Correction to: Cancer Gene Therapy https://doi.org/10.1038/s41417-021-00312-w, published online 02 March 2021
We found two errors in our paper. Firstly, in Table 1, we showed error primers for miR-485-5p. The correct is “miR-485-5p:F AGAGGCTGGCCGTGAT” and “miR-485-5p:R ATGTGTTGCTGTGTTTTGTCG”. This mistake is a slip of the pen,but we did not carefully check and correct it before submission.
Secondly, for reference 23 Jiang L, Yang H, Chen T, Zhu X, Ye J, Lv K. Identification of HMG-box family establishes the significance of SOX6 in the malignant progression of glioblastoma. Aging. 2020;12:8084–106((PMID: 32388501). It is not accurate. The correct reference is “Li Y, Guo D, Zhao Y, Ren M, Lu G, Wang Y et al. Long non-coding RNA SNHG5 promotes human hepatocellular carcinoma progression by regulating miR-26a-5p/GSK3β signal pathway. Cell death & disease 2018; 9: 888.”(PMID: 30166525 PMCID: PMC6117363 https://doi.org/10.1038/s41419-018-0882-5).
The original article has been corrected.
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
About this article
Cite this article
Yang, L., Deng, Wl., Zhao, Bg. et al. Correction to: FOXO3-induced lncRNA LOC554202 contributes to hepatocellular carcinoma progression via the miR-485-5p/BSG axis. Cancer Gene Ther 29, 1301 (2022). https://doi.org/10.1038/s41417-022-00468-z
Published:
Issue Date:
DOI: https://doi.org/10.1038/s41417-022-00468-z
