Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Article
  • Published:

An evolutionary recent neuroepithelial cell adhesion function of huntingtin implicates ADAM10-Ncadherin

Nature Neuroscience volume 15, pages 713–721 (2012)Cite this article

Subjects

This article has been updated

Abstract

The Huntington's disease gene product, huntingtin, is indispensable for neural tube formation, but its role is obscure. We studied neurulation in htt-null embryonic stem cells and htt-morpholino zebrafish embryos and found a previously unknown, evolutionarily recent function for this ancient protein. We found that htt was essential for homotypic interactions between neuroepithelial cells; it permitted neurulation and rosette formation by regulating metalloprotease ADAM10 activity and Ncadherin cleavage. This function was embedded in the N terminus of htt and was phenocopied by treatment of htt knockdown zebrafish with an ADAM10 inhibitor. Notably, in htt-null cells, reversion of the rosetteless phenotype occurred only with expression of evolutionarily recent htt heterologues from deuterostome organisms. Conversely, all of the heterologues that we tested, including htt from Drosophila melanogaster and Dictyostelium discoideum, exhibited anti-apoptotic activity. Thus, anti-apoptosis may have been one of htt's ancestral function(s), but, in deuterostomes, htt evolved to acquire a unique regulatory activity for controlling neural adhesion via ADAM10-Ncadherin, with implications for brain evolution and development.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1: Neural differentiation of htt-null mouse ES cells.
Figure 2: Neural tube impairment in htt loss-of-function zebrafish embryos.
Figure 3: Lack of htt causes increased ADAM10 activity and Ncadherin cleavage.
Figure 4: Ncadherin cleavage and ADAM10 activity in the zebrafish and mouse brain.
Figure 5: Effects of htt loss-of-function during neurulation.
Figure 6: The block of ADAM10 activity partially rescued httMO phenotypes at 24 hpf.
Figure 7: htt N terminus neural cell-adhesion function during evolution.

Similar content being viewed by others

Change history

  • 10 August 2012

    In the version of this article initially published, the htt ATG morpholino sequence given in Online Methods (ATTTTAACAGAAGCTGTGATG) was incorrect. The correct sequence is 5′-GCCATTTTAACAGAAGCTGTGATGA-3′. The error has been corrected in the HTML and PDF versions of the article.

References

  1. MacDonald, M.E. et al. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell 72, 971–983 (1993).

    Article  Google Scholar 

  2. Tartari, M. et al. Phylogenetic comparison of huntingtin homologues reveals the appearance of a primitive polyQ in sea urchin. Mol. Biol. Evol. 25, 330–338 (2008).

    Article  CAS  Google Scholar 

  3. Palidwor, G.A. et al. Detection of alpha-rod protein repeats using a neural network and application to huntingtin. PLoS Comput. Biol. 5, e1000304 (2009).

    Article  Google Scholar 

  4. Myre, M.A. et al. Deficiency of huntingtin has pleiotropic effects in the social amoeba Dictyostelium discoideum. PLoS Genet. 7, e1002052 (2011).

    Article  CAS  Google Scholar 

  5. Bhide, P.G. et al. Expression of normal and mutant huntingtin in the developing brain. J. Neurosci. 16, 5523–5535 (1996).

    Article  CAS  Google Scholar 

  6. Zuccato, C., Valenza, M. & Cattaneo, E. Molecular mechanisms and potential therapeutical targets in Huntington's disease. Physiol. Rev. 90, 905–981 (2010).

    Article  CAS  Google Scholar 

  7. O'Kusky, J.R., Nasir, J., Cicchetti, F., Parent, A. & Hayden, M.R. Neuronal degeneration in the basal ganglia and loss of pallido-subthalamic synapses in mice with targeted disruption of the Huntington's disease gene. Brain Res. 818, 468–479 (1999).

    Article  CAS  Google Scholar 

  8. Dragatsis, I., Levine, M.S. & Zeitlin, S. Inactivation of Hdh in the brain and testis results in progressive neurodegeneration and sterility in mice. Nat. Genet. 26, 300–306 (2000).

    Article  CAS  Google Scholar 

  9. Zhang, Y. et al. Depletion of wild-type huntingtin in mouse models of neurologic diseases. J. Neurochem. 87, 101–106 (2003).

    Article  CAS  Google Scholar 

  10. Leavitt, B.R. et al. Wild-type huntingtin protects neurons from excitotoxicity. J. Neurochem. 96, 1121–1129 (2006).

    Article  CAS  Google Scholar 

  11. Rigamonti, D. et al. Wild-type huntingtin protects from apoptosis upstream of caspase-3. J. Neurosci. 20, 3705–3713 (2000).

    Article  CAS  Google Scholar 

  12. Rigamonti, D. et al. Huntingtin's neuroprotective activity occurs via inhibition of procaspase-9 processing. J. Biol. Chem. 276, 14545–14548 (2001).

    Article  CAS  Google Scholar 

  13. Ho, L.W., Brown, R., Maxwell, M., Wyttenbach, A. & Rubinsztein, D.C. Wild-type Huntingtin reduces the cellular toxicity of mutant Huntingtin in mammalian cell models of Huntington's disease. J. Med. Genet. 38, 450–452 (2001).

    Article  CAS  Google Scholar 

  14. Duyao, M.P. et al. Inactivation of the mouse Huntington's disease gene homolog Hdh. Science 269, 407–410 (1995).

    Article  CAS  Google Scholar 

  15. Nasir, J. et al. Targeted disruption of the Huntington's disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell 81, 811–823 (1995).

    Article  CAS  Google Scholar 

  16. Zeitlin, S., Liu, J.P., Chapman, D.L., Papaioannou, V.E. & Efstratiadis, A. Increased apoptosis and early embryonic lethality in mice nullizygous for the Huntington's disease gene homologue. Nat. Genet. 11, 155–163 (1995).

    Article  CAS  Google Scholar 

  17. Dragatsis, I., Efstratiadis, A. & Zeitlin, S. Mouse mutant embryos lacking huntingtin are rescued from lethality by wild-type extraembryonic tissues. Development 125, 1529–1539 (1998).

    CAS  PubMed  Google Scholar 

  18. White, J.K. et al. Huntingtin is required for neurogenesis and is not impaired by the Huntington's disease CAG expansion. Nat. Genet. 17, 404–410 (1997).

    Article  CAS  Google Scholar 

  19. Auerbach, W. et al. The HD mutation causes progressive lethal neurological disease in mice expressing reduced levels of huntingtin. Hum. Mol. Genet. 10, 2515–2523 (2001).

    Article  CAS  Google Scholar 

  20. Henshall, T.L. et al. Selective neuronal requirement for huntingtin in the developing zebrafish. Hum. Mol. Genet. 18, 4830–4842 (2009).

    Article  CAS  Google Scholar 

  21. Reiner, A. et al. Neurons lacking huntingtin differentially colonize brain and survive in chimeric mice. J. Neurosci. 21, 7608–7619 (2001).

    Article  CAS  Google Scholar 

  22. Godin, J.D. et al. Huntingtin is required for mitotic spindle orientation and mammalian neurogenesis. Neuron 67, 392–406 (2010).

    Article  CAS  Google Scholar 

  23. Abranches, E. et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS ONE 4, e6286 (2009).

    Article  Google Scholar 

  24. Elkabetz, Y. et al. Human ES cell–derived neural rosettes reveal a functionally distinct early neural stem cell stage. Genes Dev. 22, 152–165 (2008).

    Article  CAS  Google Scholar 

  25. Hoettecke, N., Ludwig, A., Foro, S. & Schmidt, B. Improved synthesis of ADAM10 inhibitor GI254023X. Neurodegener. Dis. 7, 232–238 (2010).

    Article  CAS  Google Scholar 

  26. Ying, Q.L., Stavridis, M., Griffiths, D., Li, M. & Smith, A. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat. Biotechnol. 21, 183–186 (2003).

    Article  CAS  Google Scholar 

  27. Diekmann, H. et al. Decreased BDNF levels are a major contributor to the embryonic phenotype of huntingtin knockdown zebrafish. J. Neurosci. 29, 1343–1349 (2009).

    Article  CAS  Google Scholar 

  28. Kelly, G.M. & Moon, R.T. Involvement of wnt1 and pax2 in the formation of the midbrain–hindbrain boundary in the zebrafish gastrula. Dev. Genet. 17, 129–140 (1995).

    Article  CAS  Google Scholar 

  29. Adolf, B., Bellipanni, G., Huber, V. & Bally-Cuif, L. atoh1.2 and beta3.1 are two new bHLH-encoding genes expressed in selective precursor cells of the zebrafish anterior hindbrain. Gene Expr. Patterns 5, 35–41 (2004).

    Article  CAS  Google Scholar 

  30. Halbleib, J.M. & Nelson, W.J. Cadherins in development: cell adhesion, sorting and tissue morphogenesis. Genes Dev. 20, 3199–3214 (2006).

    Article  CAS  Google Scholar 

  31. Radice, G.L. et al. Developmental defects in mouse embryos lacking N-cadherin. Dev. Biol. 181, 64–78 (1997).

    Article  CAS  Google Scholar 

  32. Reiss, K. et al. ADAM10 cleavage of N–cadherin and regulation of cell-cell adhesion and beta-catenin nuclear signaling. EMBO J. 24, 742–752 (2005).

    Article  CAS  Google Scholar 

  33. Marambaud, P. et al. A presenilin-1/gamma-secretase cleavage releases the E-cadherin intracellular domain and regulates disassembly of adherens junctions. EMBO J. 21, 1948–1956 (2002).

    Article  CAS  Google Scholar 

  34. Marcello, E. et al. Synapse-associated protein 97 mediates alpha-secretase ADAM10 trafficking and promotes its activity. J. Neurosci. 27, 1682–1691 (2007).

    Article  CAS  Google Scholar 

  35. Malinverno, M. et al. Synaptic localization and activity of ADAM10 regulate excitatory synapses through N-cadherin cleavage. J. Neurosci. 30, 16343–16355 (2010).

    Article  CAS  Google Scholar 

  36. Uemura, K. et al. Characterization of sequential N-cadherin cleavage by ADAM10 and PS1. Neurosci. Lett. 402, 278–283 (2006).

    Article  CAS  Google Scholar 

  37. Lele, Z. et al. parachute/n-cadherin is required for morphogenesis and maintained integrity of the zebrafish neural tube. Development 129, 3281–3294 (2002).

    CAS  PubMed  Google Scholar 

  38. Inoshima, I. et al. A Staphylococcus aureus pore-forming toxin subverts the activity of ADAM10 to cause lethal infection in mice. Nat. Med. 17, 1310–1314 (2011).

    Article  CAS  Google Scholar 

  39. Chen, Y.Y., Hehr, C.L., Atkinson-Leadbeater, K., Hocking, J.C. & McFarlane, S. Targeting of retinal axons requires the metalloproteinase ADAM10. J. Neurosci. 27, 8448–8456 (2007).

    Article  CAS  Google Scholar 

  40. Zhang, Y. et al. Huntingtin inhibits caspase-3 activation. EMBO J. 25, 5896–5906 (2006).

    Article  CAS  Google Scholar 

  41. Yang, P., Baker, K.A. & Hagg, T. The ADAMs family: coordinators of nervous system development, plasticity and repair. Prog. Neurobiol. 79, 73–94 (2006).

    Article  CAS  Google Scholar 

  42. Muraguchi, T. et al. RECK modulates Notch signaling during cortical neurogenesis by regulating ADAM10 activity. Nat. Neurosci. 10, 838–845 (2007).

    Article  CAS  Google Scholar 

  43. Li, Z., Karlovich, C.A., Fish, M.P., Scott, M.P. & Myers, R.M. A putative Drosophila homolog of the Huntington's disease gene. Hum. Mol. Genet. 8, 1807–1815 (1999).

    Article  CAS  Google Scholar 

  44. Zhang, S., Feany, M.B., Saraswati, S., Littleton, J.T. & Perrimon, N. Inactivation of Drosophila Huntingtin affects long-term adult functioning and the pathogenesis of a Huntington's disease model. Dis. Model Mech. 2, 247–266 (2009).

    Article  CAS  Google Scholar 

  45. Miller, J.P. et al. Matrix metalloproteinases are modifiers of huntingtin proteolysis and toxicity in Huntington's disease. Neuron 67, 199–212 (2010).

    Article  CAS  Google Scholar 

  46. Postina, R. et al. A disintegrin-metalloproteinase prevents amyloid plaque formation and hippocampal defects in an Alzheimer disease mouse model. J. Clin. Invest. 113, 1456–1464 (2004).

    Article  CAS  Google Scholar 

  47. Prinzen, C. et al. Differential gene expression in ADAM10 and mutant ADAM10 transgenic mice. BMC Genomics 10, 66 (2009).

    Article  Google Scholar 

  48. Reis, S.A. et al. Striatal neurons expressing full-length mutant huntingtin exhibit decreased N-cadherin and altered neuritogenesis. Hum. Mol. Genet. 20, 2344–2355 (2011).

    Article  CAS  Google Scholar 

  49. Westerfield, M. The Zebrafish Book (University of Oregon Press, 1993).

  50. Thisse, C., Thisse, B., Schilling, T.F. & Postlethwait, J.H. Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119, 1203–1215 (1993).

    CAS  PubMed  Google Scholar 

  51. Jowett, T. & Lettice, L. Whole-mount in situ hybridizations on zebrafish embryos using a mixture of digoxigenin- and fluorescein-labeled probes. Trends Genet. 10, 73–74 (1994).

    Article  CAS  Google Scholar 

Download references

Acknowledgements

We thank M. MacDonald (Massachusetts General Hospital) for the Hdh+/+ and Hdhex4–5 cells, P. Saftig for the ADAM10 antibody (University of Kiel), E. Ruthazer for the zebrafish Ncadherin antibody (McGill University), F. Gardoni and E. Marcello for helpful technical advice on the use of ADAM10 and SAP97 antibodies, A. Badaloni for help with subcloning, and G. Simonutti for assistance with initial imaging analysis. This work has progressed at a very slow pace because it was mostly unfunded. In the beginning, this work was partially supported by the Huntington's Disease Society of America Coalition for the Cure (2007–2009) and by Italian Telethon Foundation (GGP06250, 2007–2009). Some additional support was provided by the Ministero dell'Istruzione, dell'Università e della Ricerca Scientifica, Programmi di Ricerca Scientifica di Rilevante Interesse Nazionale (2006052993, 2006). Since 2009, progress of this work has relied entirely on occasional donations. We wish to thank one donor that in 2009 collected a considerable amount of small donations for us to continue this work and another donor that has been following our progress for 10 years. C.R. was supported by the Fundação para a Ciência e Tecnologia (grant number SFRH/BD/9627/2002) through the GABBA Programme (University of Porto). E.C., J.G. and S.Z. were members of the Huntington's Disease Society of America Coalition for the Cure and J.G. received support from NS16367.

Author information

Author notes

  1. Catarina Ramos

    Present address: Present address: Instituto de Medicina Molecular, Av. Prof. Egas Moniz, Lisboa, Portugal.,

  2. Valentina Lo Sardo and Chiara Zuccato: These authors contributed equally to this work.

Authors and Affiliations

  1. Department of Pharmacological Sciences and Centre for Stem Cell Research, Università degli Studi di Milano, Milano, Italy

    Valentina Lo Sardo, Chiara Zuccato, Barbara Vitali, Catarina Ramos, Marzia Tartari, Luciano Conti, Marta Valenza & Elena Cattaneo

  2. Department of Biology, Università degli Studi di Milano, Milano, Italy

    Germano Gaudenzi, Anna Pistocchi & Franco Cotelli

  3. Center for Human Genetic Research, Massachusetts General Hospital, Boston, Massachusetts, USA

    Michael A Myre, James A Walker & James Gusella

  4. Clemens Schöpf Institute of Chemistry and Biochemistry, Technische Universität Darmstadt, Darmstadt, Germany

    Binia Drung & Boris Schmidt

  5. Department of Neuroscience, University of Virginia School of Medicine, Charlottesville, Virginia, USA

    Scott Zeitlin

Authors
  1. Valentina Lo Sardo
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Chiara Zuccato
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Germano Gaudenzi
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Barbara Vitali
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Catarina Ramos
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Marzia Tartari
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Michael A Myre
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. James A Walker
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Anna Pistocchi
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Luciano Conti
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Marta Valenza
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Binia Drung
    View author publications

    You can also search for this author in PubMed Google Scholar

  13. Boris Schmidt
    View author publications

    You can also search for this author in PubMed Google Scholar

  14. James Gusella
    View author publications

    You can also search for this author in PubMed Google Scholar

  15. Scott Zeitlin
    View author publications

    You can also search for this author in PubMed Google Scholar

  16. Franco Cotelli
    View author publications

    You can also search for this author in PubMed Google Scholar

  17. Elena Cattaneo
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

E.C., V.L.S. and C.Z. developed the study, conceived the experimental plans and analyzed the data. V.L.S. and C.Z. performed most of the biological, biochemical and molecular experiments. B.V. performed some of the biological and biochemical experiments. M.T. and C.R. participated in the initial elaboration of the project and conducted some experiments (some of the initial constructs preparation and monolayer assays, respectively). V.L.S. prepared additional constructs. M.A.M., J.A.W. and J.G. provided the Dictyostelium and Drosophila cDNA. G.G., C.Z. and A.P. performed experiments in zebrafish under the supervision of F.C. (immunocytochemistry and in situ were performed by G.G. and A.P., biochemical assays by C.Z.). M.V. and L.C. provided suggestions for some biological experiments. S.Z. provided the conditional knockout mice and some constructs. B.D. and B.S. provided GI254023X. V.L.S., C.Z. and E.C. interpreted the data and wrote the manuscript. All of the authors read and edited the manuscript. E.C. supervised the entire work, directed the strategies, provided financial support and gave final approval of the version to be published.

Corresponding author

Correspondence to Elena Cattaneo.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Text and Figures

Supplementary Figures 1–10 (PDF 19081 kb)

Supplementary Video 1

Time lapse Imaging experiment in Hdh+/+ cells during neural differentiation. (MOV 14150 kb)

Supplementary Video 2

Time lapse Imaging experiment in Hdhex4/5 cells during neural differentiation. (MOV 14455 kb)

Supplementary Video 3

Time lapse Imaging experiment of co-culture system during neural differentiation. (MOV 21124 kb)

Rights and permissions

Reprints and permissions

About this article

Cite this article

Lo Sardo, V., Zuccato, C., Gaudenzi, G. et al. An evolutionary recent neuroepithelial cell adhesion function of huntingtin implicates ADAM10-Ncadherin. Nat Neurosci 15, 713–721 (2012). https://doi.org/10.1038/nn.3080

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/nn.3080

This article is cited by

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing