Axonal chemokine-like Orion induces astrocyte infiltration and engulfment during mushroom body neuronal remodeling

Boulanger, Ana; Thinat, Camille; Züchner, Stephan; Fradkin, Lee G.; Lortat-Jacob, Hugues; Dura, Jean-Maurice

doi:10.1038/s41467-021-22054-x

Download PDF

Article
Open access
Published: 23 March 2021

Axonal chemokine-like Orion induces astrocyte infiltration and engulfment during mushroom body neuronal remodeling

Nature Communications volume 12, Article number: 1849 (2021) Cite this article

3377 Accesses
9 Citations
11 Altmetric
Metrics details

Subjects

Abstract

The remodeling of neurons is a conserved fundamental mechanism underlying nervous system maturation and function. Astrocytes can clear neuronal debris and they have an active role in neuronal remodeling. Developmental axon pruning of Drosophila memory center neurons occurs via a degenerative process mediated by infiltrating astrocytes. However, how astrocytes are recruited to the axons during brain development is unclear. Using an unbiased screen, we identify the gene requirement of orion, encoding for a chemokine-like protein, in the developing mushroom bodies. Functional analysis shows that Orion is necessary for both axonal pruning and removal of axonal debris. Orion performs its functions extracellularly and bears some features common to chemokines, a family of chemoattractant cytokines. We propose that Orion is a neuronal signal that elicits astrocyte infiltration and astrocyte-driven axonal engulfment required during neuronal remodeling in the Drosophila developing brain.

Glia instruct axon regeneration via a ternary modulation of neuronal calcium channels in Drosophila

Article Open access 14 October 2023

LC3-associated phagocytosis promotes glial degradation of axon debris after injury in Drosophila models

Article Open access 29 May 2023

Drosophila FGFR/Htl signaling shapes embryonic glia to phagocytose apoptotic neurons

Article Open access 10 March 2023

Introduction

Neuronal remodeling is a widely used developmental mechanism, across the animal kingdom, to refine dendrite and axon targeting necessary for the maturation of neural circuits. Importantly, similar molecular and cellular events can occur during neurodevelopmental disorders or after nervous system injury^1,2,3,4. A key role for glial cells in synaptic pruning and critical signaling pathways between glia and neurons have been identified⁴. In Drosophila, the mushroom body (MB), a brain memory center, is remodeled at metamorphosis and MB γ neuron pruning occurs by a degenerative mechanism^5,6,7,8. Astrocytes surrounding the MB have an active role in the process; blocking their infiltration into the MBs prevents remodeling^9,10,11,12. MB γ neuron remodeling relies on two processes: axon fragmentation and the subsequent clearance of axonal debris. Importantly, it has been shown that astrocytes are involved in these two processes and that these two processes can be decoupled¹². Altering the ecdysone signaling in astrocytes, during metamorphosis, results both in a partial axon pruning defect, visualized as either some individual larval axons or as thin bundles of intact larval axons remaining in the adults, and also in a strong defect in clearance of debris, visualized by the presence of clusters of axonal debris. Astrocytes have only a minor role in axon severing as evidenced by the observation that most of the MB γ axons are correctly pruned when ecdysone signaling is altered in these cells. When astrocyte function is blocked, the γ axon-intrinsic fragmentation process remains functional and the majority of axons degenerate.

It has been widely proposed that a “find-me/eat-me” signal emanating from the degenerating γ neurons is necessary for astrocyte infiltration and engulfment of the degenerated larval axons^7,9,13. However, the nature of this glial recruitment signal is unclear.

Here, we have identified a gene (orion), not previously described, by screening for viable ethyl methanesulfonate (EMS)-induced mutations and not for lethal mutations in MB clones as was done previously^14,15. This allowed the identification of genes involved in glial cell function by directly screening for defects in MB axon pruning. We found that orion¹, a viable X-chromosome mutation, is necessary for both the pruning of some γ axons and removal of the resulting debris. We show that Orion is secreted from the neurons, remains near the axon membranes where it associates with infiltrating astrocytes, and is necessary for astrocyte infiltration into the γ bundle. This implies a role for an as-yet-undefined Orion receptor on the surface of the astrocytes. Orion bears some chemokine features, for example, a CX₃C motif, three glycosaminoglycan (GAG) binding consensus sequences that are required for its function. Altogether, our results identify a neuron-secreted extracellular messenger, which is likely to be the long-searched-for signal responsible for astrocyte infiltration and engulfment of the degenerated larval axons and demonstrate its involvement for neuronal remodeling.

Results and discussion

The orion gene is necessary for MB remodeling

Adult orion¹ individuals showed a clear and highly penetrant MB axon pruning phenotype as revealed by the presence of some adult unpruned vertical γ axons as well as the strong presence of debris (100% of mutant MBs; n = 100) (Fig. 1a, b, Table 1, and Supplementary Figs. 1 and 2). Astrocytes, visualized with alrm-GAL4, are the major glial subtype responsible for the clearance of the MB axon debris¹². The presence of γ axon debris is a landmark of defective astrocyte function, as was described^11,12, and is also further shown in this study (Supplementary Fig. 1a–d). The unpruned axon phenotype was particularly apparent during metamorphosis (Fig. 1c–h). At 24 h after puparium formation (APF), although γ axon branches were nearly completely absent in the wild-type control, they persisted in the orion¹ mutant brains, where we also observed a significant accumulation of debris (Fig. 1e, h). The number of unpruned axons at this stage is lower in orion¹ than in Hr39^C13 where the γ axon-intrinsic process of pruning is blocked (Supplementary Fig. 1e–g). In addition, the MB dendrite pruning was clearly affected in orion¹ individuals (Supplementary Fig. 1h–p).

Table 1 Unpruned axon and axon debris quantitation.

Full size table

The orion gene encodes for a CX₃C motif-containing secreted proteins

The orion¹ EMS mutation was localized by standard duplication and deficiency mapping as well as by whole-genome sequencing (Fig. 2a). The orion gene (CG2206) encodes two putatively secreted proteins: Orion-A (664 amino acid (a.a.)) and Orion-B (646 a.a.), whose messenger RNAs (mRNAs) arise from two different promoters (Fig. 2b–d). These two proteins differ in their N-terminal domains and are identical in the remainder of their sequences. The EMS mutation is a G to C nucleotide change inducing the substitution of the glycine (at position 629 for Orion-A and 611 for Orion-B) into an aspartic acid. The mutation lies in the common shared part and therefore affects both Orion-A and -B functions. Both isoforms display a signal peptide at their N termini, suggesting that they are secreted. Interestingly, a CX₃C chemokine signature is present in the Orion common region (Fig. 2b, c). Chemokines are a family of chemoattractant cytokines, characterized by a CC, CXC, or CX₃C motif, promoting the directional migration of cells within different tissues. Mammalian CX₃CL1 (also known as fractalkine) is involved in, among other contexts, neuron–glia communication^{16,17,18,19,20}. Mammalian Fractalkines display conserved intramolecular disulfide bonds that appear to be conserved with respect to their distance from the CX₃C motif present in both Orion isoforms (Fig. 2c). Fractalkine and its receptor, CX₃CR1, have been recently shown to be required for post-trauma cortical brain neuron microglia-mediated remodeling in a mouse whisker lesioning paradigm²¹. We observed that the change of the CX₃C motif into CX₄C or AX₃C blocked the Orion function necessary for the MB pruning (Supplementary Fig. 3a–c, h–j). Similarly, the removal of the signal peptide also prevented pruning (Supplementary Fig. 3d, h–j). These two results indicate that the Orion isoforms likely act as secreted chemokine-like molecules. We also produced three CRISPR/Cas9-mediated mutations in the orion gene, which either delete the common part (orion^∆C), the A-specific part (orion^∆A), or the B-specific part (orion^∆B). Noticeably, orion^∆C displayed the same MB pruning phenotype as orion¹, which is also the same in orion¹/Deficiency females, indicating that orion¹ and orion^∆C are likely null alleles for this phenotype. In contrast, orion^∆A and orion^∆B have no MB phenotype by themselves indicating the likelihood of functional redundancy between the two proteins in the pruning process (Supplementary Fig. 4).

**Fig. 2: The *orion* gene encodes for a CX₃C motif-containing protein.**

Orion is required and expressed by MB γ axons

Using the GAL4/UAS system²², we found that expression of wild-type orion in the orion¹ MB γ neurons (201Y-GAL4) fully rescued the MB mutant phenotype (100% of wild-type MBs n = 387; see quantitation in Supplementary Fig. 3h), although wild-type orion expression in the astrocytes (alrm-GAL4) did not rescue (Fig. 1i–k and Supplementary Fig. 5a–c). repo-GAL4 could not be used because of lethality when combined with UAS-orion. This supports the hypothesis that Orion is produced by axons and, although necessary for astrocyte infiltration, not by astrocytes. Both UAS-orion-A and UAS-orion-B rescued the orion¹ pruning phenotype indicating again a likely functional redundancy between the two proteins at least in the pruning process. Complementary to the rescue results, we found that the expression of an orion-targeting RNA interference (RNAi) in the MBs produced unpruned axons similar to that in orion¹, although the debris is not apparent likely due to an incomplete inactivation of the gene expression by the RNAi (Fig. 1l and Supplementary Fig. 5d). The expression of the same RNAi in the glia had no effect (Supplementary Fig. 5e). Using the mosaic analysis with a repressible cell marker (MARCM²³), we found that orion¹ homozygous mutant neuroblast clones of γ neurons, in orion¹/+ phenotypically wild-type individuals, were normally pruned (Supplementary Fig. 6a, b). Therefore, orion¹ is a non-cell-autonomous mutation that is expected if the Orion proteins are secreted. Orion proteins secreted by the surrounding wild-type axons rescue the pruning defects in the orion mutant clones.

From our genetic data, orion expression is expected in the γ neurons. The fine temporal transcriptional landscape of MB γ neurons was recently described and a corresponding resource is freely accessible²⁴. Noteworthy, orion is transcribed at 0 h APF and dramatically decreases at 9 h APF with a peak at 3 h APF (Supplementary Fig. 7). The nuclear receptors EcR-B1 and its target Sox14 are key transcriptional factors required for MB neuronal remodeling^6,7. orion was found to be a likely transcriptional target of EcR-B1 and Sox14²⁴ and this is also consistent with earlier microarray analysis observations²⁵. Noticeably, forced expression of UAS-EcR-B1 in the MBs did not rescue the orion mutant phenotype and EcR-B1 expression, in the MB nuclei, is not altered in orion¹ individuals (Supplementary Fig. 6c, f). Furthermore, the unpruned axon phenotype produced by orion RNAi is rescued by forced expression of EcR-B1 in the MBs (Supplementary Fig. 3h). Therefore, our genetic interaction analyses support orion being downstream of EcR-B1.

Extracellularly present Orion on MB γ axons

We focused our further molecular and cellular work on Orion-B alone since a functional redundancy between the two isoforms was apparent. We expressed the Orion-B protein in the γ neurons using an UAS-orion-B-Myc insert and the 201Y-GAL4 driver. Orion-B was present along the MB lobes and extracellularly present as visualized by anti-Myc staining (Fig. 3). Indeed, anti-Myc staining was particularly strong at the tip of the lobes indicating the presence of extracellular Orion-B (Fig. 3a, d, g, j, k). Synaptic terminals are condensed in the γ axon varicosities that disappear progressively during remodeling and hole-like structures corresponding to the vestiges of disappeared varicosities can be observed at 6 h APF⁹. We noted the presence of Myc-labeled Orion-B inside these hole-like structures (Fig. 3b, e, h). The secretion of the Orion proteins should be under the control of their signal peptide and, therefore, Orion proteins lacking their signal peptide (∆SP) should not show this “extracellular” phenotype. When UAS-orion-B-Myc-∆SP was expressed, Orion-B was not observed outside the axons or in the hole-like structures (Fig. 3c, f, i). We also excluded the possibility that this “extracellular” phenotype was due to some peculiarities of the Myc labeling by using a UAS-drl-Myc construct²⁶. Drl is a membrane-bound receptor tyrosine kinase and Drl-Myc staining, unlike Orion-B, was not observed outside the axons or in the hole-like structures (Supplementary Fig. 6g–l). In addition, the presence of Myc-labeled Orion-B protein not associated with green fluorescent protein (GFP)-labeled axon membranes can be observed outside the γ axon bundle in 3D reconstructing images (Fig. 3j, k). Nevertheless, these signals are possibly located inside the glial compartments and not as freely diffusing Orion protein (see below). Finally, supporting the hypothesis that Orion acts as a secreted protein, it has been reported to be present in biochemically purified exosomes, indicating that it may act on the glia via its presence on or in exosomes²⁷.

**Fig. 3: Orion is extracellularly present on MB γ axons.**

Orion is required for the infiltration of astrocytes into the MB γ bundle

Since glial cells are likely directly involved in the orion¹ pruning phenotype, we examined their behavior early during the pruning process. At 6 h APF the axon pruning process starts and is complete by 24 h APF, but the presence of glial cells in the vicinity of the wild-type γ lobes is already clearly apparent at 6 h APF⁹. We examined glial cells visualized by a membrane-targeted GFP (UAS-mGFP) under the control of repo-GAL4 and co-stained the γ axons with anti-Fas2. At 6 h APF, a striking difference was noted between wild-type and orion¹ brains. Unlike in the wild-type control, there is essentially no glial cell invasion of the γ bundle in the mutant (Fig. 4a–c). Interestingly, glial infiltration as well as engulfment of the degenerated larval axons was not observed in orion¹ neither at 12 h APF nor at 24 h APF (Supplementary Fig. 8a–h), suggesting that glial cells never infiltrate MBs in mutant individuals. We also ruled out the possibility that this lack of glial cell activity was due to a lower number of astrocytes in mutant versus wild-type brains (Supplementary Fig. 8i, j).

We also examined the proximity between MB Orion-Myc and astrocytes, as inferred from the shape of the glial cells, labeled with the anti-Drpr antibody at 6 h APF (Fig. 4d–f). We looked at the distribution along the vertical γ lobes (60 µm of distance, see “Methods”) of Orion-B-Myc (wild-type protein) and of Orion-B-∆SP-Myc (not secreted), in an otherwise wild-type background. We quantified only from images where an astrocyte sat on the top of the vertical lobe. A peak of Orion-Myc localization was always found (n = 10) in the axonal region close to the astrocyte (<7 µm) when wild-type Orion-B-Myc was quantified (Fig. 4g, i). However, this was not the case (n = 9) when Orion-B-∆SP-Myc was quantified (Fig. 4h, j). This strongly suggests that astrocytic processes may be “attracted” by secreted Orion.

Moreover, we observed that extracellularly present Orion stays close to axon membranes (Supplementary Fig. 9a–f). Protein, in particular chemokine, localization to membranes is often mediated by GAGs, a family of highly anionic polysaccharides that occur both at the cell surface and within the extracellular matrix. GAGs, to which all chemokines bind, ensure that these signaling proteins are presented at the correct site and time in order to mediate their functions²⁸. We identified three consensus sequences for GAG linkage in the common part of Orion (Fig. 2d). We mutated these sequences individually and assayed the mutant proteins for their ability to rescue the orion¹ pruning deficit in vivo. The three GAG sites are required for full Orion function, although mutating only GAG3 produced a strong mutant phenotype (Supplementary Fig. 3e–j).

Our findings imply a role for an as-yet-undefined Orion receptor on the surface of the glial cells. The glial receptor draper (drpr) seemed an obvious candidate^13,29,30,31, although Drpr ligands unrelated to Orion have been identified^32,33. The MB remodeling phenotypes in orion¹ and drpr^∆5 are, however, different with orion mutant phenotype being stronger than the drpr one. The use of an UAS-mGFP driven by 201Y-GAL4, instead of anti-Fas2, where the labeling of αβ axons often masks individual unpruned γ axons, allowed us to observe occasionally unpruned axons in drpr^∆5 1-week-old post-eclosion brains in addition to uncleared debris (Table 1 and Supplementary Fig. 2), indicating a certain degree of previously undescribed unpruned axon persistence in the mutant background¹³. Nevertheless, only orion mutant displayed a 100% penetrant phenotype of both unpruned axons and debris (strong category) in adult flies, which are still present in old flies. On the contrary, the weaker drpr mutant phenotype strongly decreases throughout adulthood (Table 1 and Supplementary Fig. 1). This suggests that Drpr is not an, or at least not the sole, Orion receptor.

Independently of the possible role of Drpr as an Orion receptor, we wished to test if Orion could activate the drpr signaling pathway as it is the case for neuron-derived injury released factors and Spätzle5 ligands, which bind to glial insulin-like receptors and Toll-6, respectively, upregulating in turn the expression of drpr in phagocytic glia^31,34. These ligands are necessary for axonal debris elimination and act as a find-me/eat-me signals in injury and apoptosis as Orion is doing for MB pruning. Our data indicate that Orion does not modify neither the Drpr expression nor the level of the drpr transcriptional activator STAT92E in astrocytes³⁵ (Supplementary Fig. 10). Consequently, Orion does not seem to induce the Drpr signaling pathway in astrocytes.

We have uncovered a neuronally secreted chemokine-like protein acting as a “find-me/eat-me” signal involved in the neuron–glia crosstalk required for axon pruning during developmental neuron remodeling. To the best of our knowledge, chemokine-like signaling in insects was not described previously and, furthermore, our results point to an unexpected conservation of chemokine CX₃C signaling in the modulation of neural circuits. Thus, it is possible that chemokine involvement in neuron/glial cell interaction is an evolutionarily ancient mechanism.

Methods

Drosophila stocks

All crosses were performed using standard culture medium at 25 °C. Except where otherwise stated, alleles have been described (http://flystocks.bio.indiana.edu). The following alleles were used: orion¹, orion^∆A, orion^∆B, and orion^∆C were generated in this study. drpr^Δ5rec8 was found to have an unlinked lethal mutation, which was removed by standard mitotic recombination over a wild-type chromosome^29,30. Animals bearing this version of drpr^Δ5 survive to adult stages and were used for this work. The following transgenes were used: UAS-orion-RNAi (VDRC stock 30843) and 2× UAS-drl-myc²⁶, 10X-Stat92E-GFP³⁶. UAS-orion-A, UAS-orion-A-myc, UAS-orion-B, UAS-orion-B-myc, UAS-orion-B-Mut AX3C-myc, UAS-orion-B-Mut CX4C-myc, UAS-orion-B-∆SP-myc, UAS-orion-B-Mut GAG1-myc, UAS-orion-B-Mut GAG2-myc, and UAS-orion-B-Mut GAG3-myc were generated in this study. We used three GAL4 lines: 201Y-GAL4 expressed in γ MB neurons, alrm-GAL4 expressed exclusively in glial astrocytes³⁷ and the pan-glial driver repo-GAL4 expressed in all glia³⁸.

Mutagenesis and screening

EMS mutagenesis was carried out following the published procedure³⁹. EMS treated y w^67c23 sn³ FRT19A males were crossed to FM7c/ph⁰ w females and stocks, coming from single y w^67c23 sn³ FRT19A/ FM7c female crossed to FM7c males, were generated. Only viable y w^67c23 sn³ FRT19A chromosome bearing stocks were kept and y w^67c23 sn³ FRT19A; UAS-mCD8-GFP 201Y-GAL4/+ adult males from each stock were screened for MB neuronal remodeling defect with an epi-fluorescence microscope (Leica DM 6000).

Mapping of orion

To broadly map the location of the EMS-induced mutation on the X-chromosome, we used males from the stocks described in the X-chromosome duplication kit (Bloomington Stock Center) that we crossed with orion¹; UAS-mCD8-GFP 201Y-GAL4 females. Dp(1;Y)BSC346 (stock 36487) completely rescued the orion¹ γ axon unpruned phenotype. This duplication is located at 6D3-6E2; 7D18 on the X chromosome. We then used smaller duplications covering this region. Thus, duplications Dp(1;3)DC496 (stock 33489) and Dp(1;3)DC183 (stock 32271) also rescued the orion¹ mutant phenotype. However, duplication Dp(1;3)DC184 (stock 30312) did not rescue the mutant phenotype. Overlapping of duplications indicates that the EMS mutation was located between 7C9 and 7D2, which comprises 72 kb. In addition, deficiency Def(1)C128 (stock 949, Bloomington Stock Center), which expand from 7D1 to 7D5-D6, complements orion¹ contrarily to deficiency Def(1)BSC622 (stock 25697, Bloomington Stock Center), which does not (see Fig. 2a). We named this gene orion since the debris present in mutant MBs resembles a star constellation.

Whole-genome sequencing

Gene mutation responsible for the unpruned γ axon phenotype was precisely located through the application of next-generation sequencing. Genomic DNA was extracted from 30 adult females (mutant and control) and directly sequenced on a HiSeq2000 next-generation sequencing platform (Illumina). Bioinformatics analysis for read alignment and variant investigation was carried out through the 72 kb selected by duplication mapping (see above) at the University of Miami Miller School of Medicine, Center for Genome Technology.

Signal peptide and transmembrane protein domain research

For prediction of signal peptide sequences, we used the PrediSi website⁴⁰: http://www.predisi.de; for transmembrane domains, we used the TMHMM Server, v 2.0⁴¹: http://www.cbs.dtu.dk/services/TMHMM/.

Orion and fractalkine alignments

The sequence of the region common to both Orion isoforms containing the CX₃C motifs and the likely conserved CX₃C-downstream cysteines and those of the human, mouse, and chicken fractalkine were aligned using the AlignX plug-in in the VectorNTi software package (Invitrogen) without permitting the introduction of spaces or deletions.

GAG binding site research

Identification of GAG binding sites in proteins, in the absence of structural data, is complicated by the diversity of both GAG structure and GAG binding proteins. Previous work based on heparin-binding protein sequence comparisons led to the proposition of two GAG binding consensus sequences, the XBBXBX and XBBBXXBX motifs (where B and X stand for basic and neutral/hydrophobic amino acids, respectively). A number of closely related basic clusters, including XBBXBXBX, were next experimentally identified⁴². Visual examination of the Orion-B sequences returned three such clusters (XBBXXBXXBXXBX: residues 242–254; XBBXBX: residues 416–421; and XBBXBXBX: residues 547–554, numbering includes the peptide signal, see Fig. 2d), which are also present in Orion-A.

CRISPR-Cas9 strategy

All guide RNA sequences (single guide RNA (sgRNA)) were selected using the algorithm targetfinder.flycrispr.neuro.brown.edu/ containing 20 nucleotides each (PAM excluded) and are predicted to have zero off-targets. We selected three pairs of sgRNA. Each pair is targeting either the A-specific region of orion, the B-specific region of orion, or the C common region of the two isoforms. We used the following oligonucleotide pairs: CRISPR-1 orion A fwd and CRISPR-1 orion A rev to target the A region, CRISPR-1 orion-B fwd and CRISPR-1 orion-B rev to target the B region, and CRISPR-1 orion common region C fwd and CRISPR-1 orion common region C rev to target the C region (see the corresponding oligonucleotide sequences in Supplementary Table I). We introduced two sgRNA sequences into pCFD4⁴³, a gift from Simon Bullock (Addgene, plasmid # 49411) by Gibson Assembly (New England Biolabs) following the detailed protocol at crisprflydesign.org. For PCR amplification, we used the protocol described on that website. Construct injection was performed by Bestgene (Chino Hills, CA) and all the transgenes were inserted into the same attP site (VK00027 at 89E11). Transgenic males expressing the different orion sgRNAs were crossed to y nos-Cas9 w* females bearing an isogenized X chromosome. One hundred crosses were set up for each sgRNA pair, with up to five males containing both the sgRNAs and nos-Cas9, and five FM7c/ph⁰ w females. From each cross, a single y nos-Cas9 w* /FM7c female was crossed with FM7c males to make a stock that was validated for the presence of an indel by genomic PCR with primers flanking the anticipated deletion and the precise endpoints of the deletion were determined by sequencing (Genewiz, France) using orion-specific primers.

Adult brain dissection, immunostaining, and MARCM mosaic analysis

Adult fly heads and thoraxes were fixed for 1 h in 3.7% formaldehyde in phosphate-buffered saline (PBS) and brains were dissected in PBS. For larval and pupal brains, brains were first dissected in PBS and then fixed for 15 min in 3.7% formaldehyde in PBS. They were then treated for immunostaining as described^23,44. Antibodies, obtained from the Developmental Studies Hybridoma Bank, were used at the following dilutions: mouse monoclonal anti-Fas2 (1D4) 1:10; mouse monoclonal anti-Draper (8A1), 1:400; and mouse monoclonal anti-Repo (8D1.2) 1:10. Mouse monoclonal primary antibody against EcR-B1 (AD4.4) was used at 1:5000⁴⁵. Polyclonal mouse (Abcam, (9E10) ab32) and rabbit (Cell Signaling, 71D10) anti-Myc antibodies were used at 1:1000 and 1:500, respectively. Goat secondary antibodies conjugated to Cy3, Alexa 488, and Cy5 against mouse or rabbit IgG (Jackson Immunoresearch Laboratory) were used at 1:300 for detection. To generate clones in the MB, we used the MARCM technique²³. First instar larvae were heat-shocked at 37 °C for 1 h. Adult brains were fixed for 15 min in 3.7% formaldehyde in PBS before dissection and GFP visualization.

Microscopy and image processing

Images were acquired at room temperature using a Zeiss LSM 780 laser scanning confocal microscope (MRI Platform, Institute of Human Genetics, Montpellier, France) equipped with a ×40 PLAN apochromatic 1.3 oil-immersion differential interference contrast objective lens. The immersion oil used was Immersol 518F. The acquisition software used was Zen 2011 (black edition). Contrast and relative intensities of the green (GFP), of the red (Cy3), and of the blue (Cy5 and Alexa 647) channels were processed with the ImageJ and Fiji software. Settings were optimized for detection without saturating the signal. For each set of figure settings were constants. However, since the expression of the Orion-B-Myc-∆SP protein is lower than the one of the Orion-B-Myc (as shown in the western blot and its quantitation Supplementary Fig. 3i–j), the levels of red were increased in this particular case in order to get similar levels than in Orion-B-Myc. We used the Imaris (Bitplane) software to generate a pseudo-3D structure of Orion-produced γ axons (Imaris surface tool). We created two 3D surfaces, from regular confocal images, defining the axonal domain (green) and the Orion expression domain (red).

Quantitation of immunolabelling

To quantify unpruned γ axons, we established three categories of phenotypes: “none,” when no unpruned axons are observed, “weak,” when few unpruned individual axons or thin axon bundles are observed in the dorsal lobe, and “strong,” when >50% of the axons are unpruned. In this last category, the percentage of unpruned axons is estimated by the width of the corresponding medial bundle compared with the width of the medial pruned axon bundle⁴⁴. For debris quantification, we established five categories: none, scattered dots, mild, intermediary, and strong based on the location and size of the debris clusters¹¹. In ≥1-week-old adults, “none” means the absence of debris. In ≤2-h-old adults “scattered dots” means some individual debris can be observed. We considered “mild,” if debris clusters (clusters >5 μm²) appear only at one location, “intermediary,” at two locations, and “strong,” at three locations of the MB. Three debris locations were considered: the tip of the vertical lobe, the tip of the medial lobe, and around the heel (bifurcation site of γ axons into dorsal and medial).

For EcR-B1 signal quantitation, we performed five measurements for each picture (intensity 1, …, 5) in the nuclei of GFP-positive cell bodies and the same number of measurements in the background using confocal single slices. The mean of these background measurements is called mean background. We then subtracted intensities of mean background from each intensity value (intensity 1, …, 5 minus mean background) to obtain normalized intensity values. Finally, we compared normalized intensity values between two genetic conditions. We proceeded similarly for Draper and STAT-GFP signal quantitation, but staining was quantified in the astrocyte cytoplasm located in the immediate vicinity of the γ dorsal lobe. Quantitation of intensity was performed using the ImageJ software.

To quantify the Myc signal in the γ vertical lobe, we traced a 60 µm line on the Cy3 red Z-stack and used the Plot Profile function of ImageJ to create a plot of intensity values across the line. The top of the line (0 µm) was located at the tip of the γ vertical lobe and the bottom of the line (60 µm) at the branching point of the two γ lobes. Only images containing an astrocyte sitting at the top of the γ vertical lobe were used to quantify Myc expression levels in orion-B- and orion-B-∆SP-expressing MBs.

To quantify the number of astrocytes around the γ lobes, we counted the number of glial nuclei, as labeled with anti-Repo antibody, contained in GFP-positive astrocyte cytoplasm labeled with UAS-mCD8-GFP driven by alrm-GAL4. We only counted nuclei contained within a circle of 70 µm of diameter centered in the middle of the vertical γ lobe tips.

UAS constructs

The orion-A cDNA (complementary DNA) inserted in the pOT2 plasmid (clone LD24308) was obtained from Berkeley Drosophila Genome Project (BDGP). Initial Orion-B cDNA as well as the Orion-B cDNAs containing mutations at the CX₃C and the GAG sites or lacking the signal peptide were produced at GenScript (Piscataway, NJ) in the pcDNA3.1-C-(k)DYK vector. The Orion-B cDNAs contained the following mutations:

To remove the signal peptide, we removed the sequence: GCGCCGCCTTTCGGATTATTAGCTGCTGTTGTTGCTGTTCTTGTCACGCTTGTGATTTGTGGAAATA located after the first ATG. At the CX₃C site: in AX₃C we exchanged TGC to GCC. In CX4C, we added an additional Ala (GCC) to get CAX₃C. To mutate the putative GAG binding sites, we exchanged Lys and Arg by Ala at the corresponding sites: AAGAGGACGGAACGCACACTAAAAATACTCAAG; AAGCGCAACCGA and CGCAGGGAGAAACTGCGT to GCCGCCACGGAAGCCACACTAGCCATACTCAAG, GCCGCCAACGCC, and GCCGCCGAGGCCCTGGCC, respectively, for mutations in GAG1, GAG2, and GAG3. The different constructs were amplified by PCR using forward primers containing sequences CACCaaaacATG (where ATG encodes the first methionine), followed by the specific orion-A or orion-B cDNA sequences and common reverse primers. To amplify orion-A, we used primers: orion-A fwd and orion-AB rev, and to amplify orion-B as well as orion-B containing mutations, we used primers: orion-B fwd and orion-AB rev. In addition, to amplify orion-∆SP, we used orion-B ∆SP fwd and orion-AB rev (see the corresponding oligonucleotide sequences in Supplementary Table I),

Amplified cDNA was processed for pENTR/D-TOPO cloning (Thermo Fisher Scientific, K240020) and constructs were subsequently sequenced (Genewiz, France). We used the Gateway LR clonase enzyme mix (Thermo Fisher Scientific, 11791019) to recombine the inserts into the destination UAS vector pJFRC81-GW-2× Myc (Lee G. Fradkin, unpublished), which was generated from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene, plasmid 36462 deposited by G. Rubin⁴⁶) by replacing the GFP ORF with a Gateway cassette adding on a C-terminal 2× Myc tag. orion-A, orion-B, and Myc-tagged constructs (orion A, orion-B, and orion-B mutants) transgenic fly lines (UASs) were generated at BestGene and all the transgenes were inserted into the same attP site (VK00027 in 89E11). All the crosses involving the UAS-GAL4 system were performed at 25 °C, except for UAS-orion-A and 201Y-GAL4, which were performed at 18 °C.

Western analysis

Five larval heads were homogenized in an Eppendorf tube containing 20 µl of 3× sample buffer (2% sodium dodecyl sulfate (SDS), 0.125 M Tris-HCl pH 6.9, 5% β-mercaptoethanol, 20% glycerol, bromophenol blue) and proteins were separated by SDS–polyacrylamide gel electrophoresis. After electrotransfer to nitrocellulose, the blot was blocked in PBS, 0.5% Tween-20, and 5% milk. The Orion-Myc and tubulin proteins were detected using a mouse anti-Myc antibody (clone 9E10, Abcam) and an anti-tubulin antibody (Sigma, T5168) at 1/1000 and 1/10,000, respectively, in PBS, 0.5% Tween-20, 5% milk, and revealed using anti-mouse Ig horseradish peroxidase (1:10,000) and an ECL kit (Amersham). Band intensities were normalized to the corresponding tubulin band intensity using the ImageJ software.

Statistics

Comparison between two groups expressing a qualitative variable was analyzed for statistical significance using the two-sided Fisher’s exact test. Comparison of two groups expressing a quantitative variable was analyzed using the two-sided nonparametric Mann–Whitney U test. (BiostaTGV: http://biostatgv.sentiweb.fr/?module=tests). Values of p < 0.05 were considered to be significant. Graphs were performed using the GraphPad Prism software (version 8.1.1).

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Data availability

The authors declare that the data supporting the findings of this study are available within the paper and Supplementary information files. Source data are provided with this paper.

References

Luo, L. & O’Leary, D. D. Axon retraction and degeneration in development and disease. Annu. Rev. Neurosci. 28, 127–156 (2005).
Article CAS PubMed Google Scholar
Neukomm, L. J. & Freeman, M. R. Diverse cellular and molecular modes of axon degeneration. Trends Cell Biol. 24, 515–523 (2014).
Article CAS PubMed PubMed Central Google Scholar
Schuldiner, O. & Yaron, A. Mechanisms of developmental neurite pruning. Cell. Mol. Life Sci. 72, 101–119 (2015).
Article CAS PubMed Google Scholar
Neniskyte, U. & Gross, C. T. Errant gardeners: glial-cell-dependent synaptic pruning and neurodevelopmental disorders. Nat. Rev. Neurosci. 18, 658–670 (2017).
Article CAS PubMed Google Scholar
Watts, R. J., Hoopfer, E. D. & Luo, L. Axon pruning during Drosophila metamorphosis: evidence for local degeneration and requirement of the ubiquitin-proteasome system. Neuron 38, 871–885 (2003).
Article CAS PubMed Google Scholar
Yu, F. & Schuldiner, O. Axon and dendrite pruning in Drosophila. Curr. Opin. Neurobiol. 27, 192–198 (2014).
Article CAS PubMed PubMed Central Google Scholar
Boulanger, A. & Dura, J. M. Nuclear receptors and Drosophila neuronal remodeling. Biochim. Biophys. Acta 1849, 187–195 (2015).
Article CAS PubMed Google Scholar
Yaniv, S. P. & Schuldiner, O. A fly’s view of neuronal remodeling. Wiley Interdiscip. Rev. Dev. Biol. 5, 618–635 (2016).
Article PubMed PubMed Central Google Scholar
Awasaki, T. & Ito, K. Engulfing action of glial cells is required for programmed axon pruning during Drosophila metamorphosis. Curr. Biol. 14, 668–677 (2004).
Article CAS PubMed Google Scholar
Watts, R. J., Schuldiner, O., Perrino, J., Larsen, C. & Luo, L. Glia engulf degenerating axons during developmental axon pruning. Curr. Biol. 14, 678–684 (2004).
Article CAS PubMed Google Scholar
Tasdemir-Yilmaz, O. E. & Freeman, M. R. Astrocytes engage unique molecular programs to engulf pruned neuronal debris from distinct subsets of neurons. Genes Dev. 28, 20–33 (2014).
Article CAS PubMed PubMed Central Google Scholar
Hakim, Y., Yaniv, S. P. & Schuldiner, O. Astrocytes play a key role in Drosophila mushroom body axon pruning. PLoS ONE 9, e86178 (2014).
Article ADS PubMed PubMed Central CAS Google Scholar
Awasaki, T. et al. Essential role of the apoptotic cell engulfment genes draper and ced-6 in programmed axon pruning during Drosophila metamorphosis. Neuron 50, 855–867 (2006).
Article CAS PubMed Google Scholar
Lee, T., Marticke, S., Sung, C., Robinow, S. & Luo, L. Cell-autonomous requirement of the USP/EcR-B ecdysone receptor for mushroom body neuronal remodeling in Drosophila. Neuron 28, 807–818 (2000).
Article CAS PubMed Google Scholar
Zheng, X. et al. TGF-beta signaling activates steroid hormone receptor expression during neuronal remodeling in the Drosophila brain. Cell 112, 303–315 (2003).
Article CAS PubMed Google Scholar
Paolicelli, R. C., Bisht, K. & Tremblay, M. E. Fractalkine regulation of microglial physiology and consequences on the brain and behavior. Front. Cell. Neurosci. 8, 129 (2014).
Article PubMed PubMed Central CAS Google Scholar
Arnoux, I. & Audinat, E. Fractalkine signaling and microglia functions in the developing brain. Neural Plast. 2015, 689404 (2015).
Article PubMed PubMed Central Google Scholar
Werneburg, S., Feinberg, P. A., Johnson, K. M. & Schafer, D. P. A microglia-cytokine axis to modulate synaptic connectivity and function. Curr. Opin. Neurobiol. 47, 138–145 (2017).
Article CAS PubMed PubMed Central Google Scholar
Luo, P., Chu, S. F., Zhang, Z., Xia, C. Y. & Chen, N. H. Fractalkine/CX3CR1 is involved in the cross-talk between neuron and glia in neurological diseases. Brain Res. Bull. 146, 12–21 (2019).
Article CAS PubMed Google Scholar
Wilton, D. K., Dissing-Olesen, L. & Stevens, B. Neuron-glia signaling in synapse elimination. Annu. Rev. Neurosci. 42, 107–127 (2019).
Article CAS PubMed Google Scholar
Gunner, G. et al. Sensory lesioning induces microglial synapse elimination via ADAM10 and fractalkine signaling. Nat. Neurosci. 22, 1075–1088 (2019).
Article CAS PubMed PubMed Central Google Scholar
Brand, A. H. & Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401–415 (1993).
CAS PubMed Google Scholar
Lee, T. & Luo, L. Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron 22, 451–461 (1999).
Article CAS PubMed Google Scholar
Alyagor, I. et al. Combining developmental and perturbation-seq uncovers transcriptional modules orchestrating neuronal remodeling. Dev. Cell 47, 38–52 e36 (2018).
Article CAS PubMed PubMed Central Google Scholar
Hoopfer, E. D., Penton, A., Watts, R. J. & Luo, L. Genomic analysis of Drosophila neuronal remodeling: a role for the RNA-binding protein Boule as a negative regulator of axon pruning. J. Neurosci. 28, 6092–6103 (2008).
Article CAS PubMed PubMed Central Google Scholar
Reynaud, E. et al. Guidance of Drosophila mushroom body axons depends upon DRL-Wnt receptor cleavage in the brain dorsomedial lineage precursors. Cell Rep. 11, 1293–1304 (2015).
Article CAS PubMed Google Scholar
Thomas, R. E. et al. Glucocerebrosidase deficiency promotes protein aggregation through dysregulation of extracellular vesicles. PLoS Genet. 14, e1007694 (2018).
Article PubMed PubMed Central CAS Google Scholar
Monneau, Y., Arenzana-Seisdedos, F. & Lortat-Jacob, H. The sweet spot: how GAGs help chemokines guide migrating cells. J. Leukoc. Biol. 99, 935–953 (2016).
Article CAS PubMed Google Scholar
Freeman, M. R., Delrow, J., Kim, J., Johnson, E. & Doe, C. Q. Unwrapping glial biology: Gcm target genes regulating glial development, diversification, and function. Neuron 38, 567–580 (2003).
Article CAS PubMed Google Scholar
MacDonald, J. M. et al. The Drosophila cell corpse engulfment receptor Draper mediates glial clearance of severed axons. Neuron 50, 869–881 (2006).
Article CAS PubMed Google Scholar
Musashe, D. T., Purice, M. D., Speese, S. D., Doherty, J. & Logan, M. A. Insulin-like signaling promotes glial phagocytic clearance of degenerating axons through regulation of draper. Cell Rep. 16, 1838–1850 (2016).
Article CAS PubMed PubMed Central Google Scholar
Kuraishi, T. et al. Pretaporter, a Drosophila protein serving as a ligand for Draper in the phagocytosis of apoptotic cells. EMBO J. 28, 3868–3878 (2009).
Article CAS PubMed PubMed Central Google Scholar
Lin, L. et al. Complement-related regulates autophagy in neighboring cells. Cell 170, 158–171 e158 (2017).
Article CAS PubMed PubMed Central Google Scholar
McLaughlin, C. N., Perry-Richardson, J. J., Coutinho-Budd, J. C. & Broihier, H. T. Dying neurons utilize innate immune signaling to prime glia for phagocytosis during development. Dev. Cell 48, 506–522 e506 (2019).
Article CAS PubMed PubMed Central Google Scholar
Doherty, J. et al. PIK3 signaling and Stat92E converge to modulate glial responsiveness to axonal injury. PLoS Biol. 12, e1001985 (2014).
Article PubMed PubMed Central CAS Google Scholar
Bach, E. A. et al. GFP reporters detect the activation of the Drosophila JAK/STAT pathway in vivo. Gene Expr. Patterns 7, 323–331 (2007).
Article CAS PubMed Google Scholar
Doherty, J., Logan, M. A., Tasdemir, O. E. & Freeman, M. R. Ensheathing glia function as phagocytes in the adult Drosophila brain. J. Neurosci. 29, 4768–4781 (2009).
Article CAS PubMed PubMed Central Google Scholar
Sepp, K. J., Schulte, J. & Auld, V. J. Developmental dynamics of peripheral glia in Drosophila melanogaster. Glia 30, 122–133 (2000).
Article CAS PubMed Google Scholar
Lewis, E. B. & Bacher, F. Method of feeding ethyl methane sulfonate (EMS) to Drosophila males. Dros. Inf. Serv. 43, 193 (1968).
Hiller, K., Grote, A., Scheer, M., Munch, R. & Jahn, D. PrediSi: prediction of signal peptides and their cleavage positions. Nucleic Acids Res. 32, W375–379 (2004).
Article CAS PubMed PubMed Central Google Scholar
Krogh, A., Larsson, B., von Heijne, G. & Sonnhammer, E. L. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305, 567–580 (2001).
Article CAS PubMed Google Scholar
Vives, R. R. et al. A novel strategy for defining critical amino acid residues involved in protein/glycosaminoglycan interactions. J. Biol. Chem. 279, 54327–54333 (2004).
Article CAS PubMed Google Scholar
Port, F., Chen, H. M., Lee, T. & Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc. Natl Acad. Sci. USA 111, E2967–2976 (2014).
Article CAS PubMed PubMed Central Google Scholar
Boulanger, A. et al. ftz-f1 and Hr39 opposing roles on EcR expression during Drosophila mushroom body neuron remodeling. Nat. Neurosci. 14, 37–44 (2011).
Article CAS PubMed Google Scholar
Talbot, W. S., Swyryd, E. A. & Hogness, D. S. Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell 73, 1323–1337 (1993).
Article CAS PubMed Google Scholar
Pfeiffer, B. D., Truman, J. W. & Rubin, G. M. Using translational enhancers to increase transgene expression in Drosophila. Proc. Natl Acad. Sci. USA 109, 6626–6631 (2012).
Article ADS CAS PubMed PubMed Central Google Scholar
Hoover, D. M., Mizoue, L. S., Handel, T. M. & Lubkowski, J. The crystal structure of the chemokine domain of fractalkine shows a novel quaternary arrangement. J. Biol. Chem. 275, 23187–23193 (2000).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank Amélie Babled, Pascal Carme, and Dana Bis-Brewer for help in the EMS mutagenesis, MB developmental studies, and WGS analysis, respectively, and Oren Schuldiner for discussions about the Orion expression and function. We also thank Marc Freeman for alrm-GAL4 stock, Baeg Gyeong Hun for 10X-STAT92E-GFP stock, the Bloomington Drosophila Stock Center and VDRC for fly stocks, the BioCampus RAM-Drosophila facility (Montpellier, France), the imaging facility MRI, which is part of the UMS BioCampus Montpellier and a member of the National Infrastructure France-BioImaging, supported by the French National Research Agency (ANR-10-INBS-04) for help in confocal and image analysis and processing. We acknowledge BDGP, BestGene, GenScript, and Genewiz for cDNA clone, transgene service, gene synthesis, and DNA-sequencing, respectively. The 1D4 anti-Fasciclin II hybridoma and the 8D12 anti-Repo monoclonal antibody developed by Corey Goodman and the 8A1 anti-Draper monoclonal antibody developed by Mary Logan were obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of the NIH and maintained at The University of Iowa, Department of Biology, Iowa City, IA 52242. C.T. was supported by grants from the INSB at the CNRS and from the Fondation pour la Recherche Médicale. Work in the laboratory of J.-M.D. was supported by the Centre National de la Recherche Scientifique, the Association pour la Recherche sur le Cancer (grants SFI20121205950 and PJA 20151203422) and the Fondation pour la Recherche Médicale (Program “EQUIPES FRM2016” project DEQ20160334870).

Author information

These authors jointly supervised this work: Ana Boulanger, Jean-Maurice Dura.

Authors and Affiliations

IGH, Centre National de la Recherche Scientifique, Univ Montpellier, Montpellier, France
Ana Boulanger, Camille Thinat & Jean-Maurice Dura
Dr. John T. Macdonald Foundation Department of Human Genetics and John P. Hussman Institute for Human Genomics, University of Miami, Miami, FL, USA
Stephan Züchner
Department of Neurobiology, University of Massachusetts Medical School, Worcester, MA, USA
Lee G. Fradkin
Institut de Biologie Structurale, UMR 5075, University Grenoble Alpes, Centre National de la Recherche Scientifique, Commissariat à l’Énergie Atomique et aux Énergies Alternatives, Université Grenoble Alpes, Grenoble, France
Hugues Lortat-Jacob

Authors

Ana Boulanger
View author publications
You can also search for this author in PubMed Google Scholar
Camille Thinat
View author publications
You can also search for this author in PubMed Google Scholar
Stephan Züchner
View author publications
You can also search for this author in PubMed Google Scholar
Lee G. Fradkin
View author publications
You can also search for this author in PubMed Google Scholar
Hugues Lortat-Jacob
View author publications
You can also search for this author in PubMed Google Scholar
Jean-Maurice Dura
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

A.B. and J.-M.D. designed the project; A.B., C.T., and J.-M.D. performed the experiments; A.B., S.Z., L.G.F., H.L.-J., and J.-M.D. analyzed the data; A.B. and J.-M.D. wrote the original draft of the manuscript; A.B., L.G.F., H.L.-J., and J.-M.D. reviewed and edited the manuscript.

Corresponding authors

Correspondence to Ana Boulanger or Jean-Maurice Dura.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Peer review information Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Boulanger, A., Thinat, C., Züchner, S. et al. Axonal chemokine-like Orion induces astrocyte infiltration and engulfment during mushroom body neuronal remodeling. Nat Commun 12, 1849 (2021). https://doi.org/10.1038/s41467-021-22054-x

Download citation

Received: 10 March 2020
Accepted: 25 February 2021
Published: 23 March 2021
DOI: https://doi.org/10.1038/s41467-021-22054-x

This article is cited by

Experience-dependent glial pruning of synaptic glomeruli during the critical period
- Nichalas Nelson
- Dominic J. Vita
- Kendal Broadie
Scientific Reports (2024)
Mechanisms governing activity-dependent synaptic pruning in the developing mammalian CNS
- Travis E. Faust
- Georgia Gunner
- Dorothy P. Schafer
Nature Reviews Neuroscience (2021)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.