Abstract
Cisplatin kills proliferating cells via DNA damage but also has profound effects on post-mitotic cells in tumors, kidneys, and neurons. However, the effects of cisplatin on post-mitotic cells are still poorly understood. Among model systems, C. elegans adults are unique in having completely post-mitotic somatic tissues. The p38 MAPK pathway controls ROS detoxification via SKN-1/NRF and immune responses via ATF-7/ATF2. Here, we show that p38 MAPK pathway mutants are sensitive to cisplatin, but while cisplatin exposure increases ROS levels, skn-1 mutants are resistant. Cisplatin exposure leads to phosphorylation of PMK-1/MAPK and ATF-7 and the IRE-1/TRF-1 signaling module functions upstream of the p38 MAPK pathway to activate signaling. We identify the response proteins whose increased abundance depends on IRE-1/p38 MAPK activity as well as cisplatin exposure. Four of these proteins are necessary for protection from cisplatin toxicity, which is characterized by necrotic death. We conclude that the p38 MAPK pathway-driven proteins are crucial for adult cisplatin resilience.
Similar content being viewed by others
Introduction
Cisplatin is a platinum-based chemotherapeutic drug widely used to combat different types of cancer including sarcomas and carcinomas with relatively high treatment efficiency1,2. A major mechanism of cisplatin action is via the binding of platinum to DNA and forming intra- and inter-stranded crosslinks. This leads to cell cycle arrest and eventually apoptosis in fast-cycling cells2. However, only 1–10% of intracellular cisplatin can be found in nuclei3,4 and cisplatin has other cellular targets apart from nuclear DNA, such as mitochondria and endoplasmic reticulum5. Importantly for our study, many solid tumor cells are post-mitotic6, and shrinking or eliminating a tumor mass by cisplatin action involves its function in these non-dividing cells as well. Revealing the cellular pathways influenced by cisplatin could provide important information for the design of new cancer treatment strategies targeting slow-cycling or non-dividing cells. Cisplatin therapy is limited by its toxic side effects in auditory neurons and the kidney7. The side effects of toxicity in both neurons and the kidney can be devastating and can even rule out the availability of cisplatin treatment to many individuals. Both organs are completely post-mitotic and the effect of cisplatin needs to be limited or abolished for effective treatment. C. elegans is an attractive model for cisplatin resistance studies since somatic tissues of wild-type adult animals are purely post-mitotic and the wild-type worms display resistance to cisplatin treatment8,9. The presence of pathway orthologues in this model organism offers the opportunity to use the power of genetics and describe these pathways in vivo.
The innate immune system in C. elegans has been extensively studied for its role in protecting worms from bacterial and fungal pathogens10,11. For this response, the p38 MAP kinase pathway is one of the three signaling pathways that have the greatest impact on resistance to pathogens12,13. In the intestine, the p38 MAP kinase pathway (NSY-1/MAPKKK, SEK-1/MAPKK, PMK-1/MAPK) acts by activating the transcription factor ATF-7 via phosphorylation in response to pathogen attack13, whereas for hypodermal pathogens this pathway acts via STA-2 to drive a largely non-overlapping set of genes14. Apart from its role in pathogen resistance, the p38 MAPK pathway and the downstream immune response genes are important in the modulation of responses to dietary restriction and aging15, repair of sterile wounds16, and the regulation of developmental sleep17. Work in Drosophila shows that the innate immune genes have roles in processes as diverse as in oogenesis18 and repair of traumatic brain injury19. This has led to the recognition that the immune response genes should be considered as stress modulators or repair factors and that their roles stretch beyond pathogen defense.
Cisplatin induces ROS in mammalian cells20 and worms9 and a substantial body of evidence supports the notion that ROS-provoked damage could lead to cell and tissue death. In worms, cisplatin leads to the oxidation of a specific chaperone-type protein ASNA-1. Oxidation of ASNA-1 perturbs the targeting of tail-anchored membrane proteins to the endoplasmic reticulum membrane9. However, it is not known whether the levels of ROS species are high enough to inflict damage on tissues at a level sufficient to cause extensive damage or death. ROS detoxification in response to ROS accumulation is driven by the activity of type II detoxification genes which are under control of the SKN-1/NRF transcription factor. Phosphorylation and activation of SKN-1 is in turn mediated upstream by the activation of p38 MAPK pathway components SEK-1 and PMK-1 in response to increased ROS levels21,22,23. It is, therefore, possible to test, using C. elegans as a model, whether ROS-induced toxicity is an important aspect of cisplatin-provoked death.
In this study, using a combination of quantitative proteomics, genetic analysis, and selective degradation of signaling molecules we find that the p38 MAP kinase pathway has an important function in ensuring survival on cisplatin. However, we find that the activation of the innate immune response genes downstream of this pathway is far more important than the ROS detoxification arm in mediating the cisplatin response. Restricting the signaling only in somatic tissues of post-mitotic adults is equivalent to a complete knockout of the pathway observed in null mutants. Cisplatin-induced ROS is important for activation of the signaling activity and the transcription factor ATF-7 acting downstream of the p38 MAPK signaling pathway is a central participant in the response. Consistent with this idea we found that PMK-1/MAPK and ATF-7 are phosphorylated upon cisplatin exposure and that ATF-7 phosphorylation requires PMK-1 function. Moreover, IRE-1 functions with TRF-1 in a UPRER-independent manner upstream of the p38 MAPK pathway to initiate signaling. We find that sulfenylation of IRE-1 is an early molecular event in response to cisplatin exposure and this molecular landmark in turn leads to the accumulation of innate immune proteins. We identify a set of immune response proteins whose abundance depends on SEK-1 and cisplatin. Strikingly, mutants in several of these innate immune response proteins are also cisplatin sensitive. The mutants accumulate phosphatidyl serine on the surface of the necrotic vacuoles and mutants defective in excretory canal function (the kidney equivalent in worms) function are also cisplatin sensitive. We conclude that in post-mitotic tissues, the IRE-1/PMK-1/ATF-7 pathway function is of greater importance than the ROS detoxification pathway to promote resilience against cytotoxicity.
Results
ROS detoxification is not required for survival on cisplatin
There is a well-established function of ROS in the activation of MAPKs when mammalian cells are treated with cisplatin24. It was previously shown that cisplatin induces ROS in 1-day-old adult animals9. We found evidence that cisplatin treatment leads to ROS-promoted protein damage (Supplementary Fig. 1a, b). Mindful of the role of p38 MAPK activation upon ROS accumulation, we asked if the p38 MAPK cascade has functions in adult animals in response to cisplatin exposure. We found this to be the case based on several observations. First, cisplatin exposure induced the p38 MAPK pathway activity as monitored by the phosphorylation of PMK-1/MAPK (Fig. 1a, b; Supplementary Fig. 2), and cisplatin-induced ROS was required for p38 activation since treating with a ROS scavenger (MitoTempo) resulted in a decrease in PMK-1 phosphorylation (Fig. 1c, d; Supplementary Fig. 2). Second, cisplatin treatment led to an increase in the accumulation PMK-1::mNeonGreen25 in the intestinal nuclei in comparison to the untreated controls (Supplementary Fig. 3). Third, mutants in p38 MAPK pathway sek-1(km4)/MAPKK and pmk-1(km25)/MAPK, were sensitive to cisplatin in comparison to the wild-type animals (Fig. 1e). The LD50 of sek-1(km4) mutants for cisplatin-induced death was 150 μg/mL (Supplementary Fig. 4), which is half the dose of well-studied cisplatin sensitive mutants in asna-18 and about 3.5 times lower than that of wild-type animals. Another sek-1 deletion mutant, syb2311, created by precise deletion of the entire coding sequence of sek-1, also showed enhanced sensitivity to cisplatin treatment, at levels comparable to those seen in sek-1(km4) mutants (Fig. 1e)25. We concluded that cisplatin treatment led to activation of the p38 MAPK pathway and that the activation was ROS dependent.
a Western blot analysis after SDS-PAGE of phospho-p38 levels in 1-day-old wild-type adults with and without cisplatin treatment for indicated times. Worms were exposed to cisplatin on 300 μg/mL cisplatin-containing plates. The blot was probed with anti:phospho-p38 antibody to detect activated PMK-1, anti:PMK-1 antibody was used to estimate total levels of PMK-1 protein, tubulin was used as a loading control. Full uncropped images are available in Supplementary Fig. 2. b Relative phospho-p38 level quantification from blots presented in Supplementary Fig. 2. Statistical significance was determined by one-way ANOVA followed by Bonferroni post hoc correction. The experiment was performed in triplicate. Bars represent mean ± SD. c Western blot analysis after SDS-PAGE of phospho-p38 levels in 1-day-old wild-type adults with (+) and without (−) MitoTempo/cisplatin exposure. The blot was probed with anti:phospho-p38 antibody, tubulin was used as a loading control. Full uncropped images are available in Supplementary Fig. 2. d Relative phospho-p38 levels quantification from blots presented in Supplementary Fig. 2. Statistical significance was determined by one-way ANOVA followed by Bonferroni post hoc correction. The experiment was performed in triplicate. Bars represent mean ± SD. e, h, i Mean survival ± SD of 1-day-old adults with the indicated genotypes after 24 h cisplatin (300 μg/mL) exposure. Statistical significance determined was by one-way ANOVA followed by Bonferroni post hoc correction. The experiment was performed in triplicate. All data on cisplatin sensitivity trials is available in Supplementary Data 4. f, g Relative gene expression of four phase II detoxification genes in 1-day-old adult wild-type animals (f) without or with (+CP) 6 h or 24 h cisplatin treatment, g without or with (+CP) 6 h cisplatin treatment. Worms were exposed to cisplatin on 300 μg/mL cisplatin-containing plates. Statistical significance was determined by one-way ANOVA followed by Bonferroni post hoc correction. The experiment was performed in triplicate for 6 h exposure timepoint and duplicate for 24 h exposure timepoint. F44B9.5 was used as a normalizing control. Bars represent mean ± SEM. Source data are provided as a Source Data file.
The SKN-1/NRF transcription factor is activated by phosphorylation by PMK-1 in response to elevated ROS levels, and in turn activates the transcription of phase II detoxification genes23. We tested the expression of SKN-1-regulated genes gcs-1, gst-4, gst-30, and gst-38 after cisplatin treatment. Expression of these genes was induced in 1-day adults to a similar extent following a 6 h or 24 h cisplatin exposure (Fig. 1f). The activation of all tested phase II detoxification enzyme genes depended on SKN-1 since there was no induction of these genes upon cisplatin exposure of skn-1 adult mutants (Fig. 1g). This suggested an important role of SKN-1 dependent activation of phase II detoxification genes upon cisplatin exposure. Surprisingly, adults from three different skn-1 mutants displayed no sensitivity to cisplatin treatment (Fig. 1h). We concluded that the p38 MAPK pathway plays an important role in cisplatin sensitivity. However, this was not via SKN-1 and the upregulation of the phase II detoxification genes since mutants that failed to upregulate them were not sensitive to cisplatin. DAF-16/FOXO is another key transcription factor in the protection of worms from oxidative stress and daf-16 mutants are sensitive to pro-oxidants26. However, adults harbouring two daf-16 different null mutants displayed enhanced resistance to cisplatin treatment even at high cisplatin concentrations (Fig. 1h). The lack of sensitivity of skn-1 and daf-16 mutants indicated that the ROS levels generated upon exposure were not sufficiently high to cause death if ROS detoxification did not occur via these two major pathways. This finding was in contrast to the importance of DAF-16 and SKN-1 for survival on cisplatin in larval stages which have proliferating somatic tissues27. Taken together this analysis showed that the elimination of ROS by detoxifying enzymes was likely not important for the survival of adult worms after cisplatin exposure.
SEK-1/MAPKK is needed in adult somatic cells for cisplatin resistance
The auxin-inducible degron (AID) system enables the depletion of AID-tagged proteins by tissue-specific TIR1 expression in an auxin-dependent manner28. We exposed 1-day-old adult animals expressing the TIR1 pan-somatic driver (ieSi57) in sek-1::cMyc::AID (syb2456) animals to auxin treatment followed by cisplatin exposure. This allowed us to assess the ability of cisplatin to kill adult worms if SEK-1 is depleted in the soma. Auxin reduced levels of SEK-1::cMyc::AID because a 2 h exposure of 1-day-old adult animals to 1 mM auxin was able to significantly deplete SEK-1, as assessed by decreased levels of phosphorylated/activated PMK-1/p38 (Fig. 2a, Supplementary Fig. 5a). This adult-specific depletion of SEK-1 levels in the soma led to cisplatin sensitivity (Fig. 2b). We failed to directly detect the SEK-1 protein in western blots with the cMyc epitope-tagged allele, and therefore tested a new sek-1 allele (syb4220) in which the 3xFlag::AID tag replaced cMyc::AID. In these animals, expressing the pan-somatic TIR1 driver, the tagged SEK-1 protein could be detected in western blots. Auxin-treated adults had decreased levels of SEK-1 (Fig. 2c, Supplementary Fig. 5b). This auxin treatment regime significantly decreased the survival of 1-day-old adult animals on cisplatin (Fig. 2d). We concluded that the depletion of SEK-1 in post-mitotic tissues was sufficient to induce cisplatin sensitivity and that the proliferating adult germline cells did not contribute significantly to this phenotype.
a Western blot analysis after SDS-PAGE of phospho-p38 levels in 1-day-old adults with (+) and without (–) 1 mM auxin (AUX) treatment. The blot was probed with anti:phospho-p38 antibody and tubulin was used as a loading control. Full uncropped images are available in Supplementary Fig. 5. b, d Mean survival ± SD of 1-day-old adults with the indicated genotypes after 24 h exposure to 300 μg/mL cisplatin-containing plates without (−AUX) or with (+AUX) 1 mM auxin treatment (see the “Methods” section for details). Statistical significance was determined by the b independent two-sided t-test or d one-way ANOVA followed by Bonferroni post hoc correction. The experiment was performed in triplicate. c Western blot analysis after SDS-PAGE of SEK-1 levels in 1-day-old adults with (+) and without (−) 1 mM auxin (AUX) treatment. The blot was probed with anti:Flag antibody and tubulin was used as a loading control. Source data are provided as a Source Data file.
Abundance of innate immune response proteins increases after cisplatin treatment
Having ruled out a significant role for ROS as a cause of cisplatin-provoked death in adult animals, we wished to discover pathways and biological processes downstream of p38 MAPK signaling that may be involved in cisplatin resistance. To this end, we performed quantitative proteomics analysis to identify proteins that changed in abundance in response to cisplatin exposure (Fig. 3a). Principal component analysis (PCA) showed distinct abundance profiles in cisplatin-treated and control samples and demonstrated the consistent reproducibility between the biological replicates (Supplementary Fig. 6). Overall, 3586 proteins had significant changes in abundance (FDR < 0.05) (Supplementary Data 1). Of these, 121 proteins had a fold change increase >2, and 158 proteins were decreased in abundance by <−2 fold change (Fig. 3b), demonstrating a robust response to cisplatin.
a Overview of the proteomics experimental setup. Cisplatin exposure was 300 μg/mL for 6 h (see Materials and Methods section for details). b Volcano plot of differentially cisplatin-induced proteins (FDR < 0.05). Proteins that had a positive fold change (FC > LOG2(2)) upon cisplatin treatment are indicated in red and negative fold change (FC < -LOG2(2)) upon cisplatin treatment in green. FC, fold change. FDR, false discovery rate. For details see Supplementary Data 2. c Reactome analysis with overrepresented pathways (FDR < 0.05). For details see Supplementary Data 1 and Supplementary Data 2. For Reactome enrichment analysis the hypergeometric model was implement to assess whether the number of selected genes associated with Reactome pathway is larger than expected. The p values were calculated based the hypergeometric model.
To further explore which proteins might account for the response to cisplatin treatment, we performed Reactome enrichment analysis on differentially regulated proteins (FDR < 0.05). The proteins fell into multiple functional categories (Supplementary Data 2). The highest count (166 proteins) belonged to members of the innate immune system (Fig. 3c), followed by vesicle-mediated transport and membrane trafficking (Fig. 3c). In addition, this set of proteins (FDR < 0.05 and FC < −2 or FC > 2) were found to be involved in diverse biological functions; for example, response to heat, IRE1-mediated unfolded protein response, and innate immune response (Supplementary Data 2).
p38 MAPK-driven expression of immune genes is induced by cisplatin
The p38 MAP kinase signaling pathway is essential for C. elegans immune response and anti-microbial defense12,13,29,30. In addition to previously characterized sek-1 and pmk-1 mutants as sensitivity factors (Fig. 1a), we tested loss-of-function mutants in the upstream components, nsy-1/MAPKKK, and tir-1/SARM1, and found these mutants also to be cisplatin sensitive (Fig. 1a). Notably, tir-1(qd4) mutants have only been shown to have defects in innate immune function31 indicating the likely involvement of the innate immune system in this response15. The cisplatin sensitivity phenotype of tir-1(qd4) mutants was suppressed by nsy-1(ums8 gf) gain-of-function mutants30 (Fig. 1i) indicating that the canonical signaling pathway was operating. PMK-1-mediated signaling controls the expression of numerous innate immune response genes12,13,30. Since pmk-1 mutants were cisplatin sensitive, we next investigated whether the expression of PMK-1-dependent immune response genes was affected by cisplatin exposure. qRT-PCR analysis indicated that many of these genes were significantly upregulated (Fig. 4a), supporting the notion that the immune response participates in or responds to cisplatin treatment. PMK-1 was required for cisplatin-dependent induction of these immune genes since all these genes required pmk-1 for their cisplatin-provoked upregulation (Fig. 4a), as well as for their basal expression (Fig. 4a), as reported before in the context of bacterial infection response12. We concluded that the entire signal transduction pathway (TIR-1, NSY-1, SEK-1 and PMK-1) was involved in mediating the response to the cisplatin challenge.
a Relative gene expression of PMK-1-dependent immune genes in 1-day-old adult animals with the indicated genotypes without or with (+CP) 6 h cisplatin treatment. Worms were exposed to cisplatin on 300 μg/mL cisplatin-containing plates. Statistical significance was determined by one-way ANOVA followed by Bonferroni post hoc correction. The experiment was performed in triplicate. F44B9.5 was used as a normalizing control. Bars represent mean ± SEM. b Representative bright-field photographs of E. coli OP50-GFP throughout the intestine of wild-type animals without or with 6 h cisplatin treatment (n = 10). Worms were exposed to cisplatin on 300 μg/mL cisplatin-containing plates. Scale bar, 100 μm. c Relative gene expression of PMK-1-dependent immune genes in 1-day-old wild-type adult animals in the absence of OP50 without or with (+CP) 3 h cisplatin treatment. Worms were exposed to 300 μg/mL cisplatin in liquid. Statistical significance was determined by independent the two-sided t-test. The experiment was performed in triplicate. F44B9.5 was used as a normalizing control. Bars represent mean ± SEM. Source data are provided as a Source Data file.
E. coli accumulating in the intestine can provoke the worm’s innate immune response and lead to phenotypic consequences32. We asked whether the accumulation of bacteria in cisplatin-treated animals was the trigger for the induction of the immune response. We did not detect any GFP-labeled bacteria in the intestinal cells of drug-exposed worms or any damage to the intestinal cells in the time period when immune response genes are induced in the intestine (Fig. 4b). E. coli did not accumulate in the intestinal lumen in drug-exposed worms, a condition that can induce the immune response. Furthermore, E. coli were killed on the agar plates containing cisplatin within 6 h, which would prevent them from inducing an immune response. Moreover, PMK-1 phosphorylation as well as expression of known p38-dependent immune response genes were induced by cisplatin exposure even in the absence of bacteria (Fig. 4c). We concluded that the p38 MAPK pathway drives immune response gene expression as an early response directly to cisplatin challenge and not via an effect produced by bacteria.
The transcription factor ATF-7 is required for cisplatin resistance
We further tested the notion that the p38 MAPK pathway activates the innate immune pathway in response to cisplatin by assessing the role of ATF-7. ATF-7 is an ortholog of the mammalian ATF2 family of basic region leucine zipper (bZIP) transcription factors and a key downstream target of the p38/PMK-1 phosphorylation in C. elegans13. ATF-7 has a crucial role as a transcriptional regulator of the PMK-1-mediated intestinal innate immune response13. atf-7(qd22) mutants display diminished expression of PMK-1-dependent immune genes resulting in a strong pathogen susceptibility phenotype13. atf-7(qd22) mutants were sensitive to cisplatin treatment and the phenotype was further enhanced by pmk-1 loss-of-function (Fig. 5a), indicating the possibility of cross-talk between PMK-1 and other signaling pathways or that PMK-1 modulates the activation of other transcription factors in response to cisplatin challenge. qRT-PCR analysis showed that the induction of the pmk-1 dependent immune genes after cisplatin exposure was abrogated in atf-7(qd22) mutants (Supplementary Fig 7). atf-7(qd22 qd130) mutant worms allow partial expression of immune genes31. These mutants were cisplatin-resistant (Fig. 5b) and the atf-7(qd22qd130) mutation suppressed the sek-1 and pmk-1 mutant cisplatin sensitivity phenotype (Fig. 5b) indicating its role downstream of the MAPK cascade in the context of cisplatin response. We concluded that increased gene expression in atf-7(qd22 qd130) mutants likely ensures survival upon cisplatin exposure and was sufficient for the suppression of the sek-1 and pmk-1 cisplatin sensitivity phenotype. The transcriptional GFP reporter for the p38-ATF-7 regulated immune response gene, T24B8.5 expressed from the agIs219 transgene, is a reporter of p38/MAPK pathway activity31. Cisplatin treatment increased the T24B8.5p::GFP levels in intestinal cells (Fig. 5c) and this activation was pmk-1 and sek-1 dependent (Fig. 5c) indicating that the intestine was likely an important site for cisplatin action.
a, b Mean survival ± SD of 1-day-old adults with the indicated genotypes after 24 h cisplatin (150 μg/mL) exposure. Statistical significance was determined by one-way ANOVA followed by Bonferroni post hoc correction. The experiment was performed in triplicate. c Expression from the T24B8.5p::GFP reporter imaged by fluorescence microscopy in the 1-day-old adult wild-type, sek-1(km4), and pmk-1(km25) animals without or with cisplatin treatment. Worms were exposed to cisplatin for 6 h on plates containing 300 μg/mL cisplatin. Relative T24B8.5p::GFP intensity quantification in the wild-type, sek-1(km4), and pmk-1(km25) animals background without or with (+CP) cisplatin treatment. Box plots indicate median (middle line), 25th, 75th percentile (box) and Min to Max (whiskers). Statistical significance was determined by the independent two-sided t-test for wild-type and sek-1(km4) animals or Mann–Whitney U Test for pmk-1(km25) animals. Source data are provided as a Source Data file.
The epidermal p38 MAPK pathway is not involved in the cisplatin response
The p38 MAP kinase pathway promotes innate immunity both in the intestine and in the epidermis (hypodermis) via modulation of different transcription factors and distinct sets of immune effectors14,33. The genetic analysis of atf-7 alleles (Fig. 5a, b), increased levels of ATF-7::EGFP in intestinal nuclei (Supplementary Fig. 8a, b), and induction of the intestinal T24B8.5p::GFP reporter (Fig. 5c) indicated that the intestinal immunity pathway driven by p38/MAPK was an important participant in cisplatin response. We asked whether specifically perturbing the epidermal arm of the innate immune response would also affect survival on cisplatin. We, therefore, examined mutants in three genes participating in epidermal immunity; damage-associated molecular pattern (DAMP) receptor dcar-1, a component of the signaling cascade gpa-12, and the transcription factor sta-2, which is phosphorylated and activated by the p38 MAPK cascade. All three mutants were as resistant as wild-type animals to cisplatin (Supplementary Fig. 9a, b). To further support our notion that hypodermal tissue was not important for this response, we used the auxin-inducible degron (AID) system to assess if hypodermal SEK-1 depletion affected cisplatin survival. We exposed 1-day-old adult animals expressing the TIR1 hypodermal driver (reSi1)34 in the sek-1::cMyc::AID (syb2456) background to auxin treatment followed by cisplatin exposure. Growing these animals from the L1 larval stage to adulthood in the presence of auxin did not result in a cisplatin sensitivity phenotype (Supplementary Fig. 9c). By contrast, this treatment condition significantly decreased cisplatin survival of worms expressing the TIR1 intestinal driver (ieSi61) in sek-1::cMyc::AID (syb2456) background (Supplementary Fig. 9c). These experiments supported our conclusion that activation of the p38 MAPK pathway in the intestine is necessary for protection from cisplatin whereas the epidermal arm of the p38 MAPK signaling cascade did not play a significant role in cisplatin response.
ATF-7 phosphorylation occurs in response to cisplatin exposure
ATF-7 is phosphorylated by the action of SEK-1 and PMK-113. To further explore molecular mechanisms that promote cisplatin-dependent immune gene expression, we directly probed the phosphorylation state of ATF-7 after cisplatin exposure. We monitored the phosphorylation status of ATF-7 using Phos-tag gels in which phosphorylated protein species migrated more slowly than the non-phosphorylated forms. We found that levels of phosphorylated ATF-7::TY1::EGFP::3xFlag expressed from the wgIs638 transgene35 were higher after cisplatin treatment compared to untreated worms (Fig. 6a, b; Supplementary Fig. 10). The specificity of the phospho-ATF-7 band was confirmed by Lambda Protein Phosphatase (Lambda PP) treatment, which dephosphorylates phosphorylated serine, threonine, and tyrosine residues. With Lambda PP treatment, no phospho-ATF-7 band was observed (Fig. 6a). Phospho-ATF-7 was not detected in pmk-1(km25) mutants with or without cisplatin treatment (Fig. 6c, Supplementary Fig. 10). This confirmed the identification of the phosphorylation status of the shifted species and is consistent with the finding that PMK-1 phosphorylates and activates ATF-713. Furthermore, standard SDS-PAGE showed that increased steady-state levels of AFT-7::TY1::EGFP::3xFlag were detected after exposure of worms to cisplatin for 6 h (Fig. 6d, e; Supplementary Fig. 10). We found that the total levels of the tagged ATF-7 protein were stable in pmk-1(km25) mutants (Fig. 6d, e), and atf-7 transcript levels were comparable to those in pmk-1(+) worms (Fig. 6f). Fluorescence microscopy of wgIs638 expressing animals showed that ATF-7::TY1::EGFP::3xFlag levels were increased significantly after cisplatin exposure in the nuclei of intestinal cells (Supplementary Fig. 8a, b). The tagged ATF-7 protein produced by the wgIs638 transgene is functional since it could rescue the T24B8.5p::GFP expression block in atf-7(qd22) mutants (Supplementary Fig. 8c).
a, c Phosphorylation level analysis of ATF-7 in 1-day-old adult wild-type animals expressing ATF-7::TY1::EGFP::3xFLAG from the wgIs638 transgene, and 1-day-old adult animals expressing wgIs638 transgene in pmk-1(km25) mutants, without or with cisplatin treatment for indicated times as well as without or with Lambda Protein Phosphatase (Lambda PP) treatment. Worms were exposed to cisplatin on 300 μg/mL cisplatin-containing plates. * non-phosphorylated protein, ** phosphorylated protein. The blots were probed with anti:Flag antibody and tubulin was used as a loading control. b Relative phospho-ATF-7::3xFlag levels quantification from blots presented in Supplementary Fig. 10. Statistical significance was determined by an independent two-sided t-test. The experiment was performed in triplicate. Bars represent mean ± SD. d Western blot analysis after SDS-PAGE of ATF-7 total protein levels in 1-day-old adult wild-type animals, 1-day-old adult animals expressing ATF-7::TY1::EGFP::3xFLAG from the wgIs638 transgene, and 1-day-old adult animals expressing wgIs638 transgene in pmk-1(km25) mutants, without or with cisplatin treatment for indicated times. Worms were exposed to cisplatin on plates containing 300 μg/mL cisplatin. The blots were probed with anti:Flag antibody and tubulin was used as a loading control. e Relative ATF-7::3xFlag levels quantification from blots presented in Supplementary Fig. 10. Statistical significance was determined by an independent two-sided t-test. The experiment was performed in triplicate. Bars represent mean ± SD. f Relative atf-7 gene expression in 1-day-old adult wild-type and pmk-1(km25) animals. Statistical significance was determined by the independent two-sided t-test. The experiment was performed in biological triplicates. F44B9.5 was used as a normalizing control. Bars represent mean ± SEM. Source data are provided as a Source Data file.
IRE-1 functions upstream of the p38 MAPK pathway in cisplatin response
It has been previously shown that ROS exposure leads to sulfenylation of IRE-1 on the cysteine 663 residue. This not only inhibits the canonical UPRER activity of IRE-1 but promotes a redox-regulated role of IRE-1 in p38 MAPK pathway activation via the TRF-1 protein36. Therefore, we tested whether IRE-1 was the upstream signaling component for activation of the p38 MAPK pathway upon cisplatin treatment. First, we asked if the cisplatin exposure would lead to the induction of UPRER. No induction of the UPRER marker hsp-4 mRNA was observed after cisplatin treatment (Fig. 7a). Second, we asked if the knockdown of IRE-1 would cause cisplatin sensitivity. Indeed, two ire-1 mutants showed enhanced cisplatin sensitivity (Fig. 7b). However, xbp-1 mutants were not cisplatin sensitive (Fig. 7c) indicating that IRE-1 did not act through the canonical UPRER signaling pathway. Third, using a biotin-linked Dimedone derivative (DCP-BIO1), we determined that IRE-1::3xFlag (from the syb5891 allele) showed significantly increased sulfenylation in vivo in response to cisplatin exposure (Fig. 7d, e; Supplementary Fig. 11). Moreover, cisplatin-induced rapid sulfenylation of IRE-1::3xFlag, but not of IRE-1C663S::3xFlag (from the syb6493syb5891 allele), indicated that IRE-1 sulfenylation in response to cisplatin occurs via the previously identified C663 residue (Fig. 7d, e; Supplementary Fig. 11). IRE-1 acts via the trf-1/TRAF2 gene to activate NSY-1/MAPKKK in response to ROS36. We found that trf-1(nr2014) mutants were also cisplatin sensitive (Fig. 7b). The cisplatin sensitivity phenotype of ire-1 mutants was suppressed by a gain-of-function mutation in tir-137 (Fig. 7f) and the sensitivity of trf-1 mutants was suppressed by nsy-1(ums8 gf) (Fig. 7g), showing that the IRE-1-TRF-1 module acted upstream of the p38 MAPK pathway consistent with earlier findings. Further, we found that the upregulation of the p38-ATF-7 regulated reporter T24B8.5p::GFP upon cisplatin exposure was suppressed in ire-1 mutants (Fig. 7h). These lines of evidence led us to propose, that TRF-1 might allow recruitment of NSY-1 to IRE-1 which in turn will lead to p38 MAPK activation as has been reported for acute ROS activation36. Further, the data supported the idea that cisplatin provoked an increase in ROS levels leading to the sulfenylation of IRE-1 and the consequent downstream activation of the p38 MAPK pathway.
a Relative hsp-4 gene expression in 1-day-old adult wild-type animals without or with (+CP) 6 h cisplatin treatment. Worms were exposed to cisplatin on - plates containing 300 μg/mL cisplatin. Statistical significance was determined by the independent two-sided t-test. The experiment was performed in triplicate. F44B9.5 was used as a normalizing control. Bars represent mean ± SEM. b, c, f, g Mean survival ± SD of 1-day-old adults with the indicated genotypes after 24 h cisplatin (450 μg/mL) exposure. Statistical significance was determined by the c independent two-sided t-test or b, f, g one-way ANOVA followed by Bonferroni post hoc correction. The experiment was performed in triplicate. d Sulfenylation of IRE-1 using wild-type animals, animals expressing IRE-1::3xFlag or IRE-1C663S::3xFlag without (−) or with (+) cisplatin treatment (300 μg/mL of cisplatin for 2 h) The blots were probed with anti:Flag antibody and tubulin was used as a loading control. e Relative sulfenylated IRE-1::3xFlag levels quantification from blots presented in Supplementary Fig. 11. Statistical significance was determined by an independent two-sided t-test. The experiment was performed in triplicate. Bars represent mean ± SD. h Relative T24B8.5p::GFP intensity quantification in the wild-type and ire-1(v33) animals background without (WT: n = 13; ire-1(v33): n = 7) or with (+CP) cisplatin treatment (WT: n = 12; ire-1(v33): n = 13). Worms were exposed to cisplatin for 6 h on 300 μg/mL cisplatin-containing plates. Box plots indicate median (middle line), 25th, 75th percentile (box) and Min to Max (whiskers). Statistical significance was determined by the Kruskal–Wallis test followed by Dunn’s post hoc correction. Source data are provided as a Source Data file.
Identification of effectors modulated by cisplatin and SEK-1
We found that the innate immunity pathway was the top cisplatin-enriched response (Fig. 3c). and that the innate immune response driven via the p38 MAPK/ATF-7 pathway was important for protection from cisplatin cytotoxicity. A well-established set of PMK-1-dependent genes were reporters for pathway activity (Fig. 4a). We wished to determine next whether the immune effector proteins were just reporters for cisplatin exposure, or had a functional role in the process of establishing resilience against cisplatin cytotoxicity. We therefore sought to identify candidate p38 MAPK-dependent genes that might play a role in resilience. With this in mind, we performed a second proteomics analysis in sek-1(km4) mutants in order to characterize the SEK-1-dependent immune response and to identify genes that might play an important role downstream of SEK-1 (Fig. 8a, Supplementary Data 1). Principal component analysis (PCA) showed distinct expression profiles between sek-1(km4) and wild-type samples (Supplementary Fig. 12a) as well as between sek-1(km4) and wild-type samples treated with cisplatin (Supplementary Fig. 13a). 1307 proteins displayed significantly increased abundance (FDR < 0.05) (Supplementary Data 1, Supplementary Fig. 12b) and 129 proteins showed decreased abundance with a fold change less than −1.5 in sek-1 mutants (Supplementary Fig. 12b). Proteins that participate in the immune response were a prominent class among these. Cisplatin treatment changed the abundance of 2729 proteins in sek-1(km4) samples in comparison to wild-type samples (FDR < 0.05) (Supplementary Data 1, Supplementary Fig. 13b), and again proteins that participate in the immune response were a prominent class among the most downregulated proteins (FC < −1.5) (Supplementary Fig. 13b). Based on these results we anticipated that SEK-1-dependent proteins characterized in the second proteomics profiling were likely important for protection from cisplatin toxicity. We discovered that of 325 proteins (FDR < 0.05) with an FC > 1.5 upon cisplatin treatment in the wild-type background, 22 of them were downregulated with FC < −1.5 in sek-1 mutants background (in comparison to the wild-type samples), and had at least 1.5-fold decrease after cisplatin treatment in sek-1 mutants background in comparison to cisplatin-treated wild-type animals (Fig. 8b, Supplementary Data 3). The regulation of these proteins was not only highly p38 pathway-dependent but their upregulation might be crucial for the survival of post-mitotic cells upon cisplatin treatment. Many of the immune genes present in the SEK-1-dependent set are known p38 MAPK target genes12. Taken together, we identified the PMK-1/p38 MAPK signaling pathway as a central component in protection against cisplatin cytotoxicity and demonstrated a robust inducible response to cisplatin treatment.
a Overview of the proteomics experimental setup. b Protein fold change (FDR < 0.05) comparison in three different experimental setups. Cisplatin exposure: 300 μg/mL for 6 h. See the Result section for details. c Mean survival ± SD of 1-day-old adults with the indicated genotypes after 24 h cisplatin (450 μg/mL) exposure. Statistical significance was determined by one-way ANOVA followed by Bonferroni post hoc correction. The experiment was performed in triplicate. d Relative gene expression of SEK-1-dependent immune genes in 1-day-old adult animals with the indicated genotypes without or with (+CP) cisplatin treatment. Worms were exposed for 6 h to cisplatin on 300 μg/mL cisplatin-containing plates Statistical significance was determined by an independent two-sided t-test. The experiment was performed in triplicate. F44B9.5 was used as a normalizing control. Bars represent mean ± SEM. Source data are provided as a Source Data file.
p38 MAPK downstream effectors are needed for survival on cisplatin
We hypothesized that mutants in some of the p38 MAPK-dependent immunity genes identified in our proteomics analysis would have an impact on cisplatin sensitivity. We tested the cisplatin sensitivity of mutants in five of these genes: catp-3, clec-4, clec-66, dod-24, and lys-1, for which mutants were available. All five are categorized as immune response genes. Remarkably, single deletion mutants in four of these genes (catp-3, clec-4, dod-24, and lys-1) showed greatly decreased survival upon cisplatin exposure (Fig. 8c). Moreover, the qRT-PCR analysis for clec-4, catp-3, dod-24, and lys-1 confirmed that there was cisplatin-dependent induction of these immune effectors at the transcriptional level as well (Fig. 8d). Transcript accumulation of all four genes were also induced in the absence of the bacteria (Supplementary Fig. 14a) proving further that the response to cisplatin is not an effect produced by bacteria. Next, we found that induction of clec-4, catp-3, dod-24, and lys-1 was not observed upon cisplatin exposure in the absence of PMK-1 (Supplementary Fig. 14b). This further confirmed the importance of these genes for cisplatin resistance and their dependence on the p38 MAPK signaling cascade. Induction of clec-4, catp-3, dod-24, and lys-1 was also not observed in ire-1 mutants following cisplatin exposure, showing that they operated downstream and not in parallel to IRE-1 (Supplementary Fig. 14c). Taken together our work shows that IRE-1/p38 MAPK/ATF-7 mediated gene expression response in intestinal cells confers protection to C. elegans somatic tissues against cisplatin cytotoxicity (Fig. 9). Surprisingly, activation of typeII detoxification genes via SKN-1 seemed not to play an important role in protection from cisplatin cytotoxicity in post-mitotic adults (Fig. 9).
Working model for p38 innate immune pathway modulation of cisplatin response in adult C. elegans. Based on our data, we propose that the p38 immune signaling pathway was activated in the intestine via IRE-1/TRF-1 to drive transcription of ATF-7-dependent immune genes and promote somatic endurance (right pathway). Activation of detoxification genes via SKN-1 transcription factor was not sufficient to promote survival (left pathway, marked in gray). Created with BioRender.com.
Cisplatin exposure leads to the accumulation of necrotic damage
Multiple mechanisms are thought to be the cause of cisplatin-induced death. To investigate the nature of cisplatin-induced cell death we used apoptosis, necrosis, and autophagy markers to assess the cause of death of cisplatin-treated worms. We did not observe the increase in apoptotic corpses marked by CED-1::GFP in somatic tissues in cisplatin-treated clec-4(ok2050) mutants in comparison to untreated control (Supplementary Fig. 15a). No increase was detected in the number of puncta of intestinal mCherry∷LGG-19 in clec-4(ok2050) mutants upon cisplatin treatment indicating the absence of autophagy induction (Supplementary Fig. 15b). We chose intestine-expressed mCherry::LGG-1 for our analysis since the intestine was important for cisplatin response. We did however observe an increase in vacuole number in clec-4 (ok2050), catp-3(ok1612), and dod-24(ok2629) mutants upon cisplatin treatment at levels higher than that seen in wild-type controls (Supplementary Fig. 16a, b). Such vacuoles are characteristic of necrotic death38. Importantly in all cases, necrotic vacuoles were found in intestinal cells (Supplementary Fig. 16a). Necrotic vacuoles are characterized by the presence of phosphatidylserine (PS) on the outer leaflet of the vacuolar membranes. The surface exposure of phosphatidylserine can be tracked by the binding of a soluble MFG-E8:mCherry39 protein marker (Supplementary Fig. 16c), which binds PS in the vacuolar membranes of necrotic cells40. We found that the vacuoles induced at high levels in dod-24(ok2629) and catp-3(ok1612) mutants had PS-positive surfaces, thus providing further evidence for identification of the vacuoles as necrotic vacuoles. Neurotoxic and nephrotoxic side effects of cisplatin remain the major limitations in the use of the drug. It has been previously shown that low doses of cisplatin did not affect the basal and touch-provoked movement of the nematode and did not cause broad damage to sensory functions of C. elegans41. Therefore, we excluded the neurotoxicity as a likely cause of death of the mutants. We focused on the possibility of excretory system dysfunction as a cause of cisplatin-induced death. We tested the cisplatin sensitivity of the mutants with excretory canal defects: exc-5(rh232), exc-6(rh103), and exc-7(rh252). All three mutants displayed significantly decreased cisplatin survival (Supplementary Fig. 17a). EXC-4p::EXC-4::GFP marks the membranes of the excretory tubules. No differences were however observed in the GFP localization pattern between cisplatin-treated and untreated animals (Supplementary Fig. 17b). We concluded that the defect in excretory canal function is lethal for cisplatin-treated worms but the exposure of adults to cisplatin will not cause degeneration of the excretory canals.
Discussion
We have described the identification and characterization of the p38 MAPK immune pathway as a necessary component in cisplatin detoxification and protection from cisplatin toxicity in post-mitotic cells of C. elegans. Here we show that the induction of type II detoxification genes by SKN-1/NRF upon cisplatin exposure provoked by an increase in ROS levels of post-mitotic cells was not important for cisplatin resistance. Rather, we show that PMK-1-mediated innate immunity response via the ATF-7/ATF2 transcription factor was a major component in the resistance against cisplatin. The finding that tir-1(qd4) mutants, which only have a documented role in innate immunity, are also cisplatin sensitive provides further evidence for a role for innate immunity pathway in mediating resilience. Furthermore, cisplatin exposure led to the phosphorylation of PMK-1 and ATF-7 and establishes an early molecular landmark for cisplatin exposure. We found that the IRE-1/TRF-1 module acts upstream of the NSY-1/SEK-1/PMK-1 pathway to activate signaling. Cisplatin induced ROS was needed for this signaling cascade activation and cisplatin provoked sulfenylation of IRE-1 was observed. Finally, we identified four p38 MAPK-dependent genes whose function is necessary for resilience thus completing a link from cisplatin exposure, through activation of a signaling cascade to the function of individual effectors at the end of the cascade. We found increased levels of necrotic damage in the identified immune mutants thus providing a possible cellular basis for the cisplatin cytotoxicity.
Cisplatin is one of the most effective anticancer drugs and its effectiveness seems to be due to the unique properties of cisplatin and its ability to enter cells via multiple pathways. One possible killing mechanism of cisplatin in dividing cells is through the creation of DNA crosslinks, which results in the arrest of cell division and growth and triggers apoptosis1. In nuclei, cisplatin forms adducts with two consecutive guanines or adenines. This modified bond prevents DNA repair, which results in cell death1. C. elegans has been widely used to study the response of dividing cells to cisplatin. This includes cisplatin-induced DNA-damage response pathways involved in DNA inter-strand crosslinks repair42 and pathways ensuring the proper replication of damaged DNA in embryos43. Analysis of the role of cisplatin in DNA damage is important for its role in anti-tumor therapy. However, while interaction with DNA in nuclei results in cell cycle arrest and initiates cell death in proliferating cells, only 1–10% of intracellular cisplatin is found in nuclei3,4,44.
A major drawback in anti-cancer treatment against solid tumors is the presence of dormant malignant cells responsible for tumor relapse. Such non-dividing cells are resistant to standard chemotherapy agents that rely on DNA replication and cell division to promote their antitumor effect. The changed phenotype of quiescent cells enables them to survive the chemotherapeutic treatment45. In our study, we have used cisplatin-resistant adult C. elegans worms as a model organism to study the resistance mechanism of non-dividing cells. The fates of every cell in the nematode have been determined and all the somatic cells of an adult worm are terminally differentiated and non-dividing46,47. Therefore, C. elegans is a good model for the analysis of cisplatin resistance in non-dividing cells. Changes in gene expression have been quantified between cisplatin-resistant and sensitive cell tumor lines and these do not always correlate well with the protein abundance48,49,50. With that in mind, we performed a quantitative proteomics screening of cisplatin-resistant wild-type C. elegans to identify the proteins that display differential abundance in response to cisplatin and to characterize factors responsible for the resistance.
Our previous work has demonstrated in worms that there is an increase in ROS levels when C. elegans 1-day-old adults are subjected to cisplatin treatment. This consequently led to higher levels of oxidized ASNA-1 and disturbances in ER-targeted tail-anchored membrane protein insertion9,51. In this study, we started by asking to what extent ROS detoxification was essential for survival. For this, we tested the impact of the stress-activated p38 MAPK pathway on the resistance of post-mitotic worms to cisplatin treatment. MAPKs are critical components of intracellular networks which regulate gene expression in response to a range of extracellular stimuli including ROS. p38 MAPK pathway activation is an important factor in the cellular response to cisplatin52. In C. elegans activation of the SKN-1 transcription factor by the p38 MAPK pathway in the intestine is the first line of defense against xenobiotics21 via regulation of oxidative stress resistance23,53. SKN-1 is also involved in innate immunity response to pathogen infection54. Knockdown or inhibition of mammalian homolog of SKN-1, NRF2, causes increased cell death, cytotoxicity, and apoptosis in response to cisplatin treatment55,56. SKN-1 and DAF-16 are key components in the response of C. elegans developing larvae containing proliferative cells to cisplatin27. In this study, we examined whether SKN-1 also regulates the response to cisplatin in non-dividing cells. Many phase II detoxification genes which are regulated by SKN-1 are also upregulated upon cisplatin exposure. Surprisingly, skn-1 mutants did not exhibit any sensitivity phenotype to cisplatin treatment, although their phenotype in sensitivity factor to other pro-oxidants like arsenite21 or paraquat23 is well established. Furthermore, DAF-16/FOXO which is an oxidative stress-induced factor with a well-established involvement in protection from oxidative stress generators like arsenite57 or paraquat26, also had no role in protection from cisplatin.
Hourihan et al.36 have shown that endoplasmic reticulum stress sensor IRE-1 has a UPRER independent redox-regulated function36. Localized ROS activation leads to IRE-1 sulfenylation, which in turn inhibits IRE-1-mediated UPRER. IRE-1 works with TRF-1 to initiate the antioxidant response via activation of the p38 MAPK pathway through SKN-1/NRF activity. Using these findings as a starting point, we found that IRE-1 and TRF-1 are also important upstream activators of the p38 MAPK pathway in the context of cisplatin exposure. Moreover, that response was independent of the UPRER activity of IRE-1. In contrast, SKN-1/NRF driven antioxidant response was not important in protection from cisplatin toxicity. Rather our finding showed that the IRE-1/TRF-1/p38 MAPK cascade activated ATF-7-dependent immune response genes.
Sterile inflammation refers to inflammatory reaction pathogens other than pathogens. This process is activated by damage-associated molecular patterns (DAMPs) produced by cell or tissue damage58. DAMPs can initiate the immune response through the activation of pattern recognition receptors (PRPs) which include Toll-like, NOD-like, and C-type lectin receptors59. Though sterile inflammation plays a crucial role in tissue repair, unresolved chronic inflammation may lead to inflammatory or neurogenerative diseases as well as autoimmune diseases and cancer. Survival following traumatic brain injury in Drosophila was increased by induction of NF-κB innate immune response transcription factor Relish19. Moreover, macrophage-inducible C-type lectin (MINCLE), was shown to induce pathogenic proinflammatory responses in experimental traumatic brain injury and ischaemic stroke60,61. One explanation for our findings is that cisplatin exposure of post-mitotic C. elegans will lead to the induction of DAMPs and therefore initiate innate immune response through the activation of PRPs. We indeed observed in our proteomics analysis an increased immune response including several C-type lectins such as CLEC-4 and CLEC-66. The expression of many of those host defense proteins was dependent on SEK-1 confirming findings from previous studies in bacterially infected worms12. Interestingly, it has been shown that there is upregulation of the key components of immune response to infection, NFκB or TNF, in cisplatin-resistant lung cancer cell lines. Moreover, the inhibition of those two components increase cisplatin sensitivity in resistant cell lines62. We found that the deletion of single p38-dependent response genes resulted in a strong cisplatin sensitivity phenotype. Our data suggest a mechanism by which the knock-down of immune genes regulated by the p38 MAPK cascade in resistant post-mitotic cells leads to increased cisplatin sensitivity. A possible mechanistic explanation lies in the fact that three of the identified proteins LYS-1, DOD-24, and CLEC-4 are predicted with high confidence to be secreted proteins63. This suggests that such defense proteins secreted from the intestine might spread systemically to protect nearby tissues. LYS-1 is also activated by bacterial infection and by exposure to xenobiotic graphene oxide. In both cases, LYS-1 acts upstream of TUB-1/TULP4 signaling64,65, which is involved in the proteasomal degradation of target proteins in response to stress. The DOD-24 protein contains a CUB domain which is present in secreted proteins associated with tissue repair and inflammation. Knockdown of the murine homolog of CATP-3 (ATP4a) leads to secretory defects in intestinal cells and reduced levels of secretory granules66. We hypothesize that even though CATP-3 is a predicted integral membrane protein, its loss could lead to secretion defects as well. Treatments that target the immunity pathways in resistant tumors should be explored as possible means to combat cisplatin resistance in non-dividing cells.
Methods
Ethical permissions were not needed for this work since it was performed using an invertebrate model system. No local rules are applicable to research on invertebrates. Husbandry and procedures were performed as appropriate for the species.
C. elegans strains maintenance and synchronization
PHX2311: sek-1(syb2311) was obtained by precise deletion of the entire coding sequence of sek-1 using CRISPR-CAS9 technology by Suny Biotech. PHX2456: sek-1(syb2456) was generated using CRISPR-CAS9 technology by precise insertion of the flexible linker GASGASAS (GGAGCATCGGGAGCCTCAGGAGCATCG), cMyc, and AID just before the stop codon. PHX4220: sek-1(syb4220) was generated using CRISPR-CAS9 technology by precise insertion of the GASGASAS flexible linker, 3xFlag, and AID just before the stop codon of the gene. PHX5891: ire-1(syb5891) was generated using CRISPR-CAS9 technology to precisely insert the GASGASGAS flexible linker, and 3xFlag just before the stop codon. PHX6493: ire-1(syb6493) was generated by using CRISPR-CAS9 technology by precise mutation of cysteine (TGT) to serine (TCG) at amino acid 663 at the IRE-1 locus in ire-1(syb5891). All C. elegans strains used in this study are listed in Supplementary Data 5. Worms were cultured under standard conditions at 20 °C on nematode growth media (NGM) plates67 unless stated otherwise and the E. coli strain OP50 was used as a food source. OP50-GFP was obtained from the Caenorhabditis stock center. All worms used in the study were synchronized to the young adult stage. Synchronous larval populations were obtained by gravity separation as described68. The L1 larvae were cultured for three more days at 20 °C to obtain populations with synchronous worms at the 1-day-old young adult stage.
Western blot analysis
Western blots were performed as described previously69. Primary antibodies were: anti:phospho-p38 MAPK (Thr180/Thr182) Rabbit mAb (D3F9, Cell Signaling) 1:1000, anti:total PMK-1 MAPK Rabbit pAb 1:1000 from the Pukkila-Worley lab70, anti:tubulin (T5168, Sigma) 1:5000, anti:Flag (M2, Sigma) 1:1000.
Western blot analysis with SuperSep Phos-tag gels
SuperSep Phos-tag, 12.5%, 17 well gels were from Fuji Film Wako Pure Chemical Corporation (#195-17991). Sample preparation and electrophoresis were carried out using the same procedure as for regular western blot experiments except that before transfer to PVDF membranes, the gels were gently agitated in a transfer buffer containing 10 mmol/L EDTA for 1 h as per the manufacturer’s protocol. It is important to note that Phos-tag gels cause molecular weight ladders to migrate differently and the migration pattern is not indicative of the actual protein size.
Sulfenylation assay
Assay was performed as described previously36. In short, after experimental treatment, nematodes were lysed in lysis buffer (50 mM HEPES, 50 mM NaCl, 1 mM EDTA, 10% glycerol, 1% Triton x-100) supplemented with 1 mM DCP-Bio1, 0.1 mM N-ethyl malemide, 0.1 mM Iodacetamide, and protease inhibitor. Homogenization was done using the Next Advance cell disruptor and 0.2 mm stainless steel beads for 3 min at 4 °C. Next, samples were centrifuged at 14,000 × g for 20 min at 4 °C. The supernatant was transferred to a new tube and incubated in the dark for 1 h at room temperature to allow for the labeling of sulfenic acids. After incubation, un-reacted DCP-Bio1 was removed using P6-Spin Columns (#7326227, BioRad) following the manufacturer’s instructions. Protein concentrations were determined by the BCA assay and 600–800 μg of total protein was added to a 50 µl slurry of Pierce Streptavidin Magnetic Beads (#88816, Thermo Fisher Scientific) in a total volume of 900 µL. The mix was rotated for 1 h at room temperature. After the binding, the beads were magnetically separated from the lysate, the supernatant was discarded and the beads were washed three times for 10 min each in 1 ml of binding/wash buffer. Next, beads were separated and heated for 10 min at 95 °C in 30 µl of reducing 2 × LDS buffer (#1610737, BioRad). The beads were magnetically separated and the total lysate was analyzed by electrophoresis using SDS-PAGE followed by western blotting.
Detection of carbonylated protein
Protein carbonylation was determined by OxyBlot Protein Oxidation Detection Kit (S7150, Merck Millipore). Homogenization and protein estimation were done as described previously69. Total extracted proteins were derivatized according to the manufacturer’s instructions. 2-mercaptoethanol was used to reduce samples. The membrane was blocked for 1 h in 5% BSA/TBS-T and probed with antibodies provided in the kit according to the manufacturer’s instructions.
RNA isolation and quantitative RT-PCR
RNA isolation was performed as described previously9. qPCR was performed on a CFX Connect (BioRad) instrument using KAPA SYBR FAST qPCR Kit (KK4600, Sigma) with normalization to the housekeeping gene F44B9.5. Analysis was performed using the comparative Ct method All samples were tested in triplicates. Data on the graph is presented on a logarithmic scale. Oligonucleotides sequences are provided as a Supplementary Table 1.
Fluorescence microscopy and pixel intensity measurement
Live 1-day-old adult animals were sedated in 2 mM Levamisole/M9 and mounted onto 2% agarose pads. ImageJ was used to quantify pixel intensity in worms.
Confocal microscopy
Live 1-day-old adult animals were sedated in 2 mM Levamisole/M9 and mounted onto 2% agarose pads. The fluorescence signals were analyzed at 555 nm using a LSM700 Confocal Laser Scanning Microscope (Carl Zeiss) with LD C-Apochromat 63x/1.4 Oil DIC objective.
Cisplatin treatment
Worms were treated with cisplatin (i) on plates or (ii) in liquid. (i) Cisplatin plates were prepared using MYOB media with 2% agar in which the drug was added at a final concentration of 300 or 600 μg/mL. Cisplatin solution (1 mg/mL, Accord Healthcare AB) was added to the autoclaved medium after cooling to 54 °C. 1-day-old adults were collected, washed, and incubated on cisplatin plates for 3 or 6 h. Concentrated OP50 was used as a food source. (ii) 1-day-old adults were washed extensively in M9 before analysis in order to remove the traces of the live bacteria from the surface of the worms as well as from the intestine of the worms. Washed worms were exposed to cisplatin solution (300 μg/mL for 2 h or 3.5 h) by rotation at room temperature thus allowing for uniform exposure to the drug.
Auxin treatment
1-day-old adult animals were transferred to NGM plates containing 1 mM auxin (indole-3-acetic acid) (#A10556.06, Alfa Aesar) for indicated times. The 1 mM auxin-containing agar plates were prepared 24 h before use from a freshly made 800 mM stock solution in 99.5% ethanol and stored in the dark. An equivalent amount of ethanol was added to the control plates.
Pro-oxidant treatment
Worms were staged by gravity and L1 larvae were collected. L1 larvae were grown on NGM plates with or without 0.5 mM MitoTempo (#SML0737, Sigma) for 72 h until they reached adulthood. 1-day-old adult worms were washed extensively with M9 to remove any traces of the bacteria and exposed with rotation for 2 h to either M9 containing 0.5 mM MitoTempo or to cisplatin solution (300 μg/mL) diluted from the stock in M9 and containing 0.5 mM MitoTempo.
Cisplatin sensitivity assay
Cisplatin sensitivity assay was performed as described previously9. For worms pretreated with 1 mM auxin and subjected to cisplatin sensitivity assay, the cisplatin-containing agar plates also contained 1 mM auxin.
Proteomics sample preparation
1-day-old synchronized animals without or with cisplatin (300 μg/mL) treatment on plates for 6 h were lysed in 50 mM TEAB and 2% SDS and protein determination was performed. Three representative references pools were made by taking equal protein amounts from wild-type and mutant samples and combine into a wild-type, a mutant, and a wild-type/mutant reference. The samples were processed according to the filter-aided sample preparation (FASP) method modified from Wisniewski et al.71. Briefly, the samples and references (30 μg) were reduced with 100 mM dithiothreitol at 56 °C for 30 min, transferred to 30 kDa centrifugal filters (Pall Nanosep, Sigma), washed several times with 8 M urea, and once with digestion buffer (DB, 0.5% sodium deoxycholate in 50 mM triethylammonium bicarbonate) prior to alkylation with 10 mM methyl methanethiosulfonate in DB for 20 min at room temperature. Digestions were performed by the addition of 0.3 µg Pierce MS grade Trypsin (Thermo Fisher Scientific) in DB and incubated overnight at 37 °C. An additional portion of trypsin (0.3 µg) was added and incubated for another three hours. Peptides were collected by centrifugation and labeled using TMT 10-plex isobaric mass tagging reagents (Thermo Fisher Scientific) according to the manufacturer´s instructions. The wild-type and mutant samples were analyzed in separate sets and included two references each. The labeled samples were combined and sodium deoxycholate was removed by acidification with 10% trifluoroacetic acid. The combined sample was desalted using Pierce Peptide Desalting Spin Columns (Thermo Fisher Scientific) according to the manufacturer’s instructions. The proteins were pre-fractionated into 40 fractions by basic reversed-phase chromatography (bRP-LC) using a Dionex Ultimate 3000 UPLC system (Thermo Fisher Scientific). Peptide separation was performed using a reversed-phase XBridge BEH C18 column (3.5 μm, 3.0 × 150 mm, Waters Corporation) and a linear gradient from 3 to 40% acetonitrile in 10 mM ammonium formate buffer at pH 10.00 over 17 min, followed by an increase to 90% acetonitrile over 5 min at a flow of 400 µl/min. The fractions were concatenated into 20 fractions, dried, and reconstituted in 3% acetonitrile, and 0.2% formic acid.
nanoLC-MS analysis and database matching
The fractions were analyzed on an Orbitrap Fusion Tribrid mass spectrometer interfaced with Easy-nLC1200 liquid chromatography system (both Thermo Fisher Scientific). Peptides were trapped on an Acclaim Pepmap 100 C18 trap column (100 μm × 2 cm, particle size 5 μm, Thermo Fisher Scientific) and separated on an in-house packed analytical column using a gradient from 5 to 80% acetonitrile in 0.2% formic acid over 80 min followed by 80% acetonitrile for 10 min at a flow of 300 nL/min. MS scans were performed at a resolution of 120,000, m/z range 380–1380. MS2 analysis was performed data-dependent, with a top speed cycle of 3 s for the most intense e precursor ions with a charge state of 2–7. Precursor ions were isolated in the quadrupole with a 0.7 m/z isolation window and dynamic exclusion of fragmented precursors was set to 10 ppm for a duration of 60 s. Isolated precursor ions were subjected to collision-induced dissociation (CID) with collision energy set to 35 and a maximum injection time of 50 ms. The MS2 fragment ions were detected in the ion trap followed by multi-notch (simultaneous) isolation of the top 5 abundant fragment ions for further fragmentation (MS3) by higher-energy collision dissociation (HCD) at 65% and detection in the Orbitrap at 50,000 resolutions. Protein identification and quantification were performed using Proteome Discoverer version 2.2 (Thermo Fisher Scientific). The search was performed by matching against Caenorhabditis elegans using SwissProt (November 2017) using Mascot 2.5.1 (Matrix Science) with a precursor mass tolerance of 5 ppm and fragment mass tolerance of 0.6 Da. Tryptic peptides were accepted with zero missed cleavage, variable modifications of methionine oxidation, and fixed cysteine alkylation; TMT-label modifications of N-terminal and lysine were selected. Percolator was used for PSM validation with a strict FDR threshold of 0.01. TMT reporter ions were identified in the MS3 HCD spectra with 3 mmu mass tolerance, and the TMT reporter intensity values for each sample were normalized on the total peptide amount. The references were used as the denominator. Only unique identified peptides were considered for the relative quantification and quantified proteins were filtered at 1% FDR.
Statistical analysis of proteomics data
The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. To control for multiple testing, the Benjamini-Hochberg procedure was used. Proteins with an FDR value < 0.05 were considered differentially expressed. Principal component analysis (PCA) was used as quality control for the samples and clustering of groups. Enrichment analysis of the differentially expressed proteins was subsequently performed using the Reactome database.
Statistical analysis
Statistical analysis was performed with Prism 7 software (GraphPad software, La Jolla,). P-values indicated statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001).
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
All data is available in the main text or supplementary materials. Source data are provided with this paper. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE72 partner repository with the dataset identifier PXD033377. All other data are available in the article and its Supplementary files or from the corresponding author upon request. Source data are provided with this paper.
References
Dasari, S. & Tchounwou, P. B. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J. Pharm. 740, 364–378 (2014).
Kelland, L. The resurgence of platinum-based cancer chemotherapy. Nat. Rev. Cancer 7, 573–584 (2007).
Legin, A. A. et al. NanoSIMS combined with fluorescence microscopy as a tool for subcellular imaging of isotopically labeled platinum-based anticancer drugs †. Chem. Sci. 5, 3135–3145 (2014).
Mandic, A., Hansson, J., Linder, S. & Shoshan, M. C. Cisplatin induces endoplasmic reticulum stress and nucleus-independent apoptotic signaling. J. Biol. Chem. 278, 9100–9106 (2003).
Raudenska, M., Balvan, J., Fojtu, M., Gumulec, J. & Masarik, M. Unexpected therapeutic effects of cisplatin. Metallomics 11, 1182–1199 (2019).
Komlodi-Pasztor, E., Sackett, D. L. & Fojo, A. T. Inhibitors targeting mitosis: tales of how great drugs against a promising target were brought down by a flawed rationale. Clin. Cancer Res. 18, 51–63 (2012).
Karasawa, T. & Steyger, P. S. An integrated view of cisplatin-induced nephrotoxicity and ototoxicity. Toxicol. Lett. 237, 219–227 (2015).
Hemmingsson, O., Kao, G., Still, M. & Naredi, P. ASNA-1 activity modulates sensitivity to cisplatin. Cancer Res. 70, 10321–10328 (2010).
Raj, D. et al. Alternative redox forms of ASNA-1 separate insulin signaling from tail-anchored protein targeting and cisplatin resistance in C. elegans. Sci. Rep. 11, 8678 (2021).
Akira, S., Uematsu, S. & Takeuchi, O. Pathogen recognition and innate immunity. Cell 124, 783–801 (2006).
Ermolaeva, M. A. & Schumacher, B. Insights from the worm: The C. elegans model for innate immunity. Semin Immunol. 26, 303–309 (2014).
Troemel, E. R. et al. p38 MAPK regulates expression of immune response genes and contributes to longevity in C. elegans. PLoS Genet. 2, 1725–1739 (2006).
Shivers, R. P., Pagano, D. J., Kooistra, T., Richardson, C. E. & Reddy, K. C. Phosphorylation of the conserved transcription factor ATF-7 by PMK-1 p38 MAPK regulates innate immunity in Caenorhabditis elegans. PLoS Genet. 6, 1000892 (2010).
Taffoni, C. & Pujol, N. Mechanisms of innate immunity in C. elegans epidermis. Tissue Barriers 3, 1–8 (2015).
Wu, Z. et al. Dietary restriction extends lifespan through metabolic regulation of innate immunity. Cell Metab. 29, 1192–1205 (2019).
Pujol, N. et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr. Biol. 18, 481–489 (2008).
Sinner, M. P., Masurat, F., Ewbank, J. J., Pujol, N. & Bringmann Correspondence, H. Innate immunity promotes sleep through epidermal antimicrobial peptides. Curr. Biol. 31, 564–577.e12 (2021).
Weaver, L. N. & Drummond-Barbosa, D. The nuclear receptor seven up regulates genes involved in immunity and xenobiotic response in the adult drosophila female fat body. G3: Genes, Genomes, Genet. 10, 4625–4635 (2020).
Swanson, L. C. et al. Survival following traumatic brain injury in Drosophila is increased by heterozygosity for a mutation of the NF-kB innate immune response transcription factor Relish. Genetics 216, 1117–1136 (2020).
Santos, N. A. G. et al. Cisplatin-induced nephrotoxicity is associated with oxidative stress, redox state unbalance, impairment of energetic metabolism and apoptosis in rat kidney mitochondria. Arch. Toxicol. 81, 495–504 (2007).
Inoue, H. et al. The C. elegans p38 MAPK pathway regulates nuclear localization of the transcription factor SKN-1 in oxidative stress response. Genes Dev. 19, 2278–2283 (2005).
Park, S. K., Tedesco, P. M. & Johnson, T. E. Oxidative stress and longevity in C.elegans as mediated by SKN-1. Aging Cell 8, 258–269 (2009).
An, J. H. & Blackwell, T. K. SKN-1 links C. elegans mesendodermal specification to a conserved oxidative stress response. Genes Dev. 17, 1882–1893 (2003).
Bragado, P., Armesilla, A., Silva, A. & Porras, A. Apoptosis by cisplatin requires p53 mediated p38α MAPK activation through ROS generation. Apoptosis 12, 1733–1742 (2007).
Shin, H., Kaplan, R. E. W., Duong, T., Fakieh, R. & Reiner, D. J. Ral signals through a MAP4 kinase-p38 MAP kinase cascade in C. elegans cell fate patterning. Cell Rep. 24, 2669 (2018).
Kondo, M. et al. The p38 signal transduction pathway participates in the oxidative stress-mediated translocation of DAF-16 to Caenorhabditis elegans nuclei. Mech. Ageing Dev. 126, 642–647 (2005).
García-Rodríguez, F. J. et al. Genetic and cellular sensitivity of Caenorhabditis elegans to the chemotherapeutic agent cisplatin. Dis. Model Mech. 11, dmm033506 (2018).
Zhang, L., Ward, J. D., Cheng, Z. & Dernburg, A. F. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142, 4374–4384 (2015).
Kim, D. H. et al. A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate immunity. Science 297, 623–626 (2002).
Cheesman, H. K. et al. Aberrant activation of p38 MAP kinase-dependent innate immune responses is toxic to Caenorhabditis elegans. G3 6, 541–549 (2016).
Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J. & Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host Microbe 6, 321–330 (2009).
Kumar, S. et al. Lifespan extension in C. elegans caused by bacterial colonization of the intestine and subsequent activation of an innate immune response. Dev. Cell 49, 100–117.e6 (2019).
Zugasti, O. et al. Activation of a G protein-coupled receptor by its endogenous ligand triggers the innate immune response of Caenorhabditis elegans. Nat. Immunol. 15, 833–838 (2014).
Ashley, G. E. et al. An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Genetics 217, iyab006 (2021).
Sarov, M. et al. A recombineering pipeline for functional genomics applied to Caenorhabditis elegans. Nat. Methods 3, 839–844 (2006).
Hourihan, J. M., Moronetti Mazzeo, L. E., Fernández-Cárdenas, L. P. & Blackwell, T. K. Cysteine sulfenylation directs IRE-1 to activate the SKN-1/Nrf2 antioxidant response. Mol. Cell 63, 553–566 (2016).
Xie, Y., Moussaif, M., Choi, S., Xu, L. & Sze, J. Y. RFX transcription factor DAF-19 regulates 5-HT and innate immune responses to pathogenic bacteria in Caenorhabditis elegans. PLoS Genet. 9, e1003324 (2013).
Hall, D. H. et al. Neuropathology of degenerative cell death in Caenorhabditis elegans. J. Neurosci. 17, 1033–1045 (1997).
Furuta, Y., Pena-Ramos, O., Li, Z., Chiao, L. & Zhou, Z. Calcium ions trigger the exposure of phosphatidylserine on the surface of necrotic cells. PLoS Genet. 17, e1009066 (2021).
Fadok, V. A. et al. Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. J. Immunol. 148, 2207–2216 (1992).
Wellenberg, A., Brinkmann, V., Ventura, N., Honnen, S. & Fritz, G. Cisplatin-induced neurotoxicity involves the disruption of serotonergic neurotransmission. Pharm. Res. 174, 105921 (2021).
van Haaften, G. et al. Report identification of conserved pathways of DNA-damage response and radiation protection by genome-wide RNAi. Curr. Biol. 16, 1344–1350 (2006).
Roerink, S. F., Koole, W., Stapel, L. C., Romeijn, R. J. & Tijsterman, M. A broad requirement for TLS polymerases g and k, and interacting sumoylation and nuclear pore proteins, in lesion bypass during C. elegans embryogenesis. PLoS Genet. 8, e1002800 (2012).
Centerwall, C. R. et al. Modification and uptake of a cisplatin carbonato complex by Jurkat cells. Mol. Pharm. 70, 348–355 (2006).
Tannock, I. F. Tumor physiology and drug resistance. Cancer Metastasis Rev. 20, 123–132 (2001).
Kimble, J. & Hirsh, D. The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans. Dev. Biol. 70, 396–417 (1979).
Sulston, J. E. & Horvitz, H. R. Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev. Biol. 56, 110–156 (1977).
Greenbaum, D., Colangelo, C., Williams, K. & Gerstein, M. Comparing protein abundance and mRNA expression levels on a genomic scale. Genome Biol. 4, 117 (2003).
Gygi, S., Rochon, Y., Franza, B. & Aebersold, R. Correlation between protein and mRNA abundance in yeast. Mol. Cell Biol. 19, 1720–1730 (1999).
Stewart, J. J. et al. Proteins associated with cisplatin resistance in ovarian cancer cells identified by quantitative proteomic technology and integrated with mRNA expression levels. Mol. Cell. Proteom. 5, 433–443 (2006).
Raj, D., Podraza-Farhanieh, A., Gallego, P., Kao, G. & Naredi, P. Identification of C. elegans ASNA-1 domains and tissue requirements that differentially influence platinum sensitivity and growth control. PLoS Genet. 18, e1010538 (2022).
Brozovic, A. & Osmak, M. Activation of mitogen-activated protein kinases by cisplatin and their role in cisplatin-resistance. Cancer Lett. 251, 1–16 (2007).
An, J. H. et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proc. Natl Acad. Sci. USA 102, 16275–16280 (2005).
van der Hoeven, R., Mccallum, K. C., Cruz, M. R. & Garsin, D. A. Ce-Duox1/BLI-3 generated reactive oxygen species trigger protective SKN-1 activity via p38 MAPK signaling during infection in C. elegans. PLoS Pathog. 7, e1002453 (2011).
Cho, J.-M., Manandhar, S., Lee, H.-R., Park, H.-M. & Kwak, M.-K. Role of the Nrf2-antioxidant system in cytotoxicity mediated by anticancer cisplatin: implication to cancer cell resistanc. Cancer Lett. 206, 96–108 (2008).
Ren, D. et al. Brusatol enhances the efficacy of chemotherapy by inhibiting the Nrf2-mediated defense mechanism. Proc. Natl Acad. Sci. USA 108, 1433–1438 (2011).
Yu, C. W., How, C. M. & Liao, V. H. C. Arsenite exposure accelerates aging process regulated by the transcription factor DAF-16/FOXO in Caenorhabditis elegans. Chemosphere 150, 632–638 (2016).
Gong, T., Liu, L., Jiang, W. & Zhou, R. DAMP-sensing receptors in sterile inflammation and inflammatory diseases. Nat. Rev. Immunol. 20, 95–112 (2020).
Cao, X. Self-regulation and cross-regulation of pattern-recognition receptor signalling in health and disease. Nat. Rev. Immunol. 10, 35–50 (2015).
Suzuki, Y. et al. Involvement of Mincle and Syk in the changes to innate immunity after ischemic stroke. Sci. Rep. 3, 3177 (2013).
Vaccari, J. C. et al. Mincle signaling in the innate immune response after traumatic brain injury. J. Neurotrauma 3, 228–236 (2015).
Zhu, R. et al. NFκB and TNFα as individual key molecules associated with the cisplatin-resistance and radioresistance of lung cancer. Exp. Cell Res. 374, 181–188 (2019).
Teufel, F. et al. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 40, 1023–1025 (2022).
Alper, S. et al. Identification of innate immunity genes and pathways using a comparative genomics approach. Proc. Natl Acad. Sci. USA 105, 7016–7021 (2008).
Ren, M., Zhao, L., Lv, X. & Wang, D. Antimicrobial proteins in the response to graphene oxide in Caenorhabditis elegans. Nanotoxicology 11, 578–590 (2017).
Spicer, Z. et al. Stomachs of mice lacking the gastric H,K-ATPase α-subunit have achlorhydria, abnormal parietal cells, and ciliated metaplasia. J. Biol. Chem. 275, 21555–21565 (2000).
Brenner, S. The genetics of Caenorhabditis elegans. Genetics 77, 71–94 (1974).
Oláhová, M. et al. A redox-sensitive peroxiredoxin that is important for longevity has tissue-and stress-specific roles in stress resistance. Proc. Natl Acad. Sci. USA 105, 19839–19844 (2008).
Podraza-Farhanieh, A., Natarajan, B., Raj, D., Kao, G. & Naredi, P. ENPL-1, the Caenorhabditis elegans homolog of GRP94, promotes insulin secretion via regulation of proinsulin processing and maturation. Development 147, dev190082 (2020).
Peterson, N. D. et al. The nuclear hormone receptor NHR-86 controls anti-pathogen responses in C. elegans. PLoS Genet. 15, e1007935 (2019).
Wiśniewski, J. R., Zougman, A., Nagaraj, N. & Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 6, 359–362 (2009).
Perez-Riverol, Y. et al. The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 50, D543–D552 (2022).
Acknowledgements
We thank the Caenorhabditis Genetic Center (funded by NIH Office of Research Infrastructure Programs P40 OD010440) and National Bioresource Project for the Experimental Animal “Nematode C. elegans” for providing strains, Proteomics Core Facility of Sahlgrenska Academy, University of Gothenburg for proteomic analysis, Read Pukkila-Worley, Dave Reiner & Ji Ying Sze for providing strains and Read Pukkila-Worley for providing anti:total PMK-1 antibody, and Pinar Barkan for discussions on proteomics approaches. The work was supported by grants from the Swedish Cancer Society CAN 2021/1807 Pj (P.N.) and ALF means nr: ALFGBG-966362 (P.N.); Stiftelsen Assar Gabrielssons Fond FB19-44 (D.R.) and Stiftelsen Assar Gabrielssons Fond FB20-32 (D.R.).
Funding
Open access funding provided by University of Gothenburg.
Author information
Authors and Affiliations
Contributions
D.R. and G.K. designed experiments. D.R., B.K., and G.K. performed the experiments. D.R., A.P.-F., J.M., and G.K. analyzed the data. D.R. wrote the paper. G.K. and P.N. critically revised the manuscript for intellectual content. All authors approved the final version.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Source data
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Raj, D., Kraish, B., Martikainen, J. et al. Cisplatin toxicity is counteracted by the activation of the p38/ATF-7 signaling pathway in post-mitotic C. elegans. Nat Commun 14, 2886 (2023). https://doi.org/10.1038/s41467-023-38568-5
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-023-38568-5
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
