loppin B, FlyBase ID: FBtp0023347), Gish^GFP (BDSC: 59025, FlyBase ID: FBti0100581), Hfp^GFP (VDRC: 318711, FlyBase ID: FBti0198685), Rbp4^GFP (VDRC: 318563, FlyBase ID: FBti0198610), Orb2^GFP (VDRC: 318058, FlyBase ID: FBti0198927), Loopin-1^GFP (gift from R. Sinka, generated by¹²⁴), Dany^GFP (BDSC: 91773, FlyBase ID: FBti0183120), CG3927^GFP (VDRC: 318780, FlyBase ID: FBti0198743), CG14718^GFP (VDRC: 318741, FlyBase ID: FBti0198842), Mis12^GFP (BDSC: 91741, FlyBase ID: FBti0214004), Vsg^GFP (BDSC: 50812, FlyBase ID: FBti0099949), Taf1^GFP (BDSC: 64451, FlyBase ID: FBti0181874), Mxc^GFP (BDSC: 84130, FlyBase ID: FBti0207696), Mge^GFP (VDRC: 318174, FlyBase ID: FBti0198764), CG7430^GFP (VDRC: 318906), Spd-2^GFP (VDRC: 318743, FlyBase ID: FBti0198658), CG13426^GFP (VDRC: 318517, FlyBase ID: FBti0198425), Tango5^GFP (VDRC: 318337, FlyBase ID: FBti0198537), Vib^GFP (BDSC: 51531, FlyBase ID: FBti0099947), CG2774^GFP (VDRC: 318605, FlyBase ID: FBti0198336), CG5174^GFP (BDSC: 50819, FlyBase ID: FBti0099757), Cullin 3^3xHA (this study, see below for details), Klp10A^GFP (BDSC: 57329, FlyBase ID: FBti0162455), Cdc42^GFP (VDRC: 318151, FlyBase ID: FBti0198614), Vps26^GFP (BDSC: 67153, FlyBase ID: FBti0181540).

Gal4 drivers: bam-Gal4 (gift from M. Amoyel, FlyBase ID: FBtp0111994), nanos-Gal4 (BDSC: 32563, FlyBase ID: FBtp0001612), topi-Gal4 (BDSC: 91776, FlyBase ID: FBti0213638), tj^NP1624-Gal4 (DGGR: 104055, FlyBase ID: FBti0034540), TubP-Gal4 (BDSC: 30030, FlyBase ID: FBti0012687).

UAS transgenes: UASt-CG7309 (this study, see below for details), UASp-dACLY (this study, see below for details), UASp-dACLY^H772>A (this study, see below for details), UASp-dACLY^R380>A (this study, see below for details), UASp-dACLY^D1038>A (this study, see below for details), UASt-hACLY (BDSC: 65837, FlyBase ID: FBti0183265), UASp-dNAA25 (this study, see below for details), UASt-dNAA20 (this study, see below for details), UASp-dNAA20 (this study, see below for details), UASp-dNAA20^ERY (this study, see below for details), UASp-dNAA20^H (this study, see below for details), UASp-dNAA20^RG (this study, see below for details), UASp-dNAA20^FN (this study, see below for details), UASp-hNAA20 (this study, see below for details), UASp-CG31851 (this study, see below for details), UASp-CG31730^3xHA (this study, see below for details), UAS-Flp (BDSC: 4539, FlyBase ID: FBti0012284), UAS-dicer2 (VDRC#60010), UASp-CG14740^3xHA (this study, see below for details), UASt-Met.GFP (gift from Christian Klämbt, FlyBase ID: FBti0200441), UASt-Asn.GFP (gift from Christian Klämbt, FlyBase ID: FBti0200442), UASp-Citron (this study, see below for details).

RNAi transgenes: UAS-dCS^RNAi (BDSC: 36740, FlyBase ID: FBti0146753), UAS-dCS^RNAi (VDRC: 107642, FlyBase ID: FBti0120690), UAS-dCS^RNAi (VDRC: 26301, FlyBase ID: FBti0080130), UAS-CG14740^RNAi (BDSC: 60900, FlyBase ID: FBti0179283), UAS-CG14740^RNAi (BDSC: 31563, FlyBase ID: FBti0130599), UAS-mAcon1^RNAi (BDSC: 34028, FlyBase ID: FBti0140697), UAS-mAcon1^RNAi (VDRC: 103809, FlyBase ID: FBti0116727), UAS-mAcon2^RNAi (BDSC: 58074, FlyBase ID: FBti0164392), UAS-Irp-1B^RNAi (BDSC: 67939, FlyBase ID: FBti0186731), UAS-Irp-1B^RNAi (VDRC: 110637, FlyBase ID: FBti0142187), UAS-Irp-1A^RNAi (BDSC: 58117, FlyBase ID: FBti0164459), UAS-Irp-1A^RNAi (VDRC: 330238, FlyBase ID: FBti0185955), UAS-Idh^RNAi (BDSC: 41708, FlyBase ID: FBti0149904), UAS-Idh^RNAi (VDRC: 100554, FlyBase ID: FBti0120466), UAS-Idh3a^RNAi (VDRC: 106091, FlyBase ID: FBti0120806), UAS-Idh3b^RNAi (BDSC: 44475, FlyBase ID: FBti0157339), UAS-CG32026^RNAi (BDSC: 53953, FlyBase ID: FBti0158340), UAS-CG3483^RNAi (VDRC: 101958, FlyBase ID: FBti0122320), UAS-CG5028^RNAi (VDRC: 103834, FlyBase ID: FBti0117637), UAS-Nc73EF^RNAi (BDSC: 33686, FlyBase ID: FBti0140273), UAS-CG33791^RNAi (BDSC: 34101, FlyBase ID: FBti0140705), UAS-CG5214^RNAi (BDSC: 50650, FlyBase ID: FBti0157507), UAS-ScsβG^RNAi (BDSC: 50939, FlyBase ID: FBti0158111), UAS-ScsβG^RNAi (VDRC: 101554, FlyBase ID: FBti0121565), UAS-Scsα1^RNAi (VDRC: 107164, FlyBase ID: FBti0117489), UAS-ScsβA^RNAi (BDSC: 55168, FlyBase ID: FBti0159380), UAS-ScsβA^RNAi (VDRC: 105350, FlyBase ID: FBti0116796), UAS-Scsα2^RNAi (BDSC: 64025, FlyBase ID: FBti0180460), UAS-SdhD^RNAi (BDSC: 65040, FlyBase ID: FBti0184127), UAS-SdhD^RNAi (VDRC: 101739, FlyBase ID: FBti0121002), UAS-SdhA^RNAi (VDRC: 110440, FlyBase ID: FBti0141572), UAS-SdhA^RNAi (VDRC: 330053, FlyBase ID: FBti0185706), UAS-SdhC^RNAi (BDSC: 53281, FlyBase ID: FBti0157889), UAS-SdhC^RNAi (VDRC: 330697, FlyBase ID: FBti0202510), UAS-SdhBL^RNAi (BDSC: 58100, FlyBase ID: FBti0164431), UAS-CG6629^RNAi (VDRC: 106108, FlyBase ID: FBti0122779), UAS-Fum1^RNAi (BDSC: 51779, FlyBase ID: FBti0157741), UAS-Fum1^RNAi (VDRC: 105680, FlyBase ID: FBti0120862), UAS-Fum2^RNAi (BDSC: 77156, FlyBase ID: FBti0196089), UAS-Fum2^RNAi (VDRC: 106419, FlyBase ID: FBti0123418), UAS-Fum3^RNAi (BDSC: 67379, FlyBase ID: FBti0185631), UAS-Fum3^RNAi (VDRC: 103522, FlyBase ID: FBti0123817), UAS-Fum4^RNAi (BDSC: 65195, FlyBase ID: FBti0184282), UAS-Fum4^RNAi (VDRC: 103989, FlyBase ID: FBti0122623), UAS-Mdh1^RNAi (VDRC: 110604, FlyBase ID: FBti0142298), UAS-Mdh2^RNAi (BDSC: 36606, FlyBase ID: FBti0146482), UAS-Mdh2^RNAi (BDSC: 62230, FlyBase ID: FBti0179012), UAS-Mdh2^RNAi (VDRC: 101551, FlyBase ID: FBti0121546), UAS-CG10748^RNAi (BDSC: 62228, FlyBase ID: FBti0179010), UAS-CG10749^RNAi (BDSC: 62229, FlyBase ID: FBti0179011), UAS-dACC^RNAi (VDRC: 8105, FlyBase ID: FBti0090448), UAS-dFASN1^RNAi (BDSC: 28930, FlyBase ID: FBti0127757), UAS-dFASN2^RNAi (VDRC: 105855, FlyBase ID: FBti0119829), UAS-dFASN3^RNAi (BDSC: 63026, FlyBase ID: FBti0180103), UAS-beg^RNAi (VDRC: 108556, FlyBase ID: FBti0116633), UAS-CG12170^RNAi (BDSC: 40867, FlyBase ID: FBti0149775), UAS-CG3603^RNAi (VDRC: 107046, FlyBase ID: FBti0117232), UAS-CG16935^RNAi (BDSC: 36671, FlyBase ID: FBti0146682), UAS-CG16935^RNAi (BDSC: 43297, FlyBase ID: FBti0151309), UAS-yip2^RNAi (BDSC: 36874, FlyBase ID: FBti0146565), UAS-yip2^RNAi (VDRC: 26562, FlyBase ID: FBti0080546), UAS-Mtpα^RNAi (BDSC: 32873, FlyBase ID: FBti0140375), UAS-Echs1^RNAi (BDSC: 62221, FlyBase ID: FBti0179003), UAS-Ppt1^RNAi (BDSC: 62291, FlyBase ID: FBti0179684), UAS-Ppt2^RNAi (BDSC: 28362, FlyBase ID: FBti0127136), UAS-Elo68beta^RNAi (BDSC: 50646, FlyBase ID: FBti0157502), UAS-CG17821^RNAi (BDSC: 50898, FlyBase ID: FBti0157389), UAS-Elo68alpha^RNAi (BDSC: 53307, FlyBase ID: FBti0157915), UAS-CG18609^RNAi (BDSC: 44510, FlyBase ID: FBti0157416), UAS-Mtpβ^RNAi (BDSC: 34546, FlyBase ID: FBti0140715), UAS-Hat1^RNAi (BDSC: 42488, FlyBase ID: FBti0150967), UAS-CG1894^RNAi (BDSC: 34925, FlyBase ID: FBti0144900), UAS-Ing3^RNAi (VDRC: 109799, FlyBase ID: FBti0142087), UAS-Ing5^RNAi (VDRC: 102002, FlyBase ID: FBti0121514), UAS-pont^RNAi (BDSC: 50972, FlyBase ID: FBti0158154), UAS-Eaf6^RNAi (BDSC: 50518, FlyBase ID: FBti0157168), UAS-e(y)3^RNAi (BDSC: 32346, FlyBase ID: FBti0132041), UAS-d4^RNAi (BDSC: 43186, FlyBase ID: FBti0150869), UAS-Ada2b^RNAi (BDSC: 35334, FlyBase ID: FBti0144328), UAS-dTat^RNAi (BDSC: 28777, FlyBase ID: FBti0127341), UAS-CG17003^RNAi (VDRC: 101273, FlyBase ID: FBti0119276), UAS-dNAA20^shRNA (BDSC: 36899, FlyBase ID: FBti0146623), UAS-dNAA20^RNAi (VDRC: 109664, FlyBase ID: FBti0141766), UAS-dNAA25^RNAi (VDRC: 21960, FlyBase ID: FBti0080678), UAS-dNAA25^RNAi (VDRC: 103558, FlyBase ID: FBti0116761), UAS-CG31851^RNAi (VDRC: 104306, FlyBase ID: FBti0120394), UAS-CG31730^RNAi (VDRC: 104274, FlyBase ID: FBti0119985), UAS-CG31730^RNAi (VDRC: 21408, FlyBase ID: FBti0079042), UAS-CG31730^shRNA (BDSC: 42848, FlyBase ID: FBti0151179), UAS-dNAA30^RNAi (VDRC: 101769, FlyBase ID: FBti0121882), UAS-dNAA35^RNAi (VDRC: 109595, FlyBase ID: FBti0141310), UAS-dNAA38^RNAi (VDRC: 34750, FlyBase ID: FBti0080192), UAS-CG32319^RNAi (VDRC: 24728, FlyBase ID: FBti0079776), UAS-CG10932^RNAi (BDSC: 51785, FlyBase ID: FBti0157747), UAS-CG9149^RNAi (BDSC: 56858, FlyBase ID: FBti0163209), UAS-CG9149^RNAi (BDSC: 67208, FlyBase ID: FBti0185454), UAS-Hmgs^RNAi (BDSC: 57738, FlyBase ID: FBti0164187), UAS-Hmgcl^RNAi (BDSC: 51861, FlyBase ID: FBti0157828), UAS-SCOT^RNAi (BDSC: 51899, FlyBase ID: FBti0157866), UAS-sro^RNAi (BDSC: 67767, FlyBase ID: FBti0186784), UAS-CG13377^RNAi (BDSC: 65215, FlyBase ID: FBti0184141), UAS-dACLY^shRNA (BDSC: 65175, FlyBase ID: FBti0184262), UAS-dACLY^RNAi (VDRC: 30282, FlyBase ID: FBti0090534), UAS-CG33934^RNAi (VDRC: 50700, FlyBase ID: FBti0087972), UAS-CG33934^RNAi (VDRC: 50699, FlyBase ID: FBti0087971), UAS-CG33934^shRNA (BDSC: 44093, FlyBase ID: FBti0158694), UAS-Indy-2^shRNA (BDSC: 34891, FlyBase ID: FBti0144864), UAS-Indy-2^RNAi (VDRC: 51048, FlyBase ID: FBti0159828), UAS-Indy-2^RNAi (VDRC: 50694, FlyBase ID: FBti0087970), UAS-CG7309^RNAi (VDRC: 100142, FlyBase ID: FBti0118895), UAS-dCIC/sea^shRNA (BDSC: 34685, FlyBase ID: FBti0140854), UAS-dCIC/sea^shRNA (BDSC: 33976, FlyBase ID: FBti0140637), UAS-dUBR1^RNAi (BDSC: 31374, FlyBase ID: FBti0130788), UAS-dUBR1^RNAi (VDRC: 108902, FlyBase ID: FBti0160098), UAS-Pdha^RNAi (BDSC: 55345, FlyBase ID: FBti0159564), UAS-AcCoAS^RNAi (BDSC: 41917, FlyBase ID: FBti0149942), UAS-Acat1^RNAi (BDSC: 51785, FlyBase ID: FBti0157747), UAS-Acat2^RNAi (BDSC: 56858, FlyBase ID: FBti0163209), UAS-dUBR4^shRNA (BDSC: 32945, FlyBase ID: FBti0140453), UAS-dUBR5^shRNA (BDSC: 32352, FlyBase ID: FBti0132047).

Mutants: CG31851^KO (this study, see below for details), CG31851^3xHA,KI (this study, see below for details), dNAA20^KO (this study, see below for details), dNAA20^{FLAG KI} (this study, see below for details), dNAA20^FRT (this study, see below for details), CG14740^KO (this study, see below for details), Df(2 L)BSC768 (CG31851 deficiency, BDSC: 26865, FlyBase ID: FBab0045835), Df(3 R)Exel7312 (CG14740 deficiency, BDSC: 7966, FlyBase ID: FBab0038304), topi > dACLY^3xHA (this study, see below for details), topi > dNAA25^3xHA (this study, see below for details), topi > dNAA20 (this study, see below for details).

Animals were reared on fly food containing (per liter): 10 g of agar, 83 g corn flour, 60 g white sugar, 34 g dry yeast and 3,75 g Moldex (per liter, diluted in ethanol). All experimental flies were kept in incubators at 25 °C or 29 °C, and on a 12 hr light/dark cycle. Flies were transferred to fresh vials every 3 days, and fly density was kept to a maximum of 15 flies per vial. For testes immunostainings, adult males were aged for 5 days before dissection. For fatty acids feeding, flies were raised on normal fly food supplemented with 0.5% oleic and arachidonic acids.

Fertility tests

For fertility experiments, males were collected and aged for 3 days. They were then mated over five days to CantonS females (1 male with 5 females per vial). Flies were then removed and progeny was counted.

Generation of the CG14740 CRISPR null mutant

To generate a CG14740 null mutant, two gRNAs targeting the CG14740 coding sequence (gRNA 1: AGTGTTAATAGCGTGATTGGAGG, and gRNA 2: CTTATATTCCAGGTCATTCCCGG) were cloned into the pCFD5 vector (Addgene: Plasmid #73914, generated by ref. ¹²⁵). A 1.104 kb homology arm flanking the cleavage site 1 was PCR-amplified from genomic DNA using the Q5 high-fidelity polymerase from New England Biolabs (M0491S) and the following primers: 5’-AAAAGCTAGCTGGACAAAATCAGAACGGCA-3’ and 5’-AAAACCGCGGATCACGCTATTAACACTGATC-3’. The PCR product was digested with NheI and SacII prior to cloning into the pDsRedattP vector (Addgene: Plasmid #51019, generated by¹²⁶). A 1.186 kb homology arm flanking the cleavage site 2 was PCR-amplified from genomic DNA using the following primers: 5’-AAAACCTAGGTCCCGGCTACGGACACGCTG-3’and 5’-AAAACTCGAGACATGGAAGTGGAAAGGGGT-3’. The PCR product was digested with AvrII and XhoI prior to cloning into the pDsRedattP vector, containing the first homology arm. The constructs were sequence-verified and a mutant line was established through injection (Bestgene) of the 2 generated vectors (pCFD5 gRNAs and pDsRedattP homology arms) in yw;nos-Cas9 (FlyBase ID: FBti0156858, generated by¹²⁷) embryos. The generated deletion removed 1016 nucleotides (nt) of the CG14740 coding sequence and replaced it with an attP landing site and a loxP-flanked 3xP3-DsRed marker.

Generation of the dNAA20 CRISPR null mutant

To generate a dNAA20 null mutant, two gRNAs targeting the dNAA20 coding sequence (gRNA 1: AAGTGGGTCAAAGTTTCTGGCGG, and gRNA 2: GAAATAATGCACGCAAATACTGG) were cloned into the pCFD5 vector. A 0.962 kb homology arm flanking the cleavage site 1, and a 0.837 homology arm flanking the cleavage site 2 were cloned by gene synthesis (Genscript) into the pDsRedattP vector using the EcoRI, XhoI restriction sites. A mutant line was established through injection (Bestgene) of the 2 generated vectors (pCFD5 gRNAs and pDsRedattP homology arms) in yw;nos-Cas9 embryos. The generated deletion removed 1624 nt of the dNAA20 coding sequence and replaced it with an attP landing site and a loxP-flanked 3xP3-DsRed marker.

Generation of the double CG31851, CG31730 CRISPR null mutant

To generate a double CG31851, CG31730 null mutant, two gRNAs targeting the CG31851, and CG31730 coding sequences (gRNA 1: CGGAGAAGTCATGACTCGCTGGG, and gRNA 2: TATCCCATGGGTCTGCCATCAGG) were cloned into the pCFD5 vector. A 1.387 kb homology arm flanking the cleavage site 1 was PCR-amplified from genomic DNA using the Q5 high-fidelity polymerase and the following primers: 5’-AAAAGCTAGCCCACTAGGCGACCCACTTAT-3’and 5’-AAAACCGCGGGCTGGGATATAATAGGAATT-3’. The PCR product was digested with NheI and SacII prior to cloning into the pDsRedattP vector. A 1.150 kb homology arm flanking the cleavage site 2 was PCR-amplified from genomic DNA using the following primers: 5’-AAAACCTAGGATCAGGACCTGGAGCTATGGCAATC-3’and 5’-AAAACTCGAGCCACATCTCACACTTGGC-3’. The PCR product was digested with AvrII and XhoI prior to cloning into the pDsRedattP vector, containing the first homology arm. The constructs were sequence-verified and a mutant line was established through injection (Bestgene) of the 2 generated vectors (pCFD5 gRNAs and pDsRedattP homology arms) in yw;nos-Cas9 embryos. The generated deletion removed 1805 nt including the entire CG31851coding sequence and most of the CG31730 coding sequence and replaced it with an attP landing site and a loxP-flanked 3xP3-DsRed marker.

Generation of the excisable FRT-flanked dNAA20 knock-in allele

To generate an excisable FRT-flanked dNAA20 knock-in allele, the dNAA20 locus (1897 nt, sequences comprised between MKP-4 and CG14221 genes) was cloned into the RIV FRTnMCS1FRT white vector (DGRC: Plasmid#1333) using the EcoRI and AscI restriction sites. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the amorphic allele of dNAA20 generated by CRISPR-Cas9, in which dNAA20 locus has been replaced by an attP site. The generated allele rescue dNAA20 null mutant phenotypes (viability and fertility).

Generation of the excisable FRT-flanked FLAG-tagged dNAA20 knock-in allele

To generate an excisable FRT-flanked FLAG-tagged dNAA20 knock-in allele, the dNAA20 locus (1897 nt, sequences comprised between MKP-4 and CG14221 genes) was cloned into the RIV FRTnMCS1FRT white vector (DGRC: Plasmid#1333) using the EcoRI and AscI restriction sites by gene synthesis (Genescript). A 3xFLAG tag was added before the stop codon. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the amorphic allele of dNAA20 generated by CRISPR-Cas9, in which dNAA20 locus has been replaced by an attP site. The generated allele rescue dNAA20 null mutant phenotypes (viability and fertility).

Generation of the excisable FRT-flanked HA-tagged CG31851 knock-in allele

To generate an excisable FRT-flanked FLAG-tagged CG31851 knock-in allele, the CG31851 locus (1842 nt, sequences comprised between l(2)k05911 and CG31730 genes) was cloned into the RIV FRTnMCS1FRT white vector (DGRC: Plasmid#1333) using the EcoRI and XhoI restriction sites by gene synthesis (Genescript). A 3xHA tag was added before the stop codon. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the amorphic allele of CG31851 generated by CRISPR-Cas9, in which CG31851, CG31730 locus has been replaced by an attP site.

Generation of the UASp-dACLY ^3xHA lines

To generate a wild type UASp-dACLY line, dACLY cDNA (FlyBase ID: FBpp0289823) was cloned by gene synthesis (Genscript) into the pUASp vector (DGRC: Plasmid#1189) between the EagI and XbaI restrictions sites. A 3xHA tag was added before the stop codon and the sequence targeted by dACLY shRNA (BDSC: 65175) was mutated to make the UAS line resistant to the shRNA (CACGACCTATGTAGACCTGTA > TACAACGTACGTGGATTTATA, 8 mutations introduced without affecting the dACLY protein sequence). UAS lines were established through injection (Bestgene) using classical P-element mediated transformation. For the dACLY variants (H772 > A, R380 > A, and D1038 > A) mutations were introduced by gene synthesis (Genscript).

Generation of the topi > dACLY ^3xHA line

To generate a wild type topi > dACLY line, topi promoter (1412 nt upstream of the start codon) was PCR amplified from genomic DNA, and cloned into the pUASp-dACLY vector between the AgeI and EagI restrictions sites. The construct was sequence-verified and a fly line was established through injection (Bestgene) using classical P-element mediated transformation.

Generation of the UASp-dNAA25 ^3xHA lines

To generate a wild type UASp-dNAA25 line, dNAA25 cDNA (FlyBase ID: FBcl0045079) was cloned by gene synthesis (Genscript) into the pUASp vector (DGRC: Plasmid#1189) between the KpnI and PspXI restrictions sites. A 3xHA tag was added before the stop codon. UAS lines were established through injection (Bestgene) using classical P-element mediated transformation.

Generation of the topi > dNAA25 ^3xHA line

To generate a wild type topi > dNAA25 line, topi promoter (1412 nucleotides upstream of the start codon) was PCR amplified from genomic DNA, and cloned into the pUASp-dNAA25 vector digested by KpnI. The construct was sequence-verified and a fly line was established through injection (Bestgene) using classical P- element mediated transformation.

Generation of the UASp-dNAA20 lines

To generate a wild type UASp-dNAA20 line, dNAA20 cDNA (FlyBase ID: FBpp0074532) was cloned by gene synthesis (Genscript) into the pUASp-attB vector (DGRC: Plasmid#1358) between the EagI and BamHI restrictions sites. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the VK05 (BDSC: 9725, FlyBase ID: FBti0076428) attP site line. For the dNAA20 variants, mutations were introduced by gene synthesis (Genscript).

Generation of the UASt-dNAA20 line

To generate a wild type UASt-dNAA20 line, dNAA20 cDNA (FlyBase ID: FBpp0074532) was subcloned into the pUASt-attB vector (DGRC: Plasmid#1419) digested by XhoI. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the VK05 (BDSC: 9725, FlyBase ID: FBti0076428) attP site line.

Generation of the topi > dNAA20 line

To generate a wild type topi > dNAA20 line, topi promoter (1412 nucleotides upstream of the start codon) was PCR amplified from genomic DNA, and cloned into the pUASp-dNAA20 vector digested by KpnI. The construct was sequence-verified and a fly line was established through injection (Bestgene) using classical P- element mediated transformation.

Generation of the UASp-hNAA20 line

To generate a wild type UASp-hNAA20 line, hNAA20 cDNA was cloned by gene synthesis (Genscript) into the pUASp-attB vector (DGRC: Plasmid#1358) between the KpnI and XbaI restrictions sites. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the VK05 (BDSC: 9725, FlyBase ID: FBti0076428) attP site line.

Generation of the UASp-CG31851 line

To generate a wild type UASp-CG31851 line, CG31851 coding regions (FlyBase ID: FBpp0080033) were cloned by PCR from genomic DNA into the pUASp vector (DGRC: Plasmid#1189) between the KpnI and XbaI restrictions sites. UAS lines were established through injection (Bestgene) using classical P-element mediated transformation.

Generation of the UASp-CG14740 ^3xHA line

To generate a wild type UASp-CG14740 line, CG14740 coding regions (1652 nt, FlyBase ID: FBpp0082025) were cloned by PCR from genomic DNA into the pUASp-attB-3xHA vector (DGRC: Plasmid#1358) between the KpnI and SpeI restrictions sites. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the VK14 (BDSC: 9733, FlyBase ID: FBti0076436) attP site line.

Generation of the UASt-CG7309 line

To generate a wild type UASt-CG7309 line, CG7309 coding regions (1598nt, FlyBase ID: FBpp0290402) were cloned by PCR into the pUASt-attB vector (DGRC: Plasmid#1419) between the EcoRI and NotI restrictions sites. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the VK15 (BDSC: 9736, FlyBase ID: FBti0076439) attP site line.

Generation of the UASp-CG31730 ^3xHA line

To generate a wild type UASp-CG31730 line, CG31730 coding regions (498 nt, FlyBase ID: FBpp0080059) were cloned by PCR from genomic DNA into the pUASp-attB-3xHA vector (DGRC: Plasmid#1358) between the EagI and PspXI restrictions sites. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the VK05 (BDSC: 9725, FlyBase ID: FBti0076428) attP site line.

Generation of the Cullin 3 ^3xHA line

To generate a Cullin 3^3xHA line, Cullin 3 locus (4218 nt containing the testis specific-promoter, the coding regions and the 3’UTR region) were cloned by gene synthesis (Genscript) into the pUASp-attB-3xHA vector (DGRC: Plasmid#1358) between the KpnI, and XbaI restrictions sites. A 3xHA tag was added before the stop codon. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the VK05 (BDSC: 9725, FlyBase ID: FBti0076428) attP site line.

Generation of the UASp-Citron line

To generate a UASp-Citron line, Citron sequences (Addgene: Plasmid #134303, generated by²⁶) was cloned by gene synthesis (Genscript) into the pUASp-attB vector (DGRC: Plasmid#1358) between the KpnI and EagI restrictions sites. The construct was sequence-verified and a transgenic line was established through ΦC-31 integrase mediated transformation (Bestgene), using the using the VK14 (BDSC: 9733, FlyBase ID: FBti0076436) attP site line.

Immunohistochemistry

Testes were dissected, placed on poly-L-lysine (Sigma-Aldrich, P1524-1G) coated slides, fixed in 3.7% formaldehyde (Polyscience) in 1xPBS for 20 min at room temperature (RT) and then washed several times in 1xPBS. The testes were permeabilised with 0.3% sodium deoxycholate in PBSTX (1× PBS, 0.1% Tween 20, 0.3% Triton X-100) during 30 min. After PBSTX washing, the tested were blocked in PBSTX + 4% Horse serum (HS) during at least 1 h at RT. The primary antibodies incubation was performed in PBSTX + HS during 48 h at 4 °C. After several washes, secondary antibodies were incubated 2 h at room temperature. Fluorescent secondary antibodies (488-, 546- and 647-conjugated) were obtained from Jackson Immunoresearch. After DAPI staining (Sigma-Aldrich, D9542-5MG), dissected testes were mounted into Vectashield (Vector Labs). Fluorescence images were acquired using a Leica SP5 DS confocal microscope.

Reverse transcription and quantitative-PCR

RNAs were extracted from 150 adult testes (or from 10 L3 larvae) using TRIzol (Invitrogen). RNAs were cleaned using RNAeasy mini Kit (Qiagen, 74-104). cDNAs were synthesised using the iScript cDNA synthesis kit (Bio-Rad, 170-8889) from 500 ng of total RNAs. Quantitative PCRs were performed by mixing cDNA samples (5 ng) with iTaq Universal SYBR® Green Supermix (Bio-Rad, 172-5124) and the relevant primers in 384-well plates. Expression abundance was calculated using a standard curve for each gene, and normalised to the expression of the Tub control gene. For data display purposes, the median of the expression abundance was arbitrarily set at 100% for control males, and percentage of that expression is displayed for all the tested genotypes. qPCR primer pairs used are listed in Table S3.

Proteins extraction and western blotting

150 testes were dissected in 1× PBS solution and pooled per sample. Proteins were extracted with the following lysis solution: 6 M Urea, 150 mM NaCl, 50 mM Tris pH8, 1 mM EDTA and 100 mM NEM. After 30 minutes on ice, the samples were sonicated three times during 20 seconds, centrifuged at 13,000 rpm during 10 minutes, and the supernatants were collected.

The sample were then mixed with V/V 2xSDS, 100 mM DTT and heated at 100 °C during 3 min. Protein extracts were loaded on 4–15% Mini-PROTEAN® TGX Stain-Free™ Protein Gels (Biorad), run with Tris/Glycine/SDS buffer and transferred onto nitrocellulose membranes. After blocking, the membranes were incubated with the primary antibodies over night at 4 °C. The corresponding horseradish peroxidase conjugated secondary antibodies were used at 1/1000 dilution and incubated with the membranes during 2 hours at room temperature. Signal detection was performed with Pierce™ ECL Western Blotting Substrate (Thermo Scientific) using Fuji Las 4000 (GE Healthcare).

Statistics and data presentation

All statistical analyses were carried out in GraphPad Prism 7.04. Comparisons between two genotypes and/or conditions were analysed with the Mann–Whitney-Wilcoxon rank sum test. Multiple comparisons between a single control condition and different genotypes were analysed using one-way non-parametric ANOVA. These two non-parametric tests do not require the assumption of normal distributions, so no methods were used to determine whether the data met such assumptions. All graphs were generated using GraphPad Prism 7.04. All confocal and bright field images belonging to the same experiment and displayed together in our figures were acquired using the exact same settings. For visualisation purposes, level, and channel adjustments were applied using ImageJ to the confocal images shown in the figure panels (the same correction was applied to all images belonging to the same experiment), but all quantitative analyses were carried out on unadjusted raw images or maximum projections. In all figures, control datasets are displayed in blue, data related to loss-of-function experiments in green and results related to rescue experiments in red. When significant the differences between the medians of the control and the tested conditions are indicated.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

All data is available in the main text or the supplementary materials. Materials generated for the study are available from the corresponding author on request. Source data are provided with this paper Source data are provided with this paper.

References

Guerra-Carvalho, B. et al. Molecular mechanisms regulating spermatogenesis in vertebrates: environmental, metabolic, and epigenetic factor effects. Anim. Reprod. Sci. 246, 106896 (2022).
Article CAS PubMed Google Scholar
Rabbani, M. et al. Decoding the spermatogenesis program: new insights from transcriptomic analyses. Annu. Rev. Genet. 56, 339–368 (2022).
Article CAS PubMed Google Scholar
Boroughs, L. K. & DeBerardinis, R. J. Metabolic pathways promoting cancer cell survival and growth. Nat. Cell Biol. 17, 351–359 (2015).
Article CAS PubMed PubMed Central Google Scholar
Hui et al. Glucose feeds the TCA cycle via circulating lactate. Nature 551, 115–118 (2017).
Article ADS PubMed PubMed Central Google Scholar
Mills, E. L. et al. Itaconate is an anti-inflammatory metabolite that activates Nrf2 via alkylation of KEAP1. Nature 556, 113–117 (2018).
Article ADS CAS PubMed PubMed Central Google Scholar
Jang, C. et al. Metabolite exchange between mammalian organs quantified in pigs. Cell Metab. 30, 594–606.e3 (2019).
Article CAS PubMed PubMed Central Google Scholar
Rato, L. et al. Metabolic regulation is important for spermatogenesis. Nat. Rev. Urol. 9, 330–338 (2012).
Article CAS PubMed Google Scholar
Hayashi, Y., and Matsui, Y. Metabolic control of germline formation and differentiation in mammals. Sex. Dev. 16, 388–403 (2022).
Drummond-Barbosa, D. & Spradling, A. C. Stem cells and their progeny respond to nutritional changes during Drosophila oogenesis. Dev. Biol. 231, 265–278 (2001).
Article CAS PubMed Google Scholar
McLeod, C. J., Wang, L., Wong, C. & Jones, D. L. Stem cell dynamics in response to nutrient availability. Curr. Biol. 20, 2100–2105 (2010).
Article CAS PubMed PubMed Central Google Scholar
Roth, T. M. et al. Centrosome misorientation mediates slowing of the cell cycle under limited nutrient conditions in Drosophila male germline stem cells. Mol. Biol. Cell 23, 1524–1532 (2012).
Article CAS PubMed PubMed Central Google Scholar
Yang, H. & Yamashita, Y. M. The regulated elimination of transit-amplifying cells preserves tissue homeostasis during protein starvation in Drosophila testis. Dev. Camb. Engl. 142, 1756–1766 (2015).
CAS Google Scholar
Hudry, B. et al. Sex differences in intestinal carbohydrate metabolism promote food intake and sperm maturation. Cell 178, 901–918.e16 (2019).
Article CAS PubMed PubMed Central Google Scholar
Costello, L. C. & Franklin, R. B. Plasma citrate homeostasis: how it is regulated; and its physiological and clinical implications. An important, but neglected, relationship in medicine. HSOA J. Hum. Endocrinol. 1, 005 (2016).
PubMed PubMed Central Google Scholar
Birkenfeld, A. L. et al. Deletion of the mammalian INDY homolog mimics aspects of dietary restriction and protects against adiposity and insulin resistance in mice. Cell Metab. 14, 184–195 (2011).
Article CAS PubMed PubMed Central Google Scholar
Brachs, S. et al. Inhibition of citrate cotransporter Slc13a5/mINDY by RNAi improves hepatic insulin sensitivity and prevents diet-induced non-alcoholic fatty liver disease in mice. Mol. Metab. 5, 1072–1082 (2016).
Article CAS PubMed PubMed Central Google Scholar
Milosavljevic, S. et al. Untargeted metabolomics of Slc13a5 deficiency reveal critical liver-brain axis for lipid homeostasis. Metabolites 12, 351 (2022).
Article CAS PubMed PubMed Central Google Scholar
Thevenon, J. et al. Mutations in SLC13A5 cause autosomal-recessive epileptic encephalopathy with seizure onset in the first days of life. Am. J. Hum. Genet. 95, 113–120 (2014).
Article CAS PubMed PubMed Central Google Scholar
Henke, C. et al. Disruption of the sodium-dependent citrate transporter SLC13A5 in mice causes alterations in brain citrate levels and neuronal network excitability in the hippocampus. Neurobiol. Dis. 143, 105018 (2020).
Article CAS PubMed Google Scholar
Iacobazzi, V. & Infantino, V. Citrate-new functions for an old metabolite. Biol. Chem. 395, 387–399 (2014).
Article CAS PubMed Google Scholar
Aram, L. et al. A Krebs cycle component limits caspase activation rate through mitochondrial surface restriction of crl activation. Dev. Cell 37, 15–33 (2016).
Article CAS PubMed Google Scholar
Gramates, L. S. et al. Fly Base: a guided tour of highlighted features. Genetics 220, iyac035 (2022).
Article PubMed PubMed Central Google Scholar
Krause, S. A., Overend, G., Dow, J. A. T. & Leader, D. P. FlyAtlas 2 in 2022: enhancements to the Drosophila melanogaster expression atlas. Nucleic Acids Res. 50, D1010–D1015 (2022).
Article CAS PubMed Google Scholar
Carrisi, C. et al. Identification of the Drosophila melanogaster mitochondrial citrate carrier: bacterial expression, reconstitution, functional characterization and developmental distribution. J. Biochem. (Tokyo) 144, 389–392 (2008).
Article CAS PubMed Google Scholar
Morciano, P. et al. A conserved role for the mitochondrial citrate transporter Sea/SLC25A1 in the maintenance of chromosome integrity. Hum. Mol. Genet. 18, 4180–4188 (2009).
Article CAS PubMed Google Scholar
Zhao, Y., Shen, Y., Wen, Y. & Campbell, R. E. High-performance intensiometric direct- and inverse-response genetically encoded biosensors for citrate. ACS Cent. Sci. 6, 1441–1450 (2020).
Article CAS PubMed PubMed Central Google Scholar
Demarco, R. S., Eikenes, Å. H., Haglund, K. & Jones, D. L. Investigating spermatogenesis in Drosophila melanogaster. Methods San Diego Calif. 68, 218–227 (2014).
Article CAS PubMed Google Scholar
Davies, E. L. & Fuller, M. T. Regulation of self-renewal and differentiation in adult stem cell lineages: lessons from the Drosophila male germ line. Cold Spring Harb. Symp. Quant. Biol. 73, 137–145 (2008).
Article CAS PubMed Google Scholar
White-Cooper, H. Molecular mechanisms of gene regulation during Drosophila spermatogenesis. Reprod. Camb. Engl. 139, 11–21 (2010).
Article CAS Google Scholar
Arama, E., Agapite, J. & Steller, H. Caspase activity and a specific cytochrome C are required for sperm differentiation in Drosophila. Dev. Cell 4, 687–697 (2003).
Article CAS PubMed Google Scholar
Huh, J. R. et al. Multiple apoptotic caspase cascades are required in nonapoptotic roles for Drosophila spermatid individualization. PLoS Biol. 2, E15 (2004).
Article PubMed Google Scholar
Santel, A., Winhauer, T., Blümer, N. & Renkawitz-Pohl, R. The Drosophila don juan (dj) gene encodes a novel sperm specific protein component characterized by an unusual domain of a repetitive amino acid motif. Mech. Dev. 64, 19–30 (1997).
Article CAS PubMed Google Scholar
Jayaramaiah Raja, S. & Renkawitz-Pohl, R. Replacement by Drosophila melanogaster protamines and Mst77F of histones during chromatin condensation in late spermatids and role of sesame in the removal of these proteins from the male pronucleus. Mol. Cell. Biol. 25, 6165–6177 (2005).
Article PubMed PubMed Central Google Scholar
Sciambi, C. J., Komma, D. J., Sköld, H. N., Hirose, K. & Endow, S. A. A bidirectional kinesin motor in live Drosophila embryos. Traffic Cph. Den. 6, 1036–1046 (2005).
Article CAS Google Scholar
Buszczak, M. et al. The carnegie protein trap library: a versatile tool for Drosophila developmental studies. Genetics 175, 1505–1531 (2007).
Article CAS PubMed PubMed Central Google Scholar
Schittenhelm, R. B. et al. Spatial organization of a ubiquitous eukaryotic kinetochore protein network in Drosophila chromosomes. Chromosoma 116, 385–402 (2007).
Article CAS PubMed PubMed Central Google Scholar
Nagarkar-Jaiswal, S. et al. A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila. eLife 4, e05338 (2015).
Article PubMed PubMed Central Google Scholar
Sarov, M. et al. A genome-wide resource for the analysis of protein localisation in Drosophila. eLife 5, e12068 (2016).
Article PubMed PubMed Central Google Scholar
Trost, M., Blattner, A. C., Leo, S. & Lehner, C. F. Drosophila dany is essential for transcriptional control and nuclear architecture in spermatocytes. Dev. Camb. Engl. 143, 2664–2676 (2016).
CAS Google Scholar
Barreau, C., Benson, E., Gudmannsdottir, E., Newton, F. & White-Cooper, H. Post-meiotic transcription in Drosophila testes. Dev. Camb. Engl. 135, 1897–1902 (2008).
CAS Google Scholar
Chen, D. & McKearin, D. M. A discrete transcriptional silencer in the bam gene determines asymmetric division of the Drosophila germline stem cell. Dev. Camb. Engl. 130, 1159–1170 (2003).
CAS Google Scholar
Raychaudhuri, N. et al. Transgenerational propagation and quantitative maintenance of paternal centromeres depends on Cid/Cenp-A presence in Drosophila sperm. PLoS Biol. 10, e1001434 (2012).
Article CAS PubMed PubMed Central Google Scholar
Tracey, W. D., Ning, X., Klingler, M., Kramer, S. G. & Gergen, J. P. Quantitative analysis of gene function in the Drosophila embryo. Genetics 154, 273–284 (2000).
Article CAS PubMed PubMed Central Google Scholar
Wei, X., Schultz, K., Bazilevsky, G. A., Vogt, A. & Marmorstein, R. Molecular basis for acetyl-CoA production by ATP-citrate lyase. Nat. Struct. Mol. Biol. 27, 33–41 (2020).
Article CAS PubMed Google Scholar
Verschueren, K. H. G. et al. Structure of ATP citrate lyase and the origin of citrate synthase in the Krebs cycle. Nature 568, 571–575 (2019).
Article ADS CAS PubMed Google Scholar
Wang, Y. et al. The multiple facets of acetyl-CoA metabolism: energetics, biosynthesis, regulation, acylation and inborn errors. Mol. Genet. Metab. 138, 106966 (2023).
Article CAS PubMed Google Scholar
Jankowska-Kulawy, A., Klimaszewska-Łata, J., Gul-Hinc, S., Ronowska, A. & Szutowicz, A. Metabolic and cellular compartments of acetyl-CoA in the healthy and diseased brain. Int. J. Mol. Sci. 23, 10073 (2022).
Article CAS PubMed PubMed Central Google Scholar
Shi, Z. et al. Single-cyst transcriptome analysis of Drosophila male germline stem cell lineage. Dev. Camb. Engl. 147, dev184259 (2020).
CAS Google Scholar
Wellen, K. E. et al. ATP-citrate lyase links cellular metabolism to histone acetylation. Science 324, 1076–1080 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Cai, L., Sutter, B. M., Li, B. & Tu, B. P. Acetyl-CoA induces cell growth and proliferation by promoting the acetylation of histones at growth genes. Mol. Cell 42, 426–437 (2011).
Article CAS PubMed PubMed Central Google Scholar
Cluntun, A. A. et al. The rate of glycolysis quantitatively mediates specific histone acetylation sites. Cancer Metab. 3, 10 (2015).
Article PubMed PubMed Central Google Scholar
Gao, X. et al. Acetate functions as an epigenetic metabolite to promote lipid synthesis under hypoxia. Nat. Commun. 7, 11960 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
McDonnell, E. et al. Lipids reprogram metabolism to become a major carbon source for histone acetylation. Cell Rep. 17, 1463–1472 (2016).
Article CAS PubMed PubMed Central Google Scholar
Mews, P. et al. Acetyl-CoA synthetase regulates histone acetylation and hippocampal memory. Nature 546, 381–386 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Liu, X. et al. Acetate production from glucose and coupling to mitochondrial metabolism in mammals. Cell 175, 502–513.e13 (2018).
Article CAS PubMed PubMed Central Google Scholar
Lee, J. V. et al. Acetyl-CoA promotes glioblastoma cell adhesion and migration through Ca2+-NFAT signaling. Genes Dev. 32, 497–511 (2018).
Article CAS PubMed PubMed Central Google Scholar
Yucel, N. et al. Glucose metabolism drives histone acetylation landscape transitions that dictate muscle stem cell function. Cell Rep. 27, 3939–3955.e6 (2019).
Article CAS PubMed PubMed Central Google Scholar
Chen, Y. et al. mTOR complex-2 stimulates acetyl-CoA and de novo lipogenesis through ATP citrate lyase in HER2/PIK3CA-hyperactive breast cancer. Oncotarget 7, 25224–25240 (2016).
Article PubMed PubMed Central Google Scholar
Covarrubias, A. J. et al. Akt-mTORC1 signaling regulates Acly to integrate metabolic input to control of macrophage activation. eLife 5, e11612 (2016).
Article PubMed PubMed Central Google Scholar
Zhang, C. et al. Cullin3-KLHL25 ubiquitin ligase targets ACLY for degradation to inhibit lipid synthesis and tumor progression. Genes Dev. 30, 1956–1970 (2016).
Article CAS PubMed PubMed Central Google Scholar
Zhao, S. et al. ATP-citrate lyase controls a glucose-to-acetate metabolic switch. Cell Rep. 17, 1037–1052 (2016).
Article CAS PubMed PubMed Central Google Scholar
Kumari, R., Deshmukh, R. S. & Das, S. Caspase-10 inhibits ATP-citrate lyase-mediated metabolic and epigenetic reprogramming to suppress tumorigenesis. Nat. Commun. 10, 4255 (2019).
Article ADS PubMed PubMed Central Google Scholar
Martinez Calejman, C. et al. mTORC2-AKT signaling to ATP-citrate lyase drives brown adipogenesis and de novo lipogenesis. Nat. Commun. 11, 575 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Even, A. et al. ATP-citrate lyase promotes axonal transport across species. Nat. Commun. 12, 5878 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Hochrein, S. M. et al. The glucose transporter GLUT3 controls T helper 17 cell responses through glycolytic-epigenetic reprogramming. Cell Metab. 34, 516–532.e11 (2022).
Article CAS PubMed PubMed Central Google Scholar
Morciano, P. et al. Depletion of ATP-citrate lyase (ATPCL) affects chromosome integrity without altering histone acetylation in drosophila mitotic cells. Front. Physiol. 10, 383 (2019).
Article PubMed PubMed Central Google Scholar
Morciano, P., Di Giorgio, M. L., Tullo, L. & Cenci, G. The organization of the golgi structures during drosophila male meiosis requires the citrate lyase ATPCL. Int. J. Mol. Sci. 22, 5745 (2021).
Article CAS PubMed PubMed Central Google Scholar
Di Giorgio, M. L. et al. The drosophila citrate lyase is required for cell division during spermatogenesis. Cells 9, 206 (2020).
Article PubMed PubMed Central Google Scholar
Awe, S. & Renkawitz-Pohl, R. Histone H4 acetylation is essential to proceed from a histone- to a protamine-based chromatin structure in spermatid nuclei of Drosophila melanogaster. Syst. Biol. Reprod. Med. 56, 44–61 (2010).
Article CAS PubMed Google Scholar
Hundertmark, T., Gärtner, S. M. K., Rathke, C. & Renkawitz-Pohl, R. Nejire/dCBP-mediated histone H3 acetylation during spermatogenesis is essential for male fertility in Drosophila melanogaster. PloS One 13, e0203622 (2018).
Article PubMed PubMed Central Google Scholar
Hiller, M. et al. Testis-specific TAF homologs collaborate to control a tissue-specific transcription program. Dev. Camb. Engl. 131, 5297–5308 (2004).
CAS Google Scholar
Baker, C. C. & Fuller, M. T. Translational control of meiotic cell cycle progression and spermatid differentiation in male germ cells by a novel eIF4G homolog. Dev. Camb. Engl. 134, 2863–2869 (2007).
CAS Google Scholar
Mikhaylova, L. M., Nguyen, K. & Nurminsky, D. I. Analysis of the Drosophila melanogaster testes transcriptome reveals coordinate regulation of paralogous genes. Genetics 179, 305–315 (2008).
Article CAS PubMed PubMed Central Google Scholar
Belote, J. M. & Zhong, L. Duplicated proteasome subunit genes in Drosophila and their roles in spermatogenesis. Heredity 103, 23–31 (2009).
Article CAS PubMed Google Scholar
Ree, R., Varland, S. & Arnesen, T. Spotlight on protein N-terminal acetylation. Exp. Mol. Med. 50, 1–13 (2018).
Article CAS PubMed PubMed Central Google Scholar
Aksnes, H., Ree, R. & Arnesen, T. Co-translational, post-translational, and non-catalytic roles of n-terminal acetyltransferases. Mol. Cell 73, 1097–1114 (2019).
Article CAS PubMed PubMed Central Google Scholar
Goetze, S. et al. Identification and functional characterization of N-terminally acetylated proteins in Drosophila melanogaster. PLoS Biol. 7, e1000236 (2009).
Article PubMed PubMed Central Google Scholar
Hong, H. et al. Molecular basis of substrate specific acetylation by N-terminal acetyltransferase NatB. Struct. Lond. Engl. 1993 25, 641–649.e3 (2017).
CAS Google Scholar
Deng, S., Pan, B., Gottlieb, L., Petersson, E. J. & Marmorstein, R. Molecular basis for N-terminal alpha-synuclein acetylation by human NatB. eLife 9, e57491 (2020).
Article CAS PubMed PubMed Central Google Scholar
Layer, D. et al. Structural basis of Naa20 activity towards a canonical NatB substrate. Commun. Biol. 4, 2 (2021).
Article CAS PubMed PubMed Central Google Scholar
Pourreza, A. et al. Mutagenesis analysis of a conserved region involved in acetyl coenzyme A binding in the aminoglycoside 6’-N-acetyltransferase type Ib encoded by plasmid pJHCMW1. Antimicrob. Agents Chemother. 49, 2979–2982 (2005).
Article CAS PubMed PubMed Central Google Scholar
Rathore, O. S. et al. Absence of N-terminal acetyltransferase diversification during evolution of eukaryotic organisms. Sci. Rep. 6, 21304 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Hwang, C.-S., Shemorry, A. & Varshavsky, A. N-terminal acetylation of cellular proteins creates specific degradation signals. Science 327, 973–977 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Nguyen, K. T., Mun, S.-H., Lee, C.-S. & Hwang, C.-S. Control of protein degradation by N-terminal acetylation and the N-end rule pathway. Exp. Mol. Med. 50, 1–8 (2018).
Article CAS PubMed PubMed Central Google Scholar
Eldeeb, M. A., Fahlman, R. P., Ragheb, M. A. & Esmaili, M. Does N-terminal protein acetylation lead to protein degradation?. BioEssays 41, e1800167 (2019).
Article PubMed Google Scholar
Varshavsky, A. The N-end rule pathway and regulation by proteolysis. Protein Sci. 20, 1298–1345 (2011).
Article CAS PubMed PubMed Central Google Scholar
Park, S.-E. et al. Control of mammalian G protein signaling by N-terminal acetylation and the N-end rule pathway. Science 347, 1249–1252 (2015).
Article ADS CAS PubMed PubMed Central Google Scholar
Oh, J.-H., Hyun, J.-Y. & Varshavsky, A. Control of Hsp90 chaperone and its clients by N-terminal acetylation and the N-end rule pathway. Proc. Natl. Acad. Sci. USA. 114, E4370–E4379 (2017).
Article CAS PubMed PubMed Central Google Scholar
Linster, E. et al. Cotranslational N-degron masking by acetylation promotes proteome stability in plants. Nat. Commun. 13, 810 (2022).
Article ADS CAS PubMed PubMed Central Google Scholar
Kats, I. et al. Mapping degradation signals and pathways in a eukaryotic N-terminome. Mol. Cell 70, 488–501.e5 (2018).
Article CAS PubMed Google Scholar
Friedrich, U. A. et al. Nα-terminal acetylation of proteins by NatA and NatB serves distinct physiological roles in Saccharomyces cerevisiae. Cell Rep. 34, 108711 (2021).
Article CAS PubMed Google Scholar
Gawron, D., Ndah, E., Gevaert, K. & Van Damme, P. Positional proteomics reveals differences in N-terminal proteoform stability. Mol. Syst. Biol. 12, 858 (2016).
Article PubMed PubMed Central Google Scholar
Fujimuro, M., Sawada, H. & Yokosawa, H. Production and characterization of monoclonal antibodies specific to multi-ubiquitin chains of polyubiquitinated proteins. FEBS Lett. 349, 173–180 (1994).
Article CAS PubMed Google Scholar
Bartel, B., Wünning, I. & Varshavsky, A. The recognition component of the N-end rule pathway. EMBO J. 9, 3179–3189 (1990).
Article CAS PubMed PubMed Central Google Scholar
Varshavsky, A. The N-end rule: functions, mysteries, uses. Proc. Natl. Acad. Sci. USA. 93, 12142–12149 (1996).
Article ADS CAS PubMed PubMed Central Google Scholar
Kwon, Y. T. et al. The mouse and human genes encoding the recognition component of the N-end rule pathway. Proc. Natl. Acad. Sci. USA. 95, 7898–7903 (1998).
Article ADS CAS PubMed PubMed Central Google Scholar
Turner, G. C., Du, F. & Varshavsky, A. Peptides accelerate their uptake by activating a ubiquitin-dependent proteolytic pathway. Nature 405, 579–583 (2000).
Article ADS CAS PubMed Google Scholar
Kwon, Y. T., Xia, Z., Davydov, I. V., Lecker, S. H. & Varshavsky, A. Construction and analysis of mouse strains lacking the ubiquitin ligase UBR1 (E3alpha) of the N-end rule pathway. Mol. Cell. Biol. 21, 8007–8021 (2001).
Article CAS PubMed PubMed Central Google Scholar
Kwon, Y. T. et al. Female lethality and apoptosis of spermatocytes in mice lacking the UBR2 ubiquitin ligase of the N-end rule pathway. Mol. Cell. Biol. 23, 8255–8271 (2003).
Article CAS PubMed PubMed Central Google Scholar
Zülbahar, S. et al. Differential expression of Öbek controls ploidy in the Drosophila blood-brain barrier. Dev. Camb. Engl. 145, dev164111 (2018).
Google Scholar
Pancratov, R. et al. The miR-310/13 cluster antagonizes β-catenin function in the regulation of germ and somatic cell differentiation in the Drosophila testis. Dev. Camb. Engl. 140, 2904–2916 (2013).
CAS Google Scholar
Wang, Y. et al. Drosophila variable nurse cells encodes arrest defective 1 (ARD1), the catalytic subunit of the major N-terminal acetyltransferase complex. Dev. Dyn. 239, 2813–2827 (2010).
Article CAS PubMed PubMed Central Google Scholar
Ribeiro, A. L. et al. Naa50/San-dependent N-terminal acetylation of Scc1 is potentially important for sister chromatid cohesion. Sci. Rep. 6, 39118 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Pimenta-Marques, A. et al. Differential requirements of a mitotic acetyltransferase in somatic and germ line cells. Dev. Biol. 323, 197–206 (2008).
Article CAS PubMed PubMed Central Google Scholar
Hong, J. H. et al. KCMF1 (potassium channel modulatory factor 1) Links RAD6 to UBR4 (ubiquitin N-recognin domain-containing E3 ligase 4) and lysosome-mediated degradation. Mol. Cell. Proteomics 14, 674–685 (2015).
Article CAS PubMed PubMed Central Google Scholar
Vedelek, V., Kovács, A. L., Juhász, G., Alzyoud, E. & Sinka, R. The tumor suppressor archipelago E3 ligase is required for spermatid differentiation in Drosophila testis. Sci. Rep. 11, 8422 (2021).
Article CAS PubMed PubMed Central Google Scholar
Kaplan, Y., Gibbs-Bar, L., Kalifa, Y., Feinstein-Rotkopf, Y. & Arama, E. Gradients of a ubiquitin E3 ligase inhibitor and a caspase inhibitor determine differentiation or death in spermatids. Dev. Cell 19, 160–173 (2010).
Article CAS PubMed Google Scholar
Boussouar, F. & Benahmed, M. Lactate and energy metabolism in male germ cells. Trends Endocrinol. Metab. TEM 15, 345–350 (2004).
Article CAS PubMed Google Scholar
Oliveira, P. F., Martins, A. D., Moreira, A. C., Cheng, C. Y. & Alves, M. G. The Warburg effect revisited-lesson from the Sertoli cell. Med. Res. Rev. 35, 126–151 (2015).
Article PubMed Google Scholar
Cori, C. F. The glucose-lactic acid cycle and gluconeogenesis. Curr. Top. Cell. Regul. 18, 377–387 (1981).
Article MathSciNet CAS PubMed Google Scholar
Van Damme, P. et al. N-terminal acetylome analyses and functional insights of the N-terminal acetyltransferase NatB. Proc. Natl. Acad. Sci. USA. 109, 12449–12454 (2012).
Article ADS PubMed PubMed Central Google Scholar
Croft, T., James Theoga Raj, C., Salemi, M., Phinney, B. S. & Lin, S.-J. A functional link between NAD+ homeostasis and N-terminal protein acetylation in Saccharomyces cerevisiae. J. Biol. Chem. 293, 2927–2938 (2018).
Article CAS PubMed PubMed Central Google Scholar
Singer, J. M. & Shaw, J. M. Mdm20 protein functions with Nat3 protein to acetylate Tpm1 protein and regulate tropomyosin-actin interactions in budding yeast. Proc. Natl. Acad. Sci. USA. 100, 7644–7649 (2003).
Article ADS CAS PubMed PubMed Central Google Scholar
Caesar, R., Warringer, J. & Blomberg, A. Physiological importance and identification of novel targets for the N-terminal acetyltransferase NatB. Eukaryot. Cell 5, 368–378 (2006).
Article CAS PubMed PubMed Central Google Scholar
Pang, A. & Rennert, O. Protein acetylation and spermatogenesis. Reprod. Syst. Sex. Disord. Curr. Res. 1, 5 (2013).
Google Scholar
Pang, A. L.-Y. et al. Cloning, characterization, and expression analysis of the novel acetyltransferase retrogene Ard1b in the mouse. Biol. Reprod. 81, 302–309 (2009).
Article CAS PubMed PubMed Central Google Scholar
Pang, A. L. Y., Clark, J., Chan, W.-Y. & Rennert, O. M. Expression of human NAA11 (ARD1B) gene is tissue-specific and is regulated by DNA methylation. Epigenetics 6, 1391–1399 (2011).
Article CAS PubMed PubMed Central Google Scholar
Inoue, K., Zhuang, L., Maddox, D. M., Smith, S. B. & Ganapathy, V. Structure, function, and expression pattern of a novel sodium-coupled citrate transporter (NaCT) cloned from mammalian brain. J. Biol. Chem. 277, 39469–39476 (2002).
Article CAS PubMed Google Scholar
Morrison, J. et al. Missense NAA20 variants impairing the NatB protein N-terminal acetyltransferase cause autosomal recessive developmental delay, intellectual disability, and microcephaly. Genet. Med. 23, 2213–2218 (2021).
Article CAS PubMed PubMed Central Google Scholar
Helbig, A. O. et al. Perturbation of the yeast N-acetyltransferase NatB induces elevation of protein phosphorylation levels. BMC Genomics 11, 685 (2010).
Article CAS PubMed PubMed Central Google Scholar
Huber, M. et al. NatB-mediated N-terminal acetylation affects growth and biotic stress responses. Plant Physiol. 182, 792–806 (2020).
Article ADS CAS PubMed Google Scholar
Gong, X. et al. OsHYPK-mediated protein N-terminal acetylation coordinates plant development and abiotic stress responses in rice. Mol. Plant 15, 740–754 (2022).
Article CAS PubMed Google Scholar
Linster, E. et al. Downregulation of N-terminal acetylation triggers ABA-mediated drought responses in Arabidopsis. Nat. Commun. 6, 7640 (2015).
Article ADS CAS PubMed Google Scholar
Laurinyecz, B. et al. Sperm-Leucylaminopeptidases are required for male fertility as structural components of mitochondrial paracrystalline material in Drosophila melanogaster sperm. PLoS Genet. 15, e1007987 (2019).
Article CAS PubMed PubMed Central Google Scholar
Port, F. & Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nat. Methods 13, 852–854 (2016).
Article CAS PubMed PubMed Central Google Scholar
Gratz, S. J. et al. Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila. Genetics 196, 961–971 (2014).
Article CAS PubMed PubMed Central Google Scholar
Kondo, S. & Ueda, R. Highly improved gene targeting by germline-specific Cas9 expression in Drosophila. Genetics 195, 715–721 (2013).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Marc Amoyel, Bénédicte Durand, Benjamin Loppin, Rita Sinka, Alan Jian Zhu, Christian Lehner, Christian Klämbt, and Ilona Grunwald Kadow for fly lines; the Bloomington Drosophila Stock Center for providing Drosophila fly lines; the iBV platforms: Baptiste Monterroso and Sameh Ben Aicha from the imaging facility, Marie-Christine Chaboissier, and Maximilian Fürthauer for comments and Anita Mencser for fly food; and all the members of the BH laboratory for fruitful discussions and comments. This work was supported by the Université Côte d’Azur, CNRS (ATIP-Avenir program), INSERM, European Research Council (ERC starting grant CellSex, Grant number: ERC-2019-STG#850934), and the French Government (National Research Agency, ANR) through the “Investments for the Future” programs LABEX SIGNALIFE ANR-11-LABX-0028-01 and IDEX UCAJedi ANR-15-IDEX-01.

Author information

Authors and Affiliations

Université Côte d’Azur, CNRS, Inserm, Institut de Biologie Valrose, Nice, 06108, France
Charlotte M. François, Thomas Pihl, Marion Dunoyer de Segonzac, Chloé Hérault & Bruno Hudry

Authors

Charlotte M. François
View author publications
You can also search for this author in PubMed Google Scholar
Thomas Pihl
View author publications
You can also search for this author in PubMed Google Scholar
Marion Dunoyer de Segonzac
View author publications
You can also search for this author in PubMed Google Scholar
Chloé Hérault
View author publications
You can also search for this author in PubMed Google Scholar
Bruno Hudry
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Conceptualisation: C.F., B.H., methodology: C.F., B.H., investigation: C.F., T.P., M.dD.S., C.H., B.H., visualisation: C.F., T.P., M.dD.S., C.H., Funding acquisition: B.H., project administration: B.H. Supervision: B.H., writing—original draft: B.H.

Corresponding author

Correspondence to Bruno Hudry.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Giovanni Cenci and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

François, C.M., Pihl, T., Dunoyer de Segonzac, M. et al. Metabolic regulation of proteome stability via N-terminal acetylation controls male germline stem cell differentiation and reproduction. Nat Commun 14, 6737 (2023). https://doi.org/10.1038/s41467-023-42496-9

Download citation

Received: 21 April 2023
Accepted: 12 October 2023
Published: 23 October 2023
DOI: https://doi.org/10.1038/s41467-023-42496-9

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.