The NMDA receptor regulates competition of epithelial cells in the Drosophila wing

Banreti, Agnes R.; Meier, Pascal

doi:10.1038/s41467-020-16070-6

Download PDF

Article
Open access
Published: 06 May 2020

The NMDA receptor regulates competition of epithelial cells in the Drosophila wing

Nature Communications volume 11, Article number: 2228 (2020) Cite this article

5981 Accesses
16 Citations
26 Altmetric
Metrics details

Subjects

Abstract

Cell competition is an emerging principle that eliminates suboptimal or potentially dangerous cells. For ‘unfit’ cells to be detected, their competitive status needs to be compared to the collective fitness of cells within a tissue. Here we report that the NMDA receptor controls cell competition of epithelial cells and Myc supercompetitors in the Drosophila wing disc. While clonal depletion of the NMDA receptor subunit NR2 results in their rapid elimination via the TNF/Eiger>JNK signalling pathway, local over-expression of NR2 causes NR2 cells to acquire supercompetitor-like behaviour that enables them to overtake the tissue through clonal expansion that causes, but also relies on, the killing of surrounding cells. Consistently, NR2 is utilised by Myc clones to provide them with supercompetitor status. Mechanistically, we find that the JNK>PDK signalling axis in ‘loser’ cells reprograms their metabolism, driving them to produce and transfer lactate to winners. Preventing lactate transfer from losers to winners abrogates NMDAR-mediated cell competition. Our findings demonstrate a functional repurposing of NMDAR in the surveillance of tissue fitness.

Transient loss of Polycomb components induces an epigenetic cancer fate

Article Open access 24 April 2024

Emx2 underlies the development and evolution of marsupial gliding membranes

Article Open access 24 April 2024

Collective intelligence: A unifying concept for integrating biology across scales and substrates

Article Open access 28 March 2024

Introduction

Cell competition is an evolutionary conserved quality control process, which ensures that suboptimal, but otherwise viable, cells do not accumulate during development and aging¹. How relative fitness disparities are measured across groups of cells, and how the decision is taken whether a particular cell will persist in the tissue (‘winner cell’) or is killed (‘loser cell’) is not completely understood. This is an important issue as competitive behaviour can be exploited by cancer cells¹.

Various types of cell competition exist². While structural cell competition is triggered upon loss of cellular adhesion or changes in epithelial apico-basal polarity, metabolic cell competition occurs in response to alterations in cellular metabolic states. Growth signalling pathways involved in metabolic cell competition seem to funnel through Myc, which functions as an essential signalling hub in many types of cancers. Myc regulates expression of components that control proliferation, cell death, differentiation, and central metabolic pathways. Particularly, acute changes in cellular metabolism appear to be critical for the winner phenotype during Myc supercompetition in Drosophila³, where robustly growing Myc-expressing cells are able to not only outgrow but also actively trigger the elimination of nearby wild-type cells from the tissue.

Recent in vivo data demonstrate that some tumours can uptake lactate and preferentially utilize it over glucose to fuel tricarboxylic acid (TCA) cycle and sustain tumour metabolism⁴. Moreover, the growth-promoting effect of stromal cells is impaired by glycolytic inhibition, suggesting that the stroma provides nutritional support to malignant cells by transferring lactate from cancer-associated fibroblasts (CAFs) to cancer cells^5,6. Such energy transfer from glycolytic stromal cells to epithelial cancer cells closely resembles the physiological processes of metabolic cooperativity, such as in ‘neuron-astrocyte metabolic coupling’ in the brain, and the ‘lactate shuttle’ in the skeletal muscle^7,8. Activation of glycolysis in astrocytes and MCT-mediated transfer of lactate to neurons supports neuron mitochondrial oxidative phosphorylation and energy demand⁹. These observations raise the intriguing possibility that lactate serves as fuel to complement glucose metabolism during cell competition.

We report here that the NMDA receptor controls the competitiveness of epithelial cells in the Drosophila wing discs. While tissue-wide depletion of NR2 has no effect on cell viability and growth, clonal depletion of NR2 results in their rapid elimination via the TNF>JNK signalling pathway. Conversely, local over-expression of NR2 causes NR2-overexpressing cells to acquire supercompetitor-like behaviour that enables them to overtake the tissue. These data indicate that relative levels of NR2 underpins cell competitive behaviour in the wing epithelia. Moreover, we find that Myc-induced supercompetition also depends on upregulation of NMDAR. Genetic depletion of NR2 abrogates Myc-induced supercompetition. Mechanistically, we find that the JNK>PDK signalling axis in ‘loser’ cells (lower NMDAR) results in phosphorylation and inactivation of PDH, the enzyme that converts pyruvate to Acetyl-CoA to fuel the TCA in the mitochondria. In such loser cells, phospho-dependent inactivation of PDH causes mitochondrial shutdown and metabolic reprogramming, thus loser cells produce and secrete lactate to winners. Preventing lactate transfer from losers to winners removes fitness disparities and abrogates NMDAR-mediated cell competition. Together our data are consistent with the notion that NMDAR underpins cell competition and that targeting NMDAR converts Myc supercompetitor clones into superlosers.

Results

NR2 drives cell competition

In Drosophila, polarity-deficient mutant cells for discs large 1 (dlg1) are eliminated by wild-type neighbours through cell competition¹⁰. dlg1 is the highly conserved homologue of mammalian PSD-95 and SAP97. In mammals, PSD-95 and SAP97 directly bind to NR2B^11,12, a subunit of the N-methyl-D-aspartate receptor (NMDAR). We, therefore, investigated whether NMDAR takes part in cell competition. While mammals encode seven different NMDAR subunits, Drosophila encodes only two NMDAR subunits (NR1 and NR2) (Fig. 1a), which simplifies their study. Consistent with previous reports^13,14, we find that Drosophila NR2 is expressed in the central nervous system, imaginal eye and wing discs as well as salivary gland and fat body (Supplementary Fig. 1a–c)^14,15,16. To study the role of NR2 in cell competition in wing discs, we generated mosaic tissues of two clonal populations. This confronts wild-type cells (WT) with clones of cells in which the gene-of-interest (goi) is depleted by RNAi (marked by GFP (green fluorescent protein)) (Fig. 1b, left panel). We also, generated homotypic settings in which the goi is depleted tissue-wide, and where we created GFP-marked ‘non-competitive clones’ to evaluate intrinsic competition (Fig. 1b, right panel). Comparison of clonal occupancy in hetero- versus homotypic genetic backgrounds of age-matched larvae allows the exclusion of genes that compromise cell viability in general. Interestingly, clonal knockdown of NR2 (subsequently referred to as NR2 clones) using five different RNAi constructs (Fig. 1a, c, d) resulted in the loss of NR2 clones (Fig. 1c, d). Likewise, and as previously demonstrated^17,18, clonal knockdown of dlg1 or scribble (scrib) resulted in their elimination (Fig. 1d and Supplementary Fig. 2a). In contrast, clonal depletion of LacZ, which served as RNAi control, had no effect (Fig. 1c, d). Importantly, RNAi-mediated depletion of NR2 or dlg1 had no effect on clonal occupancy under homotypic condition, such as upon tissue-wide NR2 depletion using nubbin-Gal4 (Fig. 1e, f, and Supplementary Fig. 2b) or hedgehog (hh-Gal4) (Supplementary Fig. 2c) that drive expression of the RNAi constructs in the entire wing pouch or posterior compartment of the Drosophila wing imaginal disc, respectively. The observation that NR2-depleted cells are lost from the tissue when surrounded by WT cells, but are present under homotypic conditions, suggests that clonal depletion of NR2 triggers competitive interactions, resulting in the loss of otherwise viable cells.

**Fig. 1: Clonal depletion of NR2 results in the elimination of otherwise viable cells.**

Homotypic clonal analysis demonstrated that the intrinsic growth rate of NR2 clones is equivalent to the one of control LacZ cells (Fig. 1g), highlighting that NR2 depletion does not impair cell viability or growth in general. Further, treatment with AP5 ((2R)-amino-5-phosphonopentanoate), a selective inhibitor of NR2¹⁹, suppressed the loss of NR2 clones in a heterotypic genetic background (losers among winners) (Supplementary Fig. 3a, b), phenocopying a homotypic setting. This illustrates that the competitive behaviour between NR2-losers and WT-winners is due to a relative difference in NR2 activity among competing clones. AP5-medited global inhibition of NR2 thereby seems to eradicate the fitness disparity among competing clones.

Next, we examined the consequence of clonal over-expression of NR2. As shown in Fig. 1h, i, NR2 over-expressing clones overgrew at the expense of wild-type surrounding cells. This suggests that elevated expression of NR2 causes NR2 cells to acquire supercompetitor-like behaviour that enables them to overtake the tissue. Of note, clonal over-expression of NR2 did not alter developmental timing, organ or larval size (Fig. 1j). Together, our data indicate that relative levels of NR2 underpins cell competitive behaviour in the wing epithelia.

NR2 loser clones are eliminated by TNF > JNK-mediated apoptosis

To study the elimination process of NR2-depleted cells, we examined the possible involvement of the Grindelwald>JNK signalling axis²⁰. We noticed intense staining of activated JNK [p-JNK] (Fig. 2a), induction of the JNK activity reporter PucLacZ (Supplementary Fig. 4a) and high expression level of the JNK target gene MMP1 in and around NR2 clones (Fig. 2b), suggesting an involvement of JNK signalling. Consistently, while NR2-depleted cells were readily eliminated, such clones survived upon simultaneous, clonal depletion of the Drosophila TNF-receptor superfamily member grindelwald (grnd) (grnd-RNAi), hemipterous (hep) (hep-RNAi) or inactivation of basket (bsk) (UAS-bsk-dominant negative (DN)). This demonstrates that NR2-depleted clones are eliminated in a grnd- and JNK-dependent manner (Fig. 2c). JNK signalling in NR2-depleted clones ultimately resulted in caspase-mediated cell death because expression of the caspase inhibitors p35 and DIAP1 suppressed the elimination of NR2-depleted clones (Fig. 2c). Consistently, we observed cells positive for cleaved caspase staining (Supplementary Fig. 4b). Clonal depletion of NR2 (RNAi) sometimes lead to distortions of the disc, which most likely was due to the large amount of cell death (loser clone elimination) that occurs in these discs.

**Fig. 2: NR2 loser clones are eliminated by apoptosis via the TNF>JNK signalling axis.**

Metabolic reprogramming and lactate production by losers

We noticed that NR2-depleted clones appeared to have mitochondria that were less active and smaller in size (Fig. 3a, b). To explore this further, we investigated whether JNK signalling might influence mitochondrial function in NR2-depleted clones. Intriguingly, we noticed prominent JNK-dependent phosphorylation of Pyruvate Dehydrogenase (PDH), a key enzyme that catalyses the conversion of pyruvate into acetyl-CoA to be consumed in mitochondria under heterotypic (Fig. 3c and Supplementary Fig. 5a–d) but not homotypic settings (Supplementary Fig. 5e). Previous reports indicated that JNK signalling can lead to activation of the mitochondrial Pyruvate Dehydrogenase Kinase (PDK), which in turn can phosphorylate and inactivate PDH²¹. Upon phosphorylation of PDH, pyruvate is no longer converted to acetyl-CoA and therefore no longer available for the TCA in mitochondria, leading to metabolic reprogramming²². To test the importance of PDK-mediated phosphorylation of PDH (p-PDH) for the elimination of NR2-RNAi loser clones we co-depleted PDK in such clones. Interestingly, co-depletion of PDK fully rescued the elimination of NR2 loser clones (Fig. 3d, e) and abrogated the appearance of cleaved DCP1 positive cells (Supplementary Fig. 5f). Likewise, Gal4-driven expression of PDH in NR2 loser clones blocked their elimination (Fig. 3e and Supplementary Fig. 6a). In both settings, surviving NR2-depleted clones were negative for anti-p-PDH staining (Fig. 3d and Supplementary Fig. 6a). Local over-expression of PDH abrogated JNK signalling (Supplementary Fig. 6b), highlighting the presence of a feedback regulatory loop. Together, these data indicate that PDK-mediated phosphorylation and inactivation of PDH contributes to the death of NR2-depleted loser clones.

**Fig. 3: The TNF>JNK>PDK>PDH signalling axis reprograms the metabolism of NR2 loser clones.**

Loser cells transfer their lactate to winners

Since inactivation of PDH results in aerobic glycolysis, we assessed whether metabolic reprogramming of NR2-RNAi loser cells might cause elevated lactate production and secretion (Fig. 4a). To detect relative differences in lactate levels in loser and winner cells, we used a genetically encoded lactate reporter (UAS-lactate FRET)²³, which we expressed throughout the entire tissue (nub-Gal4, UAS-lactate FRET). Clonal analysis was conducted via the LexA/lexO binary system²⁴. We found that NR2-RNAi loser clones had substantially lower levels of intracellular lactate than surrounding wild-type cells or control clones (Fig. 4b). Importantly, blocking lactate exchange via RNAi-mediated knockdown of monocarboxylate transporter 1 (Mct1) rescued lactate reduction in loser cells. Co-depletion of Mct1 not only prevented reduction of lactate in loser clones but also caused significant lactate accumulation (Fig. 4c). No such changes in lactate levels were seen under non-competitive control conditions (Fig. 4c). Ex vivo treatment with MCT inhibitors (MCTi) also led to a relative increase of lactate in losers, while it caused a corresponding decrease of lactate in surrounding winners (Fig. 4d). Feeding l-lactic acid (LLA) to animals, like treating them with MCTi, suppressed lactate reduction in NR2loser clones (Fig. 4e). Together, these data are consistent with the notion that NR2-depleted loser cells are metabolically reprogrammed to produce and secrete lactate.

The transfer of lactate underpins cell competition

Next, we tested the role of lactate exchange in loser cell elimination. Because lactate feeding restored intracellular lactate levels in NR2-RNAi clones, we tested whether this might block cell competition. Intriguingly, lactate feeding inhibited the elimination of NR2-RNAi clones (Fig. 5a–c). Consistent with the notion that lactate transport from NR2 losers to winners is important for loser/winner relationships and cell competition, we found that blocking loser cells to produce and transport lactate to winner cells rescued loser cell elimination. Accordingly, concomitant down-regulation of the lactate dehydrogenase ImpL3 in NR2 loser clones, like co-knockdown of the lactate transporter Mct1, rescued the elimination of NR2 clones (Fig. 5b, c). This effect was specific to MCT1, as silencing the putative monocarboxylate transporters CG13907 or CG3409 within loser clones had no effect on NR2 loser cell elimination (Fig. 5c). Pharmacological inhibition of MCT1 also blocked cell competition and the elimination of NR2 loser clones (Fig. 5b, c). Consistent with these results, we observed elevated levels of MCT1 in NR2-RNAi cells (Supplementary Fig. 7). Together, these data suggest that preventing loser cells from transferring lactate to their neighbours inhibits cell competition.

**Fig. 5: NR2 controls cell competition by regulating lactate-mediated metabolic coupling between winners and losers.**

Lactate-mediated metabolic coupling in Myc-supercompetition

In mosaic wing imaginal discs, interactions between WT and Myc-expressing cells cause them to acquire ‘supercompetitor’ behaviour that increases their fitness and enables them to overtake the tissue by killing their WT neighbours^25,26. To address whether lactate-mediated metabolic coupling might also influence loser/Myc-supercompetitor relationships we first monitored the phosphorylation status of PDH in competing cell populations. Under control conditions, no p-PDH staining was apparent in WT cells (Fig. 6a). However, prominent p-PDH staining was detectable in WT cells that were juxtaposed to Myc winner clones (Fig. 6a–c and Supplementary Fig. 8a, b) but not homotypic controls (Supplementary Fig. 8c). Accordingly, elevated intracellular lactate level was detected in Myc cells juxtaposed to loser clones (Fig. 6d). Consistent with the notion that loser cells produce and transfer lactate to winners, we found that ex vivo treatment with MCT inhibitors (MCTi), which blocks lactate exchange, led to a time-dependent relative increase of lactate in losers, while it caused a corresponding relative decrease of lactate in Myc winners (Fig. 6e). This indicates that Myc supercompetitor cells receive and consume lactate from losers. Accordingly, lactate feeding suppressed Myc-mediated supercompetition (Supplementary Fig. 8d, e). Moreover, we found that pharmacological inhibition of MCT1 suppressed Myc supercompetition (Supplementary Fig. 8d–g). Consistently, we found that Myc clones seemed to have highly active mitochondria whose activity was dependent on NR2 (Fig. 6f). Together, our data indicate that loser cells produce and secrete lactate, while winner clones receive and consume lactate. Our data are in agreement with recent studies^4,27, demonstrating that in vivo some cancer cells preferentially consume lactate instead of generating lactate as a waste product²⁸.

**Fig. 6: Lactate-mediated metabolic coupling occurs during loser and Myc supercompetition.**

NR2 is required for the supercompetitior status of Myc cells

To test the potential role of NR2 for the supercompetitor status of Myc-expressing cells, we first examined the levels of NR2 in Myc clones. As shown in Fig. 7a–e, Myc supercompetitor clones exhibited higher levels of NR2 than surrounding wild-type neighbours, both in the wing disc as well as fat body. Furthermore, endogenous variation in the expression levels of NR2 (monitored by NR2-Gal4; UAS-GFP) showed a correlation with Myc expression levels (anti-Myc immunostaining) (Fig. 7f–g). The upregulation of NR2 was competition-dependent, as in a homotypic context, no difference in NR2 expression was observed between Myc expressing cells (driven with hh-Gal4) and wild-type cells (Supplementary Fig. 9).

**Fig. 7: NR2 is upregulated in supercompetitior Myc-expressing cells.**

To test whether NR2 contributes to the supercompetitor status of Myc during cell competition, we depleted NR2 in Myc supercompetitor clones. While clonal expression of Myc on its own resulted in large clones, such Myc winners were eliminated when NR2 was simultaneously knocked down in these clones (Fig. 8a, b). Importantly, Myc-expressing NR2 clones were eliminated only in heterotypic settings, when surrounded by WT cells. Accordingly, tissue-wide (nub-Gal4) expression of Myc;NR2-RNAi did not lead to the elimination of GFP + non-competitive clones, demonstrating that such Myc;NR2-RNAi clones are intrinsically viable (Fig. 8c), but when surrounded by WT cells are eliminated via cell competition and caspase-mediated cell death (Fig. 8d). Importantly, under conditions where NR2 was depleted tissue-wide, Myc clones no longer acquired supercompetitor status. Accordingly, wild-type cells (marked with GFP) were no longer eliminated by Myc clones (Fig. 8e, f). Likewise, treatment with the NMDAR inhibitor AP5 suppressed Myc supercompetition (Fig. 8g, h). These data are consistent with the notion that NR2 contributes to the supercompetitor status of Myc clones.

**Fig. 8: NR2 is essential for the supercompetitior status of Myc-expressing cells.**

Discussion

The elimination of unfit cells via competitive interactions plays an important role for the maintenance of tissue health during development and adulthood^1,2,29,30,31. Our data indicate that the NMDA receptor NR2 influences the competitive behaviour of epithelia cells and Myc supercompetitors in the Drosophila wing disc. We find that genetic depletion of NR2 reprograms metabolism via TNF-dependent and JNK-mediated activation of PDK, which in turn phosphorylates and inactivates PDH. This causes a shutdown of pyruvate catalysis and results in a switch to aerobic glycolysis. Upon phospho-dependent inhibition of PDH, pyruvate is reduced to lactate via LDH, and secreted³². While lactate exits cells to avoid acidification, it can be recaptured and used as carbon source by other cells, leading to metabolic compartmentalisation between adjacent cells. In normal physiology as well as in murine and human tumours, lactate is an important energy source that fuels mitochondrial metabolism^4,27. For example, lactate produced and secreted by astrocytes is transported to neighbouring neurons where it is used as source of energy to support neuronal function³³. This is akin of the ‘reverse Warburg effect’⁶, also named ‘two-compartment metabolic coupling’ model, where cancer-associated fibroblasts (CAFs) undergo aerobic glycolysis and production of high energy metabolites, especially lactate, which is then transported to adjacent cancer cells to sustain their anabolic need⁶.

Our data suggest that the epithelial NMDA receptor is responsible for fitness surveillance and to provide Myc clones with supercompetitor status. Cells with decreased epithelial NMDA receptor are metabolically reprogrammed to transfer their carbon fuel to their neighbours. According to our model, differential NMDAR signalling in adjacent cells triggers lactate-mediated metabolic coupling, and underpins cell competition in epithelia. Consistently, preventing loser cells from ‘transferring’ lactate to their neighbours, via inhibition of MCT1, Impl3 or PDK, removes the fitness disparity and nullifies cell competition. Likewise, exposure to elevated levels of systemic lactate, blocks elimination of NR2 loser clones. This suggests that cell competition may be based on NMDAR-mediated metabolic coupling between winners and losers. Importantly, this metabolic coupling only occurs under competitive conditions. Consistently, NR2 losers are only eliminated if they are surrounded by cells with functional NMDAR. This is evident as tissue-wide inhibition of NMDAR by AP5, a selective inhibitor of NR2, blocks elimination of NR2 loser clones in a heterotypic genetic setting.

We find that NR2 is upregulated in Myc expressing clones and that Myc cells co-opt epithelial NR2 to promote cell competition, subduing their neighbouring wild-type cells that become re-classified as ‘unfit’. Interestingly, Myc clones lose their supercompetitor status upon tissue-wide depletion of NR2. Under this condition, WT cells are no longer eliminated and survive among Myc supercompetitors. This indicates that NR2 underpins Myc-induced supercompetition. Given that Myc is a major driver of cancer cell growth, and is a hallmark of the disease in nearly seven out of ten cases, blocking Myc’s function would be a powerful approach to treat many types of cancer. However, the properties of the Myc protein itself make it difficult to design a drug against it. Since the NMDAR signalling circuit is hijacked in many types of human cancers³⁴, and its expression level is associated with poor patient survival, it is attractive to speculate that targeting NMDAR may be a promising strategy to improve patient care.

Methods

Fly strains

The following strains were used: UAS-LacZ-RNAi³⁵ (from M. Miura), UAS-dlg1 ^GD41136-RNAi (Vienna Drosophila Resource Center, VDRC), NR2:Gfp³⁶, UAS-scrib^TRIP.GL00638-RNAi (Bloomington Drosophila Stock Centre, BDSC), UAS-NR2^TW-RNAi¹⁵ and UAS-NR2 (from A.S. Chiang), UAS-NR2^TRIPJF02044-RNAi (Bloomington Drosophila Stock Centre, BDSC), UAS-NR2^TRIPHMS02012-RNAi (BDSC), UAS-NR2^TRIPHMS02176-RNAi (BDSC), UAS-NR2^GD3196-RNAi (VDRC), UAS-grnd^KK109939-RNAi (VDRC), UAS-hep^GD26929-RNAi (VDRC), UAS-bsk-DN (BDSC: 6409), UAS-bsk.B (WT bsk, BDSC: 9310), UAS-p35,UAS-DIAP1 (PMID: 10675329), pucE69(puc-LacZ)³⁷, Pdk-RNAi^TRiPGL00009 (BDSC: 35142), UAS-Pdh (BDSC: 58765), UAS-lactateFRET²³ (from B. Hudry), UAS-Mct1^KK108618-RNAi (VDRC), UAS-impL3^GD31192-RNAi (VDRC), UAS-impL3^KK110190-RNAi (VDRC), UAS-CG13907^KK107339-RNAi (VDRC), UAS-CG3409^GD37139-RNAi (VDRC), UAS-Myc (BDSC: 9674), nub-Gal4 (BDSC: 25754), hh-Gal4 (BDSC:45946 III), NR2[MI09281-GFSTF.2] (BDSC: 60566), NR2-Gal4 (BDSC: 76705), nub-LexA (BDSC: 54415 and BDSC: 54963), LexO-NR2-RNAi (generated for this study), LexO-RFP-RNAi (generated for this study), LexO-LacZ (BDSC: 7226), for the generation of GFP-marked clones the following strains were used: y,w,hs-flp;;Act > CD2 > Gal4,UAS-nEGFP³⁸ (from T. Neufeld) (“>” denotes FRT sites) and Ubi-p63E > STOP > Stringer(nEGFP) (BDSC: 32251), w; tub > myc y + >Gal4, UAS-GFP/CyO (from L. Johnston), w; tub>CD2>lexA, lexO-mCherry³⁹, w; tub > myc > lexA, lexO-mCherry³⁹, and yw; Act > y > UAS-LacZ (from B. Hudry). See Supplementary Table 1 for genotypes.

Generation of lexO transgenic lines

In all, 21 bp short hairpin sequences targeting NR2 (CACTTCAAGTTCACTATCCTA) or RFP (CGAGTTCATCTACAAGGTGAA) were chemically synthesised and cloned into pJFRC19 vector. Transgenes were inserted by phiC31-mediated recombination into the attp-9A docking site on the 3^rd chromosome (75A10) (BDSC: 9725).

Fly husbandry

Fly stocks were reared on a standard corn meal/agar diet (6.65% corn meal, 7.15% dextrose, 5% yeast, 0.66% agar, supplemented with 2.2% nipagin and 3.4 ml/l propionic acid). All experimental flies were kept at RT on a 12 h light/dark cycle. Fly crosses were set up and kept at RT. Flies were transferred to fresh vials every day, and fly density was kept to a maximum of 15 flies per vial. For clonal flip-out experiments (homotypic and heterotypic assays), flies were allowed to lay eggs in fresh tubes for 3 h. In all, 48 h after egg laying (AEL) larvae were incubated at 37 °C for 10 min to induce transgene expression. Following temperature shift, animals were kept at RT. Imaginal wing discs were dissected 48 (for ex vivo lactate FRET experiments) or 72 h after heat-shock-mediated induction of clones.

Homotypic and heterotypic cell competition assays

For the homotypic assays, hsFlp;nub-Gal4;ubi-p63 > STOP > Stringer(nEGFP) flies were crossed to flies carrying the respective UAS-based transgenes. nub-Gal4 drives expression of the UAS-transgene in the entire wing pouch. Heat shock generates nEGFP-positive non-competitive clones, which have the same genotype as the surrounding wing pouch. For heterotypic assays, hsFlp;;act>CD2>Gal4,UAS-nEGFP or hsFlp; tub>CD2>lexA, lexO-mCherry flies were crossed to flies carrying the respective UAS- or lexO-based transgenes. Heat shock generates flip-out clones, removing the >CD2> cassette, which allows expression of the UAS-based transgenes. Such clones are marked by nEGFP or mCherry expression, respectively. Heterotypic supercompetition assays: based on a similar principle, hsFlp; tub>myc y + >Gal4, UAS-GFP/CyO or hsFlp; tub>myc >lexA, lexO-mCherry stocks were crossed to UAS- or LexO-based transgenes and heat shock generates flip-out clones, removing the tub>myc y+> or >myc>cassettes, respectively.

Immunohistochemistry

Larval tissues were stained using standard immunohistochemical procedures. Briefly, discs were dissected in PBS, fixed at room temperature for 20 min in 3.7% formaldehyde/PBS and washed in 2% Triton-X100/PBS. All subsequent incubations were performed in 2% Triton X-100/PBS at 4 °C. Samples were mounted either in Vectashield or Vectashield containing DAPI (Vector Labs). The following primary antibodies were used: mouse anti-dNR2¹⁵ (1:100, from Ann-Shyn Chiang, mouse anti-dlg1 (1:50, 4F3, DSHB, University of Iowa, Iowa City, IA, USA), mouse anti-GFP (11814460001, Roche), mouse anti-MMP1 (1:50, 5H7B11, DSHB, University of Iowa, Iowa City, IA, USA), rabbit anti-cleaved DCP1 (Asp216) (1:200,Cell Signaling), mouse p-JNK (1:100, 9255,Cell Signaling Technology Inc., Danvers, MA, USA), PHA-555 (Phalloidin-555, A34055, Invitrogen/Molecular probes), mouse polyclonal anti-MCT1 (1:100, ab90582, Abcam), rabbit polyclonal anti-Myc (1:100, d1-717, sc-28207 Santa Cruz Biotechnology), rabbit polyclonal anti-p-PDHE1 (1:200, Pyruvate Dehydrogenase E1-alpha subunit (phospho S293), ab92696, Abcam). Note, the phosphorylation site surrounding S296 of human PDHE1 is conserved in Drosophila PDHE1, which is encoded by lethal(1)G0334 (CG7010) (e-value 5e-36, query coverage of 99%). Fluorescent secondary antibodies (1:2000, FITC-, Cy3- and Cy5-conjugated) were obtained from Jackson Immunoresearch.

TMRM and MitoTracker Red stainings

Mitochondria were stained with 500 nM Tetramethylrhodamine Methyl Ester (TMRM) for 20 min. TMRM staining was recorded with excitation at 543 nm and a 560–615 nm band-pass emission filter. MitoTracker Red CMXRos (M7512, LifeTechnologies) was used at 300 nM in PBS 1% Tween 20 for 10 min.

Lactate feeding and treatments with inhibitors

Following heat shock-mediated clone induction, larvae were placed on standard food containing l-lactate (30 mM, 71718-10G, Sigma Aldrich), the NR2 antagonists AP5 (5 μM, A8054, Sigma Aldrich), PEAQX tetrasodium hydrate (0.015 μM, 1999, Sigma Aldrich), Ifenprodil-tartarate salt (15 μM, I2892, Sigma Aldrich) or the MCT1 inhibitor AR-C155858 (100 nM, Bio-Techne (Tocris)) for 48 h. For ex vivo experiments with dissected wing discs, MCT1 inhibitor was added in a final concentration of 10 nM into M16 Medium (M7292, Sigma Aldrich).

Lactate measurements using FRET-based metabolite sensor

Imaging experiments were performed using dissected imaginal wing discs. A genetically encoded lactate reporter (UAS-lactate FRET)²³, was co-expressed within clones expressing gene-of-interest (goi) or UAS-lacZ-RNAi. Alternatively, the sensor was expressed tissue wide, under the control of nubbin (nub-Gal4 > UAS-lactate FRET). In the latter case, clonal analysis was conducted via the lexA/lexO binary system²⁴, which allowed side-by-side comparison of the lactate FRET signal in clones expressing the lexO-goi or lexO-LacZ and surrounding wild-type cells. The dissected tissues were placed into an open μ-slide (chambered coverslip, ibidi #80826). Fluorescent images were acquired using a ×20, ×40 or ×63 Zeiss objectives on a Zeiss 780 confocal microscope. An Argon laser and MBS458/514 beamline splitter were used with the following filter sets: excitation 458 nm, emission 485-526 nm (mTFP channel); excitation 458 nm, emission 526–625 nm (FRET channel) and excitation 514 nm, emission 526–625 nm (Venus channel). For data analysis, regions-of-interest (ROI) were delimited and the average intensity of both mTFP and Venus channels over each ROI were calculated. As the FRET (from mTFP to Venus) inversely correlates, with lactate concentration, to obtain a signal that positively correlates with lactate concentration, the signal intensity of mTFP was divided by Venus signal intensity.

Quantifications

Imaginal discs were imaged at ×20 magnification. Seven Z-stacks were taken for each disc. After imaging, channels were split and maximum Z-projection was analysed. Using DAPI channel images, a line was drawn around the pouch area and measured using ImageJ. The sum areas of GFP-positive clones were measured using the GFP channel. Threshold was adjusted with the Huang auto-thresholding algorithm to subtract background. The area above the threshold was analysed. Data were collected from at least three independent experiments, and 10 wing discs per genotype and/or condition were analysed, unless stated otherwise. The relative occupancy of GFP-positive clones was quantified, and expressed as proportion of GFP-positive clones per pouch (±S.D.).

Statistics and data presentation

All statistical analyses were carried out using GraphPad Prism7. Comparisons between two genotypes/conditions were analysed with the Mann–Whitney nonparametric two-tailed rank U-test or Pearson’s correlation test. Confocal images belonging to the same experiment, and displayed together, were acquired using the same settings. For the purpose of visualization, the same level and channel adjustments were applied using ImageJ. Of note, all quantitative analyses were carried out on unadjusted raw images or maximum projections. Values are presented as average ± standard deviation (S.D.), P-values from Mann–Whitney U-test (non-significant (ns): P > 0.05; *: 0.05 > P > 0.1; **: 0.1 > P > 0.01; ***: 0.01 > P > 0.001;****: P > 0.0001 and from Pearson’s analysis α = 0.05.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Data availability

The authors declare that all data supporting the findings of this study are available within the article and its Supplementary Information files or from the corresponding author upon reasonable request.

The original data underlying the following figures are provided as a Source Data file: Figs.1d, 1f, 1g, 1i, 2c, 3a, b, 3e, 4c–e, 5c, 6b–f, 7e, 8b, c, f, h and Supplementary Figs. 3, 5, 7c–e, 8d, e, 8f, g.

References

Johnston, L. A. Socializing with MYC: cell competition in development and as a model for premalignant cancer. Cold Spring Harb. Perspect. Med. 4, a014274 (2014).
Article Google Scholar
Claveria, C. & Torres, M. Cell competition: mechanisms and physiological roles. Annu Rev. Cell Dev. Biol. 32, 411–439 (2016).
Article CAS Google Scholar
de la Cova, C. et al. Supercompetitor status of Drosophila Myc cells requires p53 as a fitness sensor to reprogram metabolism and promote viability. Cell Metab. 19, 470–483 (2014).
Article Google Scholar
Faubert, B. et al. Lactate metabolism in human lung tumors. Cell 171, 358–371 e359 (2017).
Article CAS Google Scholar
Bonuccelli, G. et al. Ketones and lactate “fuel” tumor growth and metastasis: evidence that epithelial cancer cells use oxidative mitochondrial metabolism. Cell Cycle 9, 3506–3514 (2010).
Article CAS Google Scholar
Pavlides, S. et al. The reverse Warburg effect: aerobic glycolysis in cancer associated fibroblasts and the tumor stroma. Cell Cycle 8, 3984–4001 (2009).
Article CAS Google Scholar
Nedergaard, M. & Goldman, S. A. Carrier-mediated transport of lactic acid in cultured neurons and astrocytes. Am. J. Physiol. 265, R282–R289 (1993).
CAS PubMed Google Scholar
Brooks, G. A. Lactate production under fully aerobic conditions: the lactate shuttle during rest and exercise. Fed. Proc. 45, 2924–2929 (1986).
CAS PubMed Google Scholar
Brooks, G. A., Dubouchaud, H., Brown, M., Sicurello, J. P. & Butz, C. E. Role of mitochondrial lactate dehydrogenase and lactate oxidation in the intracellular lactate shuttle. Proc. Natl Acad. Sci. USA 96, 1129–1134 (1999).
Article ADS CAS Google Scholar
Bilder, D. Epithelial polarity and proliferation control: links from the Drosophila neoplastic tumor suppressors. Genes Dev. 18, 1909–1925 (2004).
Article CAS Google Scholar
Kornau, H. C., Schenker, L. T., Kennedy, M. B. & Seeburg, P. H. Domain interaction between NMDA receptor subunits and the postsynaptic density protein PSD-95. Science 269, 1737–1740 (1995).
Article ADS CAS Google Scholar
Niethammer, M., Kim, E. & Sheng, M. Interaction between the C terminus of NMDA receptor subunits and multiple members of the PSD-95 family of membrane-associated guanylate kinases. J. Neurosci. 16, 2157–2163 (1996).
Article CAS Google Scholar
Hogan-Cann, A. D. & Anderson, C. M. Physiological Roles of Non-Neuronal NMDA Receptors. Trends Pharm. Sci. 37, 750–767 (2016).
Article CAS Google Scholar
Potier, D. et al. Mapping gene regulatory networks in Drosophila eye development by large-scale transcriptome perturbations and motif inference. Cell Rep. 9, 2290–2303 (2014).
Article CAS Google Scholar
Wu, C. L. et al. Specific requirement of NMDA receptors for long-term memory consolidation in Drosophila ellipsoid body. Nat. Neurosci. 10, 1578–1586 (2007).
Article CAS Google Scholar
Xia, S. et al. NMDA receptors mediate olfactory learning and memory in Drosophila. Curr. Biol. 15, 603–615 (2005).
Article CAS Google Scholar
Brumby, A. M. & Richardson, H. E. scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila. EMBO J. 22, 5769–5779 (2003).
Article CAS Google Scholar
Igaki, T., Pagliarini, R. A. & Xu, T. Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila. Curr. Biol. 16, 1139–1146 (2006).
Article CAS Google Scholar
Olverman, H. J., Jones, A. W. & Watkins, J. C. L-glutamate has higher affinity than other amino acids for [3H]-D-AP5 binding sites in rat brain membranes. Nature 307, 460–462 (1984).
Article ADS CAS Google Scholar
Andersen, D. S. et al. The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth. Nature 522, 482–486 (2015).
Article ADS CAS Google Scholar
Zhou, Q., Lam, P. Y., Han, D. & Cadenas, E. Activation of c-Jun-N-terminal kinase and decline of mitochondrial pyruvate dehydrogenase activity during brain aging. FEBS Lett. 583, 1132–1140 (2009).
Article CAS Google Scholar
Kim, J. W., Tchernyshyov, I., Semenza, G. L. & Dang, C. V. HIF-1-mediated expression of pyruvate dehydrogenase kinase: a metabolic switch required for cellular adaptation to hypoxia. Cell Metab. 3, 177–185 (2006).
Article Google Scholar
Hudry, B. et al. Sex differences in intestinal carbohydrate metabolism promote food intake and sperm maturation. Cell 178, 901–918 e916 (2019).
Article CAS Google Scholar
del Valle Rodriguez, A., Didiano, D. & Desplan, C. Power tools for gene expression and clonal analysis in Drosophila. Nat. Methods 9, 47–55 (2011).
Article Google Scholar
Moreno, E. & Basler, K. dMyc transforms cells into super-competitors. Cell 117, 117–129 (2004).
Article CAS Google Scholar
de la Cova, C., Abril, M., Bellosta, P., Gallant, P. & Johnston, L. A. Drosophila myc regulates organ size by inducing cell competition. Cell 117, 107–116 (2004).
Article Google Scholar
Hui, S. et al. Glucose feeds the TCA cycle via circulating lactate. Nature 551, 115–118 (2017).
Article ADS Google Scholar
Harjes, U. Metabolism: More lactate, please. Nat. Rev. Cancer 17, 707 (2017).
Article CAS Google Scholar
Amoyel, M. & Bach, E. A. Cell competition: how to eliminate your neighbours. Development 141, 988–1000 (2014).
Article CAS Google Scholar
Di Gregorio, A., Bowling, S. & Rodriguez, T. A. Cell competition and its role in the regulation of cell fitness from development to cancer. Dev. Cell 38, 621–634 (2016).
Article Google Scholar
Baker, N. E. Mechanisms of cell competition emerging from Drosophila studies. Curr. Opin. Cell Biol. 48, 40–46 (2017).
Article CAS Google Scholar
Rogatzki, M. J., Ferguson, B. S., Goodwin, M. L. & Gladden, L. B. Lactate is always the end product of glycolysis. Front. Neurosci. 9, 22 (2015).
Article Google Scholar
Steinman, M. Q., Gao, V. & Alberini, C. M. The role of lactate-mediated metabolic coupling between astrocytes and neurons in long-term memory formation. Front. Integr. Neurosci. 10, 10 (2016).
Article Google Scholar
Li, L. & Hanahan, D. Hijacking the neuronal NMDAR signaling circuit to promote tumor growth and invasion. Cell 153, 86–100 (2013).
Article CAS Google Scholar
Kashio, S. et al. Tissue nonautonomous effects of fat body methionine metabolism on imaginal disc repair in Drosophila. Proc. Natl Acad. Sci. USA 113, 1835–1840 (2016).
Article ADS CAS Google Scholar
Nagarkar-Jaiswal, S. et al. A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila. Elife 4, 1–28 (2015).
Google Scholar
Martin-Blanco, E. et al. puckered encodes a phosphatase that mediates a feedback loop regulating JNK activity during dorsal closure in Drosophila. Genes Dev. 12, 557–570 (1998).
Article CAS Google Scholar
Chang, Y. Y. & Neufeld, T. P. An Atg1/Atg13 complex with multiple roles in TOR-mediated autophagy regulation. Mol. Biol. Cell 20, 2004–2014 (2009).
Article CAS Google Scholar
Alpar, L., Bergantinos, C. & Johnston, L. A. Spatially restricted regulation of spatzle/toll signaling during cell competition. Dev. Cell 46, 706–719 e705 (2018).
Article CAS Google Scholar

Download references

Acknowledgements

We would like to thank Laura Johnston, Ann-Shyn Chiang, M. Miura and Bruno Hudry for reagents, and Marta Fores Maresma, C. Castilho Soares, Rebecca Wilson, Sidonie Wicky John, Tencho Tenev, Celia Domingues, Katalin Schlett and the iBV PRISM imaging facility for technical assistance. We would like to thank members of the Meier laboratory for discussions and critical reading of the manuscript. We thank Stephane Noselli and his laboratory for his support during the revision period. A.B. was funded by an EMBO Long Term Fellowship (ALTF-48-2014) and an IDEX-Initiative d’excellence Grant. Work in the Meier lab is funded by Breast Cancer Now (CTR-QR14-007) and Biological Sciences Research (BBSRC) (BB/L021684/1). We acknowledge NHS funding to the NIHR Biomedical Research Centre.

Author information

Authors and Affiliations

The Breast Cancer Now Toby Robins Research Centre, The Institute of Cancer Research, London, UK
Agnes R. Banreti & Pascal Meier
Université Côte D’Azur, CNRS, Inserm, Institut de Biologie Valrose, Nice, France
Agnes R. Banreti

Authors

Agnes R. Banreti
View author publications
You can also search for this author in PubMed Google Scholar
Pascal Meier
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

A.B. conceived the study, A.B. and P.M designed the experiments, and A.B. performed the experiments. A.B. and P.M. analysed the data and wrote the paper.

Corresponding authors

Correspondence to Agnes R. Banreti or Pascal Meier.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Peer review information Nature Communications thanks Miguel Torres Sanchez and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Banreti, A.R., Meier, P. The NMDA receptor regulates competition of epithelial cells in the Drosophila wing. Nat Commun 11, 2228 (2020). https://doi.org/10.1038/s41467-020-16070-6

Download citation

Received: 15 May 2018
Accepted: 08 April 2020
Published: 06 May 2020
DOI: https://doi.org/10.1038/s41467-020-16070-6

This article is cited by

The PECAn image and statistical analysis pipeline identifies Minute cell competition genes and features
- Michael E. Baumgartner
- Paul F. Langton
- Eugenia Piddini
Nature Communications (2023)
Apoptotic dysregulation mediates stem cell competition and tissue regeneration
- Marianna Yusupova
- Roi Ankawa
- Yaron Fuchs
Nature Communications (2023)
Cell competition in development, homeostasis and cancer
- Sanne M. van Neerven
- Louis Vermeulen
Nature Reviews Molecular Cell Biology (2023)
Usp8 promotes tumor cell migration through activating the JNK pathway
- Yunhe Zhao
- Dezhen Peng
- Qingxin Liu
Cell Death & Disease (2022)
Emerging mechanisms of cell competition
- Nicholas E. Baker
Nature Reviews Genetics (2020)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.