The mosquito Aedes aegypti requires a gut microbiota for normal fecundity, longevity and vector competence

Harrison, Ruby E.; Yang, Xiushuai; Eum, Jai Hoon; Martinson, Vincent G.; Dou, Xiaoyi; Valzania, Luca; Wang, Yin; Boyd, Bret M.; Brown, Mark R.; Strand, Michael R.

doi:10.1038/s42003-023-05545-z

Download PDF

Article
Open access
Published: 13 November 2023

The mosquito Aedes aegypti requires a gut microbiota for normal fecundity, longevity and vector competence

Communications Biology volume 6, Article number: 1154 (2023) Cite this article

2360 Accesses
1 Citations
3 Altmetric
Metrics details

Subjects

Abstract

Mosquitoes shift from detritus-feeding larvae to blood-feeding adults that can vector pathogens to humans and other vertebrates. The sugar and blood meals adults consume are rich in carbohydrates and protein but are deficient in other nutrients including B vitamins. Facultatively hematophagous insects like mosquitoes have been hypothesized to avoid B vitamin deficiencies by carryover of resources from the larval stage. However, prior experimental studies have also used adults with a gut microbiota that could provision B vitamins. Here, we used Aedes aegypti, which is the primary vector of dengue virus (DENV), to ask if carryover effects enable normal function in adults with no microbiota. We show that adults with no gut microbiota produce fewer eggs, live longer with lower metabolic rates, and exhibit reduced DENV vector competence but are rescued by provisioning B vitamins or recolonizing the gut with B vitamin autotrophs. We conclude carryover effects do not enable normal function.

The evolutionary drivers and correlates of viral host jumps

Article Open access 25 March 2024

Effects of climate change and human activities on vector-borne diseases

Article 14 March 2024

Dopamine receptor D2 confers colonization resistance via microbial metabolites

Article 13 March 2024

Introduction

Dietary deficiencies cause a variety of defects in animals including arrested development¹. Most animals also host a gut microbiota that can be affected by diet or influence how animals respond to changes in diet^2,3. Wide-ranging feeding habits make insects valuable subjects for understanding how diet and gut microbes interact⁴. Holometabolous insects that undergo complete metamorphosis are also of interest because larvae and adults often consume different diets⁵. Metamorphosis is thought to be a key factor in the diversification of insects into the largest animal group on Earth⁶, but how gut microbes affect responses to dietary changes between life stages remains unclear⁷.

Mosquitoes are holometabolous insects that include many vector species which vector blood-borne pathogens to humans or other vertebrates⁸. All mosquitoes are aquatic during their immature stages with larvae usually feeding as detritivores before pupating. Terrestrial adults of both sexes consume water and sugar sources, while females usually must also blood feed on a host to produce eggs^8,9,10. Each gonadotrophic cycle is activated by a separate blood meal while successive blood meals underly how pathogens are acquired and transmitted between hosts^8,9,10. Bacteria and other microbes continuously move between the larval gut and aquatic environment, while adults maintain a gut microbiota that includes species carried over from the larval stage and that are acquired by imbibing water, sugar feeding, and mating^11,12,13.

Insects that feed on nutrient-deficient diets often host heritable microbes that function as nutritional symbionts⁴, but no heritable microbes with functions in nutrient provisioning are known in mosquitoes¹¹. Larvae can experience resource limitations in the field but in the laboratory are fed nutrient-rich diets that are thought to provide all required resources^14,15. Nonetheless, several mosquito species in axenic (AX) cultures with no commensal microbes arrest as first instars when fed laboratory diets under standard conditions (temperatures of 25–28 °C and 12–16 h light: 8–12 h dark photoperiods) that mimic what larvae usually experience in the field^16,17,18. Arrest is also associated with alterations in metabolism, gut function, and nutrient storage^19,20,21. Many species of bacteria have been identified in mosquito larvae and adults that are reared under non-sterile conditions which we hereafter refer to as conventional (CN) larvae or adults¹¹. Several species of bacteria including Escherichia coli K12 MG1655 rescue larval development to adulthood when added alone or as defined communities to AX cultures, creating a gnotobiotic (GN) culture, but these microbes have no rescue effects if dead^{16,17,18,19,20,21,22,23,24}. No larval rearing diets have been identified that enable larvae in AX cultures to develop into adults if maintained under standard rearing conditions, whereas some diets have been identified that support development of AX larvae into adults if maintained in darkness^25,26,27. These findings thus collectively suggest larval rearing diets lack or lose factors under standard conditions that mosquito larvae require for development, while some species of living bacteria can provision them.

Like other insects, mosquitoes cannot synthesize essential nutrients including B vitamins that must be acquired from other sources^26,28. To identify the factors lost from undefined diets under standard rearing conditions, we recently developed a defined (holidic) medium named H + LA that contains all essential nutrients mosquitoes are thought to require plus lactalbumin²⁶. H + LA supports development of AX A. aegypti larvae into adults in darkness but first instars arrest under standard conditions as occurs with undefined diets due to photosensitivity of select B vitamins²⁶. Riboflavin is highly photosensitive, decaying in 6–12 h under standard conditions, and is the only nutrient that causes larvae to arrest as first instars if omitted from H + LA²⁶. AX larvae likewise arrest as first instars if maintained with an E. coli K12 riboflavin auxotroph but develop normally into adults if maintained with wild-type E. coli that can synthesize riboflavin and all of the other B vitamins in H + LA²⁶. AX larvae molt to second or third instars before arresting when fed H + LA lacking thymidine or pyridoxine, while the proportion of larvae that pupate and emerge as adults is reduced in the absence of folate²⁶. Omission of the other B vitamins in H + LA (pantothenate, biotin, nicotinate) does not significantly reduce development into adults²⁶. These findings indicate larvae require bacteria like E. coli which can provision B vitamins that are absent or lost from dietary sources under standard rearing conditions. Other studies of A. aegypti have also shown that folate deficiency reduces the proportion of larvae that pupate and eclose as adults¹⁸, while studies of other insects indicate deficiencies in thiamin and other B vitamins adversely affect development or cause long-term (intergenerational) defects^28,29,30.

The sugar and blood meals adult mosquitoes consume are rich in carbohydrates or protein respectively but are deficient for other nutrients including B vitamins^31,32. Obligately hematophagous arthropods like ticks and lice host intracellular symbionts that are thought to fully or partially compensate for nutrient deficiencies in blood³². In contrast, facultatively hematophagous insects like mosquitoes have been suggested to avoid nutrient deficiencies by relying on resources larvae consume and carry over to the adult stage³². However, studies focusing on mammals indicate B vitamins are not stored and require daily repletion³³, which for holometabolous insects suggests carryover from the larval stage may be insufficient to provision adults. Prior studies of carryover effects in mosquitoes have all used CN adults or adults that developed from GN larvae but were maintained under non-sterile conditions which enables acquisition of other microbes by feeding^{17,34,35,36,37,38}. The presence of a gut microbiota in adults could thus provision B vitamins and other resources while also obscuring whether carryover effects from the larval stage enable normal function. Some studies have used short-term treatment of adults with antibiotics targeting bacteria to reduce the microbiota in CN adults^39,40. Other studies though indicate resistant bacteria and non-susceptible microbes like fungi are present in larvae or adults, while also indicating short-term treatment with antibiotics does not produce AX mosquitoes^41,42. Alternatively, approaches have been developed for producing AX adults by rearing GN larvae with particular strains of E. coli that are cleared by antibiotics or other methods^16,18. Results described above also indicate AX adults can be produced by axenic rearing in darkness^26,27. Here we asked if carryover effects from the larval stage enable AX adults to function like CN adults by measuring egg production, longevity and competence to vector dengue virus (DENV). We report that adults require a gut microbiota that includes B vitamin autotrophs for normal function.

Results

AX adult females lay smaller egg clutches than CN females

Because prior studies of carryover effects from larvae to adults have used non-sterile adults with a gut microbiota, we included CN adults as a treatment but also reared AX and CN adults as similarly as possible to minimize differences when making comparisons between treatments. Toward this end, we earlier reported that AX A. aegypti larvae produced from surface sterilized eggs do not develop beyond the first instar when maintained under standard rearing conditions but develop normally into adults in GN cultures containing certain species of bacteria in our laboratory culture or certain species of bacteria from field-collected A. aegypti including E. coli which is a known B vitamin autotroph^16,26,41. E. coli K12 MG1655 is highly susceptible to ampicillin^20,26. Treating GN cultures containing E. coli K12 MG1655 with ampicillin as second or third instars results in larvae molting to third or fourth instars but then cease to further grow because clearance of this bacterium results in riboflavin deficiency that causes developmental arrest²⁶. In this study, we added E. coli K12 MG1655 to AX cultures containing first instars fed sterile rat chow mix (RCM) diet we use for general rearing but added ampicillin when larvae were second day fourth instars (Supplementary Fig. S1). This resulted in almost all individuals molting to the pupal stage that was briefly surface sterilized with bleach before transfer to sterile water from which AX adults eclosed (Supplementary Fig. S1). The AX status of these adults was confirmed by no detection of bacterial or fungal DNA by PCR or microbial colonies when homogenates from individual adults were cultured on Luria broth (LB) plates (Supplementary Fig. S2a). Development time to pupation, female size as estimated by wing length, and sex ratio did not differ when compared to CN adults, or adults from GN cultures containing E. coli that were not treated with ampicillin (Supplementary Fig. S2b). The second approach we used to produce AX adults consisted of feeding AX larvae from surface sterilized eggs H + LA in 6-well culture plates in darkness (Supplementary Fig. S1). These larvae take 1-2 days longer to pupate but adult females do not differ in size from CN adults²⁶. CN adults used in experiments were also reared in 6-well culture plates from AX larvae that hatched from sterile eggs and were fed sterile RCM diet. However, larvae were inoculated with a mixed community of microbes prepared from our general A. aegypti culture, which earlier studies showed to result in adults having a mixed community of gut microbes that were carried over from the larval stage by transstadial transmission¹⁶. Although unnecessary for normal development, GN larvae with E. coli and CN larvae were also reared in darkness for consistency with AX larvae reared without microbes. Resulting adults from each treatment were also maintained under identical physical conditions (Supplementary Fig. S1).

Developmental arrest of AX larvae is associated with multiple defects including reduced production of ATP due to deficiencies in riboflavin-derived cofactors required for electron transport^19,20,21,26. Prior results additionally suggested that similar to mammals³³, A. aegypti does not store riboflavin which underlies why GN second and third instars arrest after molting to the third or fourth instars respectively when a complete B vitamin autotroph like E. coli is cleared²⁶. Since blood meal digestion and egg production are both metabolically costly^9,43, we first asked if AX and CN adult females exhibited differences in blood feeding and egg production. Using AX adult females produced by clearance of E. coli K12 showed that a smaller proportion blood fed when compared to CN females (Fig. 1a), but the females that did feed consumed equivalent amounts of blood as CN females (Fig. 1b). In contrast, AX females produced by clearance or axenic rearing by feeding larvae H + LA diet laid smaller egg clutches than CN females (Fig. 1c). We also assessed the number of eggs laid in a second gonadotrophic cycle because carryover of macronutrients required for egg development have previously been shown to primarily contribute to production of a first clutch^9,44. Again, AX females produced by clearance or axenic rearing laid smaller second clutches than CN females (Fig. 1d). Dissection of spermathecae from ten randomly selected AX females produced by clearance or AX rearing of larvae showed that all were mated indicating the smaller clutch sizes were not due to being unfertilized. We also measured the proportion of eggs that hatched for 22 egg clutches (1462 eggs total) laid by AX females produced by clearance and 27 egg clutches (1,555 eggs total) laid by CN females after the first blood meal was consumed. No difference in hatch rates was detected (66% for AX females, 65% for CN females, p = 0.4, contingency table analysis), but we did not rear these larvae to assess whether differences existed in subsequent growth, pupation or adult emergence.

**Fig. 1: AX females lay fewer eggs than CN females.**

Axenic females exhibit defects in egg maturation and nutrient storage

Each gonadotrophic cycle in A. aegypti consists of a previtellogenic phase before blood feeding that produces primary follicles followed by a vitellogenic phase after blood feeding that stimulates primary follicles to develop into mature eggs⁴³. Key events during the vitellogenic phase include: 1) release of neuropeptide hormones in response to blood feeding that activate primary follicles and ecdysteroid production by the ovaries; 2) biosynthesis of the yolk protein vitellogenin by the fat body in response to ecdysteroids, insulin-like peptides (ILPs) and target of rapamycin signaling, 3) yolk packaging into oocytes of primary follicles, and 4) digestion of the blood meal, which primarily consists of protein, by midgut-produced serine-like protease VI (AaSPVI) and late trypsin (AaLT) that ecdysteroids and ILPs co-regulate^45,46,47,48. Since AX females produced by clearance of E. coli or axenic rearing both laid fewer eggs than CN females, we used the former to determine if smaller clutches were associated with defects in egg formation or oviposition. Results showed that the ovaries produced less ecdysteroids while primary follicles packaged less yolk, which is a well-established measure of egg maturation (Fig. 2a–d)^45,49. The fat body also produced less vitellogenin in AX than CN females during both gonadotrophic cycles (Fig. 2e), while focusing on the first gonadotrophic cycle indicated transcript abundances for AaSPVI and AaLT in the midgut were lower in AX than CN females (Fig. 2f).

**Fig. 2: AX females exhibit multiple defects during oogenesis.**

Macronutrients carried over from the larval stage are often referred to as teneral reserves that adults primarily store as neutral lipid droplets (LDs) in the fat body^9,50,51. Adult females additionally convert carbohydrates from sugar feeding and protein from blood feeding to triacylglycerol (TAG) and other neutral lipids in the midgut that are transported and stored in the fat body as LDs^50,51. We detected only low levels of TAG in the midguts of CN and AX adults produced by clearance after blood feeding, which was consistent with earlier results showing that the mosquito midgut rapidly transports neutral lipids to the fat body (Fig. 3a)^21,50,51. LDs transiently increased more in the midguts of AX than CN females after blood feeding but declined to similarly low levels by 72 h PBM (Fig. 3b). In contrast, lipid stores as measured by TAG and LDs in the fat body were larger in 4 day old non-blood fed (=0 h PBM) CN than AX females (Fig. 3c, d). TAG and LDs per adipocyte also declined in CN females after blood feeding which was consistent with nutrient mobilization that normally occurs⁵¹, whereas TAG and LDs did not decline after AX females blood fed (Fig. 3c, d). Thus, the smaller clutch sizes laid by AX females reflected: 1) lower ecdysteroid synthesis, 2) lower vitellogenin production and yolk deposition into primary follicles, and 3) reduced lipid stores in the fat body.

**Fig. 3: AX females store and mobilize less lipid in the fat body during a gonadotrophic cycle.**

AX females provisioned with B vitamins or B vitamin autotrophs lay similar clutch sizes as CN females

The sugar meals adult females were fed contained no B vitamins while vertebrate blood also contains low amounts of B vitamins³². We thus assessed whether the smaller clutch sizes AX females laid were due to B vitamin deficiency. Adding all of the B vitamins in H + LA to the sugar solutions AX adults were provided ad libitum resulted in females laying first and second clutch sizes that did not differ from CN females (Fig. 4a, b). While loss of riboflavin, thiamin or pyridoxine inhibit A. aegypti larvae from pupating²⁶, adding only these B vitamins to sugar solutions did not restore egg production to CN levels (Fig. 4a). Omitting folate from H + LA also earlier reduced the proportion of AX larvae that developed into adults²⁶ while adding folate to an undefined diet increased the proportion of larvae that emerged as adults after clearance of an E. coli auxotroph¹⁸. However, provisioning only folate to AX females resulted in first clutch sizes that were smaller than those laid by CN females (Fig. 4a). Thus, AX females required multiple B vitamins to lay egg clutches that did not differ from those of CN females.

**Fig. 4: B vitamins and B vitamin autotrophs increase clutch sizes laid by AX females to similar levels as CN females.**

The AX and CN adults used in the preceding assays were reared as similarly as possible, but nonetheless differed in terms of microbial exposure. We therefore also assessed whether reintroducing bacteria to AX adults produced by clearance of E. coli also increased clutch sizes. As earlier noted, we had previously isolated several members of the CN community in our laboratory A. aegypti culture^16,22,24. From these, we selected four species (Serratia sp. named strain UGAL515B_01, Delftia sp. UGAL515B_02, Acinetobacter sp. UGAL515B_03 and Sphingobacterium sp. UGAL515B_04) that earlier results showed to support development into adults when added to AX larval cultures^22,24. We sequenced each using the PacBio platform, which yielded complete genome assemblies, predicted coding sequences (CDSs) and other metrics (Supplementary Table S1). Metabolic network reconstruction predicted Serratia sp. is a complete autotroph for all of the B vitamins in H + LA (Supplementary Fig. S3) which as earlier noted is also the case for E. coli K12²⁶. Sphingobacterium sp., Acinetobacter sp, and Delftia sp. were predicted to have complete de novo synthesis pathways for riboflavin, thiamin, pantothenate, biotin, and folate but lacked genes in the canonical deoxyxylulose-5-phosphate (DXP) dependent and independent pathways for biosynthesis of pyridoxine (Supplementary Fig. S3). However, some bacteria also recycle and/or use incompletely understood alternative routes for pyridoxine biosynthesis^52,53, which suggest these species could also provision this vitamin. We additionally did not identify homologs for nadD in Acinetobacter sp. or Delftia sp., which is required for converting nicotinate to NAD⁺ or NADP⁺ but A. aegypti encodes this gene, which suggested it uses nicotinate from bacteria or dietary sources (Supplementary Fig. S3). In contrast, A. aegypti lacks most other genes required for synthesis of the B vitamins in H + LA (Supplementary Fig. S3). Individually adding each of these bacteria to the sugar solutions AX adults were provisioned on the day of emergence resulted in each persisting in the gut for 9 days in females that were blood fed on day 4 post-emergence (Supplementary Fig. S4). Abundances were relatively constant for some species while others increased to 10⁶−10⁸ CFUs after blood feeding before declining by 9 days to densities that were similar to before blood feeding (Supplementary Fig. S4). Females provisioned with these bacteria also laid larger clutches than AX females with the possible exception of Delftia sp. as did CN females (Fig. 4c). Unexpectedly though, a higher proportion of females hosting E. coli K12, Delftia sp., and Acinetobacter sp. died after laying a first clutch when compared to AX females (Fig. 4d). This finding suggested these bacteria adversely affected adult females that blood fed although none showed adverse effects in earlier studies conducted in larvae^16,22,24. Since the Serratia sp. did not reduce adult survival and was also predicted to be a complete B vitamin autotroph, we measured second clutch sizes laid by females hosting this bacterium which showed that clutch sizes were also similar to those laid by CN females but were larger than those laid by AX females (Fig. 4e). Thus, provisioning AX females with B vitamins or reintroducing B vitamin autotrophs both increased clutch sizes to levels laid by CN females.

Axenic adults exhibit lower metabolic rates but longer lifespans that are also restored by B vitamin provisioning

In the field, A. aegypti spends long periods resting on walls or other surfaces and is thought to only fly short distances over its lifetime⁵⁴. Activity assays in the laboratory similarly indicate adults spend ~75% of their time on average resting⁵⁵. We also observed predominant resting and infrequent flight for both AX and CN adults. For most organisms including insects, O₂ input directly correlates with CO₂ output which reflects overall metabolic levels that can be compared if activity levels do not differ between treatment groups⁵⁶. We thus established cages in which AX adults produced by clearance of E. coli or CN adults were provided ad libitum access to water and sucrose. We then measured CO₂ production in resting adults of increasing age as a proxy for metabolic rate. AX males produced less CO₂ than CN males at each sample time, whereas AX females produced less CO₂ than CN females at 10 and 20 days old (Fig. 5a, b). In contrast, provisioning the B vitamins in H + LA to AX adults through sugar solutions resulted in 10 day old AX females producing CO₂ levels that did not differ from CN females (Fig. 5c). Inoculating AX females produced by clearance with the Serratia sp. UGAL515B_01 that rescued egg production resulted in 10 day old females that produced more CO₂ than AX females but less than CN females (Fig. 5c). Since metabolic rates were overall lower in AX than CN adults but increased with B vitamin provisioning, we also measured survival rates. Strikingly, AX males and females lived longer than CN males and females, whereas provisioning B vitamins or reintroducing Serratia sp. resulted in survival curves that did not differ from CN adults (Fig. 5d, e).

**Fig. 5: AX mosquitoes exhibit lower metabolic rates and longer lifespans than CN females.**

Axenic females exhibit lower DENV vector competence

A. aegypti is the primary vector of dengue virus (DENV), which annually infects more than 100 million humans worldwide⁵⁷. Previous studies report that certain commensal bacteria in larval cultures have carryover effects that reduce DENV vector competence in CN adults by unknown mechanisms^17,38, while short-term pretreatment of CN adults with antibiotics increased vector competence as measured by higher DENV midgut titers 7 days post-infection (dpi)⁴⁰. This latter outcome was further hypothesized to occur because bacteria in the gut prime the immune system to increase defense against arboviruses^58,59,60,61, whereas treatment with a cocktail of antibacterial agents reduced microbiota abundance in the gut and associated defense⁴⁰. However as earlier noted, studies also report that resistant bacteria and other microbes like fungi that are non-susceptible to antibacterial agents are commonly present in CN mosquitoes that are not cleared by antibiotic treatment^41,42.

Given this background, we first asked if vector competence of AX females produced by clearance of E. coli or axenic rearing exhibited differences in DENV vector competence relative to CN adults. The potential for carryover effects also prompted us to produce AX adults by a third method that replaced lactalbumin in H + LA with autoclaved E. coli K12 (H + EC) that similarly supports development into adults if maintained in darkness but also results in larvae contacting dead bacteria during growth²⁶. AX and CN adults were then fed infectious blood meals containing DENV type 2 (DENV-2) at a titer of 1 × 10⁶ TCID₅₀ per ml, and following an extrinsic incubation period of 7 days, total viral load per tissue was estimated by RT-qPCR that measured genome copy number. Infection prevalence and genome copy number was higher in CN adults than AX adults produced by clearance or axenic rearing on H + Ec (Fig. 6a, b). In contrast, AX females produced by clearance that were provisioned with B vitamins in sugar solutions or by introducing Serratia sp. UGAL515B_01 exhibited infection prevalences and DENV genome copy numbers after a 7 day extrinsic incubation period that were similar to CN females (Fig. 6a, b). Serratia marcescens is an opportunistic pathogen of many insects⁶², but has also been shown to promote DENV infection of A. aegypti through a secreted protein named enhancin that digests mucins lining the midgut⁶³. Earlier studies of another Serratia sp. also describe a protein with similar properties to enhancin⁶⁴. However, phylogenetic analysis indicated Serratia sp. UGAL515B_01 is not closely related to S. marcescens (Supplementary Fig. S5), and does not encode an enhancin homolog. Extending our analysis of AX females produced by clearance to 14 dpi indicated infection prevalence remained lower than in CN females (Fig. 6c). Prevalence of a disseminated infection to the head and legs, which served as a proxy for transmission potential, also trended lower in AX than CN females (Fig. 6d), but we detected no difference in DENV-2 genome copy number between AX and CN females for those females with a disseminated infection (Fig. 6e). Overall, these results indicated DENV-2 vector competence was lower in AX than CN adults but increased in AX females that were provisioned with B vitamins or a B vitamin autotroph (Serratia sp. UGAL515B_01) lacking an enhancin homolog.

**Fig. 6: AX females exhibit lower DENV-2 vector competence than CN females.**

The preceding outcomes were also opposite results where CN adults pretreated with antibiotics exhibited increased DENV competence⁴⁰. We thus repeated the same antibiotic regimen (AB 1x) with CN females from our own A. aegypti culture followed by feeding a high titer infectious blood meal (10⁶ TCID₅₀/mL). Almost no mortality occurred in untreated CN females, whereas pretreatment with AB 1x resulted in 56% mortality by 5 dpi and 78% mortality by 14 dpi suggesting off target effects (Supplementary Fig. S6a), which had earlier also been observed when CN larvae were treated with antibiotics⁴¹. Reducing antibiotic concentrations 10-fold (AB 1/10x) resulted in no significant differences in mortality when compared to untreated females (Supplementary Fig. S6a). We also altered conditions by lowering DENV titer of the infectious meal to 10⁴ TCID₅₀/mL and found that this modestly improved AB 1x survival (Supplementary Fig. S6b). We therefore used low titer infectious blood meals to investigate effects of antibiotic treatment on A. aegypti DENV competence. However, because of the continued high mortality of females treated with AB 1x, we only assessed the proportion of females that were DENV-infected at 5 dpi. A higher proportion of A. aegypti treated with AB 1/10x were infected with DENV-2 but no difference in infection prevalence was detected for the AB 1x treatment when compared to CN control females (Supplementary Fig. S6c). DENV-2 titer per female in the midgut was also modestly higher in the AB 1/10x treatment females but no difference in titer was detected between females treated with AB 1x and the CN control (Supplementary Fig. S6d).

Discussion

Our interest in conducting this study stemmed from the literature which suggests facultatively hematophagous insects like mosquitoes avoid nutrient deficiencies by carryover of B vitamins and potentially other nutrients from larvae³². However, other results indicate animals including mosquitoes do not store B vitamins^26,33, while prior studies of carryover effects in mosquitoes have used non-sterile adults with microbes that could provision B vitamins^{17,34,35,36,37,38}. We therefore produced AX adults by clearing GN larvae of E. coli K12 which is a B vitamin autotroph that fully supports growth of larvae into adults^16,26. We also produced AX adults by axenic rearing given evidence suggesting microbes present during the larval stage can affect adult fitness traits³⁸. We then compared these treatments to CN adults produced from larvae with a microbiota from our A. aegypti culture because the latter provided a reference for ‘normal’ function and other studies of carryover effects in the literature that used non-sterile adults. We also reared this CN treatment as similarly as possible to minimize differences with the AX treatments.

Our results show that clutch sizes and adult longevity do not differ between the AX treatments we generated but do substantially differ from the CN treatment. The clutch sizes laid by CN females in this study are also very similar to the clutch sizes females in our laboratory culture lay^65,66. We thus hypothesized the B vitamins E. coli K12 and H + LA provision larvae do not carry over to the adult stage which would be consistent with earlier results indicating A. aegypti does not store riboflavin²⁶. Our finding that provisioning B vitamins to AX adults restores clutch sizes and longevities to CN levels also supports this hypothesis while also supporting other studies indicating vertebrate blood is B vitamin deficient³². We recognize though rearing conditions, while very similar, were not fully identical for our AX and CN treatments. We therefore also used AX adults produced by clearance to assess whether clutch sizes increase if E. coli K12 is reintroduced or conventional community members that are also B vitamin autotrophs are introduced. Results indicated clutch sizes increased when compared to the AX control but were very similar to CN adults or AX adults provisioned with B vitamins. Taken together, these findings strongly indicate carryover effects from the larval stage do not enable AX adults to function normally as compared to our CN treatment. That several B vitamin autotrophs increase clutch sizes comparably to B vitamin supplementation also strongly suggest adults require a gut microbiota under normal rearing conditions to provision B vitamins for normal function.

We are unclear why introducing E. coli K12, Delftia sp. and Acinetobacter sp. increased mortality after adult females blood fed and laid eggs in this study. Prior results implicate the gut microbiota in blood meal digestion while also showing that some bacteria increase in abundance in the gut after blood feeding³⁹. Such increases could potentially underlie the increase in mortality we observed in the case of Delftia sp. and Acinetobacter sp. that both rose to more than 10⁸ CFUs per female after blood feeding which was approximately a log unit higher than the increase in total culturable bacteria detected in CN females (Supplementary Fig. S4). However, this pattern does not explain mortality associated with reintroducing E. coli K12 to AX adults as this species did not substantially increase after blood feeding. We also observed no increase in mortality in females with Sphingobacterium sp. that increased in abundance after blood feeding similarly to females hosting a CN community. Thus, other factors besides density underlie the increase in mortality we observed. However, these outcomes were why we restricted our measures of second clutch sizes, metabolic rates and DENV vector competence to introducing Serratia sp. UGAL515B_01 that is a complete autotroph for all of the B vitamins mosquitoes appear to require for development²⁶.

The smaller clutches AX females laid in this study are associated with defects in vitellogenesis but our finding that AX females produce similar numbers of eggs as CN females when provisioned with B vitamins or bacteria that are B vitamin autotrophs suggest defects in vitellogenesis are due to B vitamin deficiencies. Earlier studies in larvae indicate B vitamin deficiencies also cause a number of physiological defects that are most severe in the absence of riboflavin which prevents larvae from growing or molting²⁶. Larvae likewise arrest if reared with an E. coli K12 auxotroph that cannot produce riboflavin, whereas adding riboflavin to the diet or replacing this auxotroph with wild-type E. coli restores normal growth²⁶. However, the loss of other B vitamins including thiamin, pyridoxine and folic acid also cause growth defects in A. aegypti larvae^18,26. In this study, provisioning all of the B vitamins in H + LA to AX adults increased egg clutch sizes to the numbers laid by CN adults, but provisioning only riboflavin pyridoxine and thiamin or only folic acid did not suggesting insufficient carryover from larvae combined with additional deficiencies in sugar and blood results in AX adults lacking other B vitamins that are required for normal egg production and longevity.

We have not conducted a metagenomic analysis of the community of bacteria present in our laboratory A. aegypti culture, but our isolation, sequencing and annotation of four community members that earlier studies showed to support development of AX larvae into adults²⁴ indicates each is a complete or near complete B vitamin autotroph, which also strongly suggests the CN community as a whole can provision B vitamins to larvae and adults in our culture. Variable communities of bacteria have been identified from A. aegypti and other mosquitoes in the field and laboratory^11,67. However, we think it likely most communities of microbes associated with mosquitoes contain bacteria that are partial or complete B vitamin autotrophs given the comparative literature which indicates many environmental bacteria in families and genera that are common community members in mosquitoes synthesize riboflavin and other B vitamins^68,69. Our previous results also identify several bacteria from field and laboratory cultures that enable AX larvae to develop into adults which suggests these unsequenced species are also B vitamin autotrophs in light of evidence showing that wild-type E. coli K12 rescues growth of AX larvae but mutants defective for synthesis of, for example, riboflavin cannot^{16,17,22,26,41}. However, a few studies do report that supplementing CN cultures with B vitamins enhances mosquito fitness as measured by development time, adult longevity and egg production, which suggests microbial communities may not always provision sufficient amounts of one or more B vitamins^70,71. As earlier noted, mosquitoes are unknown to host any heritable microbes that function as nutritional symbionts. One strain of Wolbachia has been identified that likely provisions riboflavin and biotin to obligately hematophagous bedbugs⁷². While some mosquitoes host natural Wolbachia infections, no role for Wolbachia in nutrient provisioning has been identified⁷³. We thus hypothesize the prevalence of partial or complete B vitamin autotrophs in the environments where mosquitoes live reduces selection pressure to evolve associations with heritable symbionts to provision B vitamins.

In a previous study, AX A. aegypti produced by clearing a strain of E. coli resulted in no differences in egg production after the first gonadotrophic cycle or longevity when compared to GN progeny that were not cleared¹⁸. A higher proportion of these AX and GN adults also oviposited than CN adults while the CN adults that oviposited laid smaller clutches than the AX and GN females¹⁸. However, we also note the proportion of CN females that oviposited after blood feeding (~20%) and the clutch sizes laid (30–40 eggs) by CN, GN, and AX adults in this study are much lower than the UGAL strain we used and A. aegypti cultures used in other studies where more than 90% of females oviposit and lay clutch sizes of 80–120 eggs^65,66,74. Longevity of the AX and GN adults in this earlier study¹⁸ were also more similar to the AX than the CN or rescued AX adults in this study. However, the GN adults in this previous study were noted to host very small numbers of E. coli owing to low transstadial transmission while no rescue experiments were conducted¹⁸. We too have observed that only low densities of E. coli K12 are transstadially transmitted to GN adults using our UGAL strain of A. aegypti, which could potentially contribute to bacterial abundance being too low to increase B vitamins and clutch sizes. A. aegypti adults developing from CN larvae have also been reported to have longer lifespans than adults from GN larvae that were reared with a single a commensal microbe³⁸. Interpreting this finding in the context of this study though is difficult because adults were non-sterile and thus cannot be compared to the AX adults we assessed.

Resource constraints often promote trade-offs between reproduction and longevity in animals^75,76, which is broadly consistent with AX adults producing fewer eggs but living longer than CN adults. However, results from this study further indicate AX adults have lower metabolic rates than CN adults. This latter point is of interest because several B vitamins produce cofactors with essential functions in metabolism including riboflavin that is required for electron transport and ATP production by mitochondria²⁶. Defects in mitochondrial function and lower metabolic rates have also been shown to increase longevity in model organisms like Caenorhabditis elegans through alterations in signaling processes^77,78. Thus, a potentially important future direction for study is understanding how deficiencies in B vitamins like riboflavin affect mosquito metabolism and potential consequences for a range of physiological processes.

Similar to egg production and longevity, our results indicate DENV-2 vector competence is lower in AX than CN females but is also rescued by B vitamin supplementation or introduction of a B vitamin autotroph to the midgut. These outcomes suggest the gut microbiota in the adults used in this study increase DENV-2 vector competence by provisioning B vitamins deficient in sugar and blood meals which is consistent with studies indicating arboviruses like DENV substantially depend on host cell metabolism for replication^79,80. The lower DENV-2 titers detected in AX females that developed from larvae with E. coli K12 versus without (see Fig. 6b) could suggest a carryover effect from the larval stage that further reduces DENV titers in AX adults at 7 dpi by unknown means. Our results showing that DENV vector competence is similarly increased by B vitamin provisioning or addition of a complete B vitamin autotroph like Serratia sp. UGAL515B_01 further favor the suggestion both treatments increase host metabolism which promotes viral replication. In contrast, our results do not indicate Serratia sp. UGAL515B_01 encodes an enhancin or is closely related to Serratia marcescens that increases DENV vector competence via the activity of enhancin⁶³. In contrast, other commensal or heritable microbes like certain strains of Wolbachia strongly reduce DENV vector competence by still incompletely understood mechanisms^59,60,61.

Methods

Ethics statement

No vertebrate animals were used in the study. For maintenance of the A. aegypti mosquito culture, adult females were blood-fed with or without DENV using membrane feeders and commercially purchased rabbit blood (Hemostat Laboratories) with protocols approved by the University of Georgia institutional Biosafety Committee protocol 2022-0047.

Laboratory A. aegypti culture

The University of Georgia strain of A. aegypti (UGAL) was maintained in an insectary under standard conditions (27 °C, 70% relative humidity, and a 12 h light: 12 h dark photoperiod) as earlier described⁶⁵. Larvae were reared in pans containing 1 L water and fed rat chow mix (RCM) diet consisting of ground rat chow pellets (LabDiet 5001), lactalbumin (Sigma), and torula yeast extract (Bio-Serve) mixed in a ratio of 1:1:1 by volume. Adults were held in cages with ad libitum access to cotton-wick feeders containing 10% sucrose in water. Adult females (4–6 days old) for the general culture were fed defibrinated rabbit blood (Hemostat Laboratories) in water-jacketed glass (Rutledge) feeders warmed to 37 °C with Parafilm® as the membrane to produce eggs that were hatched for colony maintenance 10–14 days after oviposition.

Bacteria

Glycerol stocks of Escherichia coli str. K12 substrain MG1655 were earlier prepared¹⁶. Glycerol stocks were also prepared for Serratia sp. strain UGAL515_B1, Sphingobacterium sp. strain UGAL515_B2, Acinetobacter sp. strain UGAL515_B3, and Delftia sp. strain UGAL515_B4 that were identified from UGAL A. aegypti²⁴. Each was cryopreserved at −80 °C and used in this study by streaking onto Luria-Bertani (LB) medium-agar plates with no antibiotics. Liquid cultures used to inoculate AX larvae (see below) were grown overnight from a single colony in antibiotic-free Luria-Bertani (LB) broth at 37° (E. coli) or 30 °C (all other bacteria used in assays) in shaking incubators. Cultures with an optical density of 1 at 600 nm contained ~1×10⁹ colony forming units per ml²⁴. Water was collected from a rearing pan in the general culture containing fourth instars. After removal of debris by gentle centrifugation (200 × g for 1 min), the microbial community in this water was collected by centrifugation at 6000 × g for 15 min by discarding the supernatant and cryopreserving the remaining pellet at −80 °C after resuspension in sterile glycerol and water (1:1). This community of microbes was then used to produce the adults with a conventional (CN) microbial community used in bioassays.

Whole genome sequencing of bacteria and reconstruction of B vitamin biosynthesis pathways

DNA was isolated by phenol/chloroform extraction from bacterial cells grown on LB agar at room temperature (Pacific Biosciences, https://www.pacb.com/wp-content/uploads/2015/09/SharedProtocol). After quantification by Nanodrop (Eppendorf) and quality checking by gel electrophoresis, DNA was sequenced using the PacBio Sequel system at the UGA Georgia Genomics and Bioinformatics Core. De novo assembly of the raw PacBio data was performed independently using Flye V2.8 for Serratia sp. UGAL515_B1 and Sphingobacterium sp. UGAL515_B2 or Canu v 2.1.1 for Acinetobacter sp. UGAL515_B3 and Delftia sp. UGAL515_B4 followed by quality assessment using QUAST v5.02 and annotation using the PGAP pipeline^81,82,83,84. RNAmmer and tRNAscan-SE was used for RNA annotation^85,86. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was performed by annotating the genes in each bacterium we sequenced, E. coli K12, and A. aegypti with KO identifiers using the KEGG Automatic Annotation Server⁸⁷. KEGG Mapper was then used to match genes with the pathway in the KEGG database to infer biosynthetic capabilities⁸⁸. The basic local alignment search tool was used to assess whether a homolog for S. marcescens enhancin⁶³ was present in the genome of Serratia sp. UGAL515_B1.

Axenic (AX) and conventional (CN) cultures

AX and CN adults were reared as larvae under identical conditions in 6 well culture plates (Corning) (Supplementary Fig. S1). Ten-14 day old eggs from the general culture were surface-sterilized as earlier described¹⁶ with the exception that 0.1% Roccal (Pfizer) was replaced with 0.1% D-256 (Vedco). Surface sterilized eggs were transferred to a 10 cm² culture flask (Corning) containing sterile water where AX first instars hatched. To produce AX adults from larvae that were cleared of E. coli, 5 AX first instars were placed 6-well culture plates (Corning) in which each well contained 5 ml of sterile water. Sixty μl of E. coli K12 (~10⁸ CFUs) from an overnight culture was then pelleted and resuspended in sterile water before adding to the well. Resulting GN larvae were fed RCM diet that had been sterilized by gamma irradiation to 10 kGy under standard conditions (Supplementary Fig. S1)¹⁶. Although unnecessary for growth, GN larvae were reared in darkness to be consistent with rearing of larvae in AX cultures (see below). Ampicillin (Sigma) was added at 100 ug/ml to each culture well 48 h after GN larvae had molted to the fourth instar, which was followed by pupation the next day. Pupae were collected, surface sterilized using 2% bleach, and transferred to cups containing sterile water that were placed in sterile nested containers where AX adults emerged (Supplementary Fig. S1). To produce AX adults without exposure to living bacteria, five AX first instars from surface sterilized eggs were added per culture well containing 5 ml of sterile water and fed H + LA or H + EC diet in darkness as earlier described²⁶. We fed AX larvae these diets because prior results indicated RCM diet is riboflavin deficient²⁶. Resulting pupae were transferred to cups containing sterile water that were placed in sterile nested containers similarly to AX adults that were produced by clearance of E. coli (Supplementary Fig. S1). CN adults were produced by placing five AX first instars from surface sterilized eggs per culture well containing 5 ml of sterile water that was inoculated using a sterile loop with the mixed community of microbes in the glycerol stock prepared from the general culture (see above). CN larvae were then fed gamma irradiated RCM diet and maintained in darkness to be consistent with GN and AX larvae until pupation. Resulting pupae were transferred to cups containing sterile water that were placed in nested containers as used for AX adults (Supplementary Fig. S1). All adult mosquitoes used in bioassays were provided ad libitum access to sterile water or 10% sucrose solutions that were replaced daily. Females were blood fed using defibrinated, sterile rabbit blood in small-scale membrane feeders⁶⁰ that were surface sterilized using 70% ethanol (3 min), povidone-iodine (Betadine) (3 min), and 70% ethanol (3 min) before air drying. Females were allowed to feed for 30 min or 1 h depending on assay (see below).

Sterility assessment

Culture- and polymerase chain reaction (PCR)-based methods were used to screen for sterility in all cohorts of AX larvae hatched from surface sterilizing eggs or AX adults used in bioassays. We also screened all cohorts of GN or CN progeny. Larvae or adult samples were homogenized (whole-body without external sterilization) in sterile phosphate-buffered saline (PBS) and spread onto antibiotic-free LB-agar plates that were incubated at 30 °C for three days to confirm either no microbial growth (AX adults), colonies with morphology corresponding to E. coli K12 (GN progeny), or colonies with different morphologies (CN progeny). PCR assays were conducted to assess status by isolating total DNA from mosquitoes followed by reactions using universal primers 27 F (5’-GAGAGTTTGATCCTGGCTCAG-3’) and 1492 Rv (5’-GGTTACCTTGTTACGACTT-3’) that amplify a portion of the bacterial 16 S rRNA gene or near-universal primers ITS1-F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and LR3 (5’-CCGTGTTTCAAGACGGG-3’) that amplify a fungal internal transcribed spacer (ITS) region⁸⁹. PCR products were visualized on 1% agarose gels stained with ethidium bromide, run at 90 V for 45 min (LabNet Gel Electrophoresis System). Detection of amplicons in cohorts from larvae inoculated with E. coli K12 or microbes from CN glycerol stocks together with appropriate colony morphologies on culture plates were classified as GN or CN mosquitoes while extracts that generated no visible 16 S or ITS amplicons or colonies were classified as AX mosquitoes (Supplementary Fig. S2). Contamination was infrequent but any cohort that deviated from these outcomes was discarded. For adults that were provided E. coli K12 or Serratia sp. in sugar solutions, 4 females per treatment at 3 days post-inoculation, 24 h post-blood meal (4 d post-inoculation), and 4 days post-bloodmeal (8 d post-inoculation) were sampled for whole-body CFU counts by plating E. coli-fed mosquito homogenates on LB-agar and Serratia sp.-fed mosquito homogenates on tryptic soy agar (TSA).

Development metrics

Development time to pupation (days) was assessed for GN progeny with E. coli K12, AX progeny produced by clearance of E. coli K12 using ampicillin, or CN progeny with at least three different rearing cohorts consisting of at least 10 individuals per replicate being measured. Sex ratio was determined by tallying number of males and dividing by the total number of adults per replicate. Wing length of adults was used as a proxy for body size and was assessed by removing and slide-mounting the one wing per adult and measuring the length in mm from the alular notch to the wingtip apex^22,24. Adult survival was tracked daily beginning from 24 h post-eclosion until all individuals were dead for 3 independent replicate cages that each contained 20–30 males or females; both sexes were provided sterile 10% sucrose ad libitum and females were additionally blood-fed on day four. For the duration of survival assays all adults were held in a climate-controlled incubator under standard conditions.

Blood feeding and clutch sizes

The proportion of AX females produced by clearance and CN females that blood fed was assessed by providing membrane feeders to females and counting the number of engorged individuals after 1 h divided by the total number females present. The amount of ingested blood per female was estimated by cold-anesthetizing and weighing 5 cohorts of 10 CN females or 8 cohorts of 10 AX females using an analytical balance (Ohaus DV215CD) to generate an average NBF mass for each replicate. Females were given 8 h to recover, blood fed, and replete females were isolated and weighed, again pooled by replicate, within 15 min to generate median, minimum and maximum blood meal weights (mg) per female.

Clutch sizes laid by adult females were assessed by provisioning filter-sterilized water and sugar solutions ad libitum. All B vitamins at the same working concentration as in H medium²⁶ (thiamin 268 ng/ml, riboflavin 990 ng/ml, nicotinic acid 1 ug/ml, pyridoxine 1.5 ug/ml, calcium pantothenate 332 ng/L, biotin 28 ng/L, and folic acid 300 ng/ml)²⁶ were provisioned to AX females by adding them daily to sugar solutions. Bacteria from cultures grown in Luria-Bertani broth were pelleted by centrifugation, rinsed 2X in sterile water and added to sugar solutions at a density of 10⁶ CFUs/ml that were provisioned to newly eclosed AX females produced by clearance for three days. For each treatment, females were blood fed on day 4 post-emergence for a first gonadotrophic cycle and day 8 post-emergence for a second gonadotrophic cycle using defibrinated, sterile rabbit blood in small-scale membrane feeders as described above. Females were allowed to feed for 30 min. First and second clutch sizes were determined by selecting females from four independent rearing cohorts and placing them in sterile, polypropylene cups with screen lids (2.86 cm×2.86 cm, US Plastics) that contained sterile wetted paper as an oviposition site. At 3 d post-inoculation, 24 h post-blood meal, and 4 d post-bloodmeal ( = 9 days old), four females per treatment were sampled for whole-body CFU counts using culture-based methods⁹⁰. E. coli-fed mosquito homogenates were plated on LB-agar, Delftia sp.-fed mosquito homogenates on 869 medium while the other treatments including the sterile AX control were cultured on tryptic soy agar.

Vitellogenesis assays

Activation of the vitellogenic phase in the first and second gonadotrophic cycle was assessed by measuring ecdysteroid production by the ovaries, yolk deposition into oocytes, and vitellogenin production by the fat body. Ecdysteroids were quantified using a previously established ex vivo enzyme immunoassay⁹¹. Samples were generated by incubating paired ovaries from two females were collected by dissection at 20 h PBM and cultured in 60 µl of Beyenbach’s saline for 6 h at 27 °C and ~90% RH. The ecdysteroids secreted into the saline solution were then determined by EIA using primary antibody EAB27 and 20E standards (Sigma) with 7–15 biological replicates obtained for each treatment and time point⁹¹. Yolk deposition into oocytes was measured in μm along the anterior-posterior axis as illustrated in Fig. 2b, averaged for three representative oocytes per female with at least 5 females measured from three independent rearing cohorts. Vitellogenin was visualized by collecting ovaries from two females and remaining abdomens containing the fat body in Pro-Prep™ (iNtRON Biotechnology) plus 10x Halt™ protease and phosphatase inhibitor cocktail (ThermoFisher). Following homogenization, sonication, and centrifugation to remove debris, protein extracts were mixed with Laemmli sample buffer (Bio-Rad) containing 5% ß-mercaptoethanol and boiled for 10 min. Samples contained pooled tissues from two individuals, while a 1/5 tissue equivalent for fat body samples and a 1/10 tissue equivalent for ovary samples were loaded per lane for each treatment. Samples were electrophoresed at 100 V for 1 h using 4–20% Tris-glycine polyacrylamide gels (Mini-PROTEAN TGX stain-free, Bio-Rad), then transferred to polyvinyl difluoride (PVDF; ThermoFisher) using 0.35 A for 1 h. Blots were blocked in 5% nonfat dry milk in PBS with 0.1% Tween 20 for 1 h, then probed with rabbit anti-Vg (1:80,000) in milk block overnight. Following three washes in PBS with 0.1% Tween 20, blots were probed with a peroxidase-conjugated goat anti-rabbit secondary antibody (1:5,000; Jackson) in milk block for 2 h followed by application of Clarity™ ECL chemiluminescent substrate (Bio-Rad) and imaging (Syngene G:Box). Immunoblots were repeated in triplicate using independently collected samples.

Relative transcript abundance of late trypsin-like genes was analyzed by real-time quantitative reverse transcriptase PCR (rqRT-PCR) using total RNA from 24 h PBM midguts (two midguts per replicate, 4 biological replicates per treatment) extracted in Trizol reagent (Ambion). cDNA was generated using iScript (Bio-Rad) while gene specific primers were designed and purchased (IDT) for: Aedes aegypti early trypsin (AaET, X64362.1; forward 5’-ACCGTGGCAGATGGAGCTATG-3’; reverse 5’-GGCATAACCAGCGCAGATCAT-3’; Aedes aegypti late trypsin (AaLT, M77814.1; forward 5’-GGAAGTGATACCTTTACCGACCG-3’; reverse 5’-GATCACCAACGGGCTGTAGGC-3’), and Aedes aegypti serine protease VI (5G1) (AaSPVI, GQ398048; forward 5’-AGGAATGCCACAAGGCTTACTTGA-3’; reverse 5’-CCATAACCCCAGGATACCACT-3’) (35). Aedes aegypti actin (AaACT, KY000701) was used as reference gene using primers forward 5’-CGTTCGTGACATCAAGGAAA-3’ and reverse 5’-GAACGATGGCTGGAAGAGAG-3’^31,58. Reactions contained 3 µl cDNA, 2 µl forward/reverse primers 5 µM, and 5 µl iQ SYBR Green Supermix (Bio-Rad 170-8882) and were run using a Rotor-Gene Q real-time PCR cycler (Qiagen) under the following conditions: denaturation at 95 °C for 10 sec and annealing at 60 °C for 45 sec, for a total of 30 cycles. Relative transcript abundance of each target gene relative to AaACT and fold change compared to non-fed controls was calculated using the ΔΔCT method⁵¹.

Triacylglycerol and lipid droplet quantification

TAG stores in the fat body of previtellogenic and vitellogenic females was measured by collecting abdomens with the gut and ovaries removed (pelts) from day 4 females immediately post blood feeding (=0 h PBM) and females at 24 h intervals up to 72 h PBM⁵¹. Each biological sample consisted of two pelts that were homogenized in 100 µl of PBS containing 0.5% Tween-20 and then incubated at 70 °C for 5 min. Pelt samples were centrifuged at 3000 × g for 1 min and 15,900 × g for 3 min followed by transfer of 10 µl from each sample to individual wells of 96-well plates (Corning). After adding 100 µl of TAG reagent (Thermo-Fisher) and gentle mixing, samples were incubated for 10 min at room temperature and absorbance was measured with a Synergy plate reader (BioTek) at 530 nm. A range of TAG standards (MedTest Dx) was included in the wells of each plate and used to calculate experimental values from a regression line. Lipid droplet accumulation in cells was assessed by fixing tissues in 4% paraformaldehyde in PBS for 20 min, two 5-minute rinses in PBS, permeabilization in PBS-Triton X-100 2% for 20 min, and staining with Nile Red 100 µg/mL (Molecular Probes) for 20 min. After washing in PBS for 10 min, samples were counterstained with Hoescht 33342 1 µg/mL for 10 min, slide-mounted in 1:1 glycerol-PBS and imaged using a Zeiss LSM 710 confocal microscope. The number of lipid droplets per cell was quantified for 5 representative cells per tissue sample to generate an average. A minimum of 7 independently collected tissue samples were analyzed per treatment and time point.

Metabolic rates

CO₂ production by resting adults was measured by respirometry using respirometers as designed by Yatsenko et al.⁹². Each biological replicate consisted of placing 5 females or 10 males that were 1, 5, 10 or 20 days old per respirometry chamber that was placed in a climate-controlled room (25 °C) for a minimum of 30 min before starting an assay. CO₂ output was recorded as µl/mosquito/h. A minimum of 3 independently collected biological replicates were conducted for each treatment.

Vector competence

Vector competence assays were conducted used DENV type 2 (DENV-2) originally obtained from the World Reference Center for Emerging Viruses and Arboviruses at the University of Texas Medical Branch (PRS 225 488, Thailand 1974). Viral stocks were propagated in Vero (African green monkey kidney epithelial) cells obtained from the American Type Culture Collection using an MOI of 0.1 or 0.01 and virus-containing supernatant collected at 4–6 dpi and frozen at −80 °C prior to use in infectious feeds. DENV-2 stocks in Vero cell conditioned medium (Dulbecco’s Modification of Eagle’s Medium +10% fetal bovine serum) were diluted in defibrinated rabbit blood at 1:10 to produce high-titer feeds or at 1:200 to produce low-titer feeds. The viral stock aliquot used and samples of infectious blood taken before and after each infectious feed were all titered by tissue culture infectious dose (TCID₅₀) assay in Vero cells. Infectious titer was calculated using the Spearman-Karber method⁹³ and was typically 10⁶ TCID₅₀/mL for high titer feeds and 10⁴ TCID₅₀/mL for low titer feeds, with infectious blood viral titer decreasing by one log unit over the course of the feed (45 min–1 h).

Four-day old adult females were offered infectious bloodmeals using water-jacketed glass (Rutledge) feeders warmed to 37 °C with Parafilm® as the membrane and 1 mM ATP added as a phagostimulant. Females that fed to repletion were isolated after the blood meal and held for either 7 d to determine infection prevalence and viral genome copy number in the midgut or 14 d to assess infection prevalence, viral genome copy number in the midgut and the proportion of females with a disseminated infection to the head and legs, which served as a proxy for transmission potential. Females were provided ad libitum access to water and 10% sucrose for the duration of the incubation period and maintained under standard conditions. Virus presence/absence and titer were measured by qRT-PCR as the large number of samples precluded titration by TCID₅₀. Several pilot experiments revealed no viral dissemination at 7 dpi for any treatment; therefore, whole-body females were used to assess midgut infection at 7 dpi. Viral dissemination at 14 dpi was assessed in the pooled legs and head from each female, with the remaining thorax and abdomen (containing the gut) used to estimate titer. Sufficient numbers of females in each treatment were offered infectious blood meals to obtain a minimum of 30 replete females per treatment at 7 dpi or 14 dpi. Total RNA was extracted and cDNA was synthesized as above, while qRT-PCR reactions were run with DENV-specific NS5 region primers (forward 5’-ACAAGTCGAACAACCTGGTCCAT-3’; reverse 5’- GCCGCACCATTGGTCTTCTC −3’) (80) using a two-step PCR program as described above. The NS5 fragment that was PCR amplified from a DENV-2 stock cDNA template was ligated into a PCR®2.1 TOPO® TA (Invitrogen), transformed into One Shot™ TOP10 chemically competent cells (Invitrogen) and plasmid DNA was extracted using a GeneJET Plasmid Miniprep Kit (Thermo Fisher). Sanger sequencing (Eurofins Genomics) verified identity. Serial dilutions of the plasmid 10⁹−10² copies/µl were then used to generate a standard curve by qRT-PCR which was used to estimate titer in each treatment sample which was determined from the average of four technical replicates.

Statistics and reproducibility

Individual mosquitoes served as the unit of replication for most assays. Exceptions were digestive enzyme expression, ecdysteroids produced by ovaries, and TAG stores where each replicate consisted of dissected tissues from two or more mosquitoes or in the case of CO₂ production five pooled adult female mosquitoes or ten pooled adult male mosquitoes. Proportional data sets were analyzed by contingency table analysis using Fisher’s exact test or Chi-square tests. Quantitative data sets involving two treatments including development time, wing length, and digestive enzyme expression were analyzed using an unpaired two-tailed Student’s t-tests or the nonparametric alternative Welch’s t-test if treatment variances were first determined unequal by F tests of variances. Grouped data comparing two treatments over a time course including ovary ecdysone production, yolk deposition, and CO₂ production were analyzed using pairwise t-tests for which the two-stage step-up correction method for false discovery rate was applied. TAG levels and lipid droplets per cell data sets were both analyzed using a linear repeated measures mixed effects model. For TAG levels, replicate was assigned as a source of random variation, while for counting lipid droplets, individual cells and the tissue sample (from which they came were both assigned as sources of random variation followed by a nested sampling design. Clutch sizes and DENV-2 genome copy numbers were compared among treatments by analysis of variance (ANOVA). Data sets were first subjected to Bartlett’s test for homogeneity of variances and Shapiro-Wilk test for normality of residuals to determine if the data fit the assumptions of ANOVA. If data generated p values of greater than 0.05 for both tests, a one-way ANOVA was used to compare treatment means followed by either Tukey’s Honestly Significant Differences multiple comparisons test or by Dunnett’s post-hoc analysis where either CN or AX adults were designated as the positive or negative control respectively. If data were found to violate the assumptions of ANOVA due to either unequal variances among treatments or non-normal distribution of residuals, non-parametric Kruskal–Wallis tests were used followed by a Dunn’s post hoc multiple comparison test. Adult survival curves (Kaplin–Meier plots) were analyzed using logrank (Mantel–Cox) tests. Reinoculation of bacteria into AX adults and subsequent persistence in the gut over 9 days was assessed using a mixed effects repeated measures model. Analyses were conducted in R v.4.2.2 using the nlme package for linear mixed effects models or GraphPad Prism v.9.0.1. Figures were generated in GraphPad Prism followed by export to Adobe Illustrator (v.23.0.1) for sizing and additional labeling.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The genomes for Serratia sp. (strain UGAL515B_01), Spingobacterium sp. (strain UGAL515B_02), Acinetobacter sp. (strain UGAL515B_03), and Delftia sp. (strain UGAL515B_04) are deposited in the National Center for Biotechnology Information (NCBI) GenBank in the Sequencing Read Archive (SRA) under BioProject ID PRJNA889817. All other data supporting the findings of this study are available within the paper and its Supplementary Information. The uncropped and unedited immunoblots used for Fig. 2e are provided in Supplementary Fig. S7.

References

Erdman, J. W., MacDonald, I. A., Zeise, I. S. H. Present Knowledge in Nutrition (10^th Ed Wiley, 2016).
O’Hara, A. M. & Shanahan, F. The gut flora as a forgotten organ. EMBO Rep. 7, 688–693 (2006).
Article PubMed PubMed Central Google Scholar
Singh, R. K. et al. Influence of diet on the gut microbiome and implications for human health. J. Transl. Med. 15, 73 (2017).
Article PubMed PubMed Central Google Scholar
Engel, P. & Moran, N. A. The gut microbiota of insects - diversity in structure and function. FEMS Microbiol. Rev. 37, 699–735 (2013).
Article CAS PubMed Google Scholar
Ebenman, B. Evolution in organisms that change their niches during the life-cycle. Am. Nat. 139, 990–1021 (1992).
Article Google Scholar
Nicholson, D. B., Ross, A. J. & Mayhew, P. J. Fossil evidence for key innovations in the evolution of insect diversity. Proc. Biol. Sci. 281, 20141823 (2014).
PubMed PubMed Central Google Scholar
Hammer, T. J. & Moran, N. A. Links between metamorphosis and symbiosis in holometabolous insects. Philos. Trans. R. Soc. B. 374, 20190068 (2019).
Article CAS Google Scholar
Clements, A. N. The Biology of Mosquitoes, Vol. 1: Development, Nutrition, and Reproduction (Chapman and Hall, New York, 1992).
Briegel, H. Physiological bases of mosquito ecology. J. Vector Ecol. 28, 1–11 (2003).
PubMed Google Scholar
Attardo, G. M., Hansen, I. A. & Raikhel, A. S. Nutritional regulation of vitellogenesis in mosquitoes: implications for anautogeny. Insect Biochem. Mol. Biol. 35, 661–675 (2005).
Article CAS PubMed Google Scholar
Strand, M. R. Composition and functional roles of the gut microbiota in mosquitoes. Curr. Op. Insect Sci. 28, 59–65 (2018).
Article Google Scholar
Dada, N. et al. Considerations for mosquito microbiome research. Microbiome 1, 36 (2021).
Article Google Scholar
Favia, G. et al. 2007. Bacteria of the genus Asaia stably associate with Anopheles stephensi, an Asian malarial mosquito vector. Proc. Natl Acad. Sci. USA 104, 9047–9051 (2007).
Article CAS PubMed PubMed Central Google Scholar
Bond, J. G. et al. Efficiency of two larval diets for mass-rearing of the mosquito Aedes aegypti. Plos One 12, e0187420 (2017).
Article CAS PubMed PubMed Central Google Scholar
Kauffman, E. et al. Rearing of Culex spp. and Aedes spp. mosquitoes. Bio. Prote. 7, e2542 (2017).
Google Scholar
Coon, K. L., Vogel, K. J., Brown, M. R. & Strand, M. R. Mosquitoes rely on their gut microbiota for development. Mol. Ecol. 23, 2727–2739 (2014).
Article CAS PubMed PubMed Central Google Scholar
Dickson, L. B. et al. Carryover effects of larval exposure to different environmental bacteria drive adult trait variation in a mosquito vector. Sci. Adv. 3, e1700585 (2017).
Article PubMed PubMed Central Google Scholar
Romoli, O., Schönbeck, J. C., Hapfelmeier, S. & Gendrin, M. Production of germ-free mosquitoes via transient colonisation allows stage-specific investigation of host–microbiota interactions. Nat. Comm. 12, 1–16 (2021).
Article Google Scholar
Vogel, K. J. et al. Transcriptome sequencing reveals large-scale changes in axenic Aedes aegypti larvae. PLoS Negl. Trop. Dis. 11, e0005273 (2017).
Article CAS PubMed PubMed Central Google Scholar
Coon, K. L. et al. Bacteria-mediated hypoxia functions as a signal for mosquito development. Proc. Natl Acad. Sci. USA 114, E5362–E5369 (2017).
Article CAS PubMed PubMed Central Google Scholar
Valzania, L. et al. Hypoxia-induced transcription factor signaling is essential for larval growth of the mosquito Aedes aegypti. Proc. Natl Acad. Sci. USA 115, 457–465 (2018).
Article CAS PubMed PubMed Central Google Scholar
Coon, K. L., Brown, M. R. & Strand, M. R. Gut bacteria differentially affect egg production in the anautogenous mosquito Aedes aegypti and facultatively autogenous mosquito Aedes atropalpus (Diptera: Culicidae). Parasit. Vectors 9, 375 (2016).
Article PubMed PubMed Central Google Scholar
Valzania, L. et al. Both living bacteria and eukaryotes in the mosquito gut promote growth of larvae. PLoS Negl. Trop. Dis. 12, e0006638 (2018).
Article PubMed PubMed Central Google Scholar
Martinson, V. G. & Strand, M. R. Diet-microbiota interactions alter mosquito development. Front. Microbiol. 12, 650743 (2021).
Article PubMed PubMed Central Google Scholar
Correa, M. A., Matusovsky, B., Brackney, D. E. & Steven, B. Generation of axenic Aedes aegypti demonstrate live bacteria are not required for mosquito development. Nat. Comm. 9, 4464 (2018).
Article Google Scholar
Wang, Y. et al. Riboflavin instability is a key factor underlying the requirement of a gut microbiota for mosquito development. Proc. Natl Acad. Sci. USA 13, e2101080118 (2021).
Article Google Scholar
Steven, B., Hyde, J., LaReau, J. C. & Brackney, D. E. The axenic and gnotobiotic mosquito: emerging models for microbiome host interactions. Front. Microbiol. 12, 714222 (2021).
Article PubMed PubMed Central Google Scholar
Dadd, R. H. Insect nutrition: current developments and metabolic implications. Annu. Rev. Entomol. 18, 381–420 (1973).
Article CAS PubMed Google Scholar
Serrato-Salas, J. & Gendrin, M. Involvement of microbiota in insect physiology: focus on B vitamins. mBio 10, 1128/mbio.02225–22 (2022).
Google Scholar
Sannino, D. R. et al. The Drosophila melanogaster gut microbiota provisions thiamine to its host. mBio 9, e00155–18 (2018).
Article CAS PubMed PubMed Central Google Scholar
Barredo, E. & DeGennaro, M. Not just from blood: mosquito nutrient acquisition from nectar sources. Trends Parasitol. 36, 473–484 (2020).
Article PubMed Google Scholar
Duron, O. & Gottlieb, Y. 2020. Convergence of nutritional symbioses in obligate blood feeders. Trends Parasitol. 36, 816–825 (2020).
Article CAS PubMed Google Scholar
Hanna, M., Jaqua, E., van Nguyen, D. O. & Clay, J. B vitamins: functions and uses in medicine. Perm. J. 26, 21.204 (2022).
Article Google Scholar
Kramer, L. D. & Ciota, A. T. Dissecting vectorial capacity for mosquito-borne viruses. Curr. Op. Virol. 15, 112–118 (2015).
Article Google Scholar
Alto, B. W., Lounibos, L. P., Higgs, S. & Juliano, S. A. Larval competition differentially affects arbovirus infection in Aedes mosquitoes. Ecology 86, 3279–3288 (2005).
Article PubMed Google Scholar
Joy, T. et al. The impact of larval and adult dietary restriction on lifespan, reproduction and growth in the mosquito Aedes aegypti. Exp. Gerontol. 45, 685–690 (2010).
Article PubMed PubMed Central Google Scholar
Dittmer, J. & Gabrieli, P. Transstadial metabolic priming mediated by larval nutrition in female Aedes albopictus mosquitoes. J. Insect Physiol. 123, 104053 (2020).
Article CAS PubMed Google Scholar
Giraud, E. et al. Mosquito-bacteria interactions during larval development trigger metabolic changes with carry-over effects on adult fitness. Mol. Ecol. 31, 1444–1460 (2021).
Article Google Scholar
de O Gaio, A. et al. Contribution of midgut bacteria to blood digestion and egg production in Aedes aegypti (Diptera: Culicidae) (L.). Parasit. Vectors 4, 105 (2011).
Article Google Scholar
Xi, Z., Ramirez, J. L. & Dimopoulos, G. The Aedes aegypti Toll pathway controls dengue virus infection. PLoS Path. 7, e1000098 (2008).
Article Google Scholar
Coon, K. L., Brown, M. R. & Strand, M. R. Mosquitoes host communities of bacteria that are essential for development but vary greatly between local habitats. Mol. Ecol. 25, 5806–5826 (2016).
Article CAS PubMed PubMed Central Google Scholar
Hyde, J., Gorham, C., Brackney, D. E. & Steven, B. Antibiotic resistant bacteria and commensal fungi are common and conserved in the mosquito microbiome. PLoS One 14, e0218907 (2019).
Article CAS PubMed PubMed Central Google Scholar
Roy, S. et al. Regulation of reproductive processes in female mosquitoes. Adv. Insect Physiol. 51, 115–144 (2016).
Article Google Scholar
Zhou, G., Pennington, J. E. & Wells, M. A. Utilization of pre-existing energy stores of female Aedes aegypti mosquitoes during the first gonadotrophic cycle. Insect Biochem. Mol. Biol. 34, 919–925 (2004).
Article CAS PubMed Google Scholar
Gulia-Nuss, M., Robertson, A. E., Brown, M. R. & Strand, M. R. Insulin-like peptides and the target of rapamycin pathway coordinately regulate blood meal digestion and egg maturation in the mosquito Aedes aegypti. PLoS One 6, 320401 (2011).
Article Google Scholar
Strand, M. R., Brown, M. R. & Vogel, K. J. Mosquito peptide hormones: diversity, production, and function. Adv. Insect Physiol. 51, 145–188 (2016).
Article CAS Google Scholar
Roy, S. G., Hansen, I. A. & Raikhel, A. S. Effect of insulin and 20-hydroxyecdysone in the fat body of the yellow fever mosquito. Aedes Aegypti. Insect Biochem. Mol. Biol. 37, 1317–1326 (2007).
Article CAS PubMed Google Scholar
Isoe, J., Rascon, A. A. Jr., Kunz, S. & Miesfeld, R. L. Molecular genetic analysis of midgut serine proteases in Aedes aegypti mosquito. Insect Biochem. Mol. Biol. 39, 903–912 (2009).
Article CAS PubMed PubMed Central Google Scholar
Valzania, L., Mattee, M. T., Strand, M. R. & Brown, M. R. Blood feeding activates the vitellogenic stage of oogenesis in the mosquito Aedes aegypti through inhibition of glycogen synthase kinase 3 by the insulin and TOR pathways. Dev. Biol. 454, 85–95 (2019).
Article CAS PubMed PubMed Central Google Scholar
Wang, X. L. et al. Hormone and receptor interplay in the regulation of mosquito lipid metabolism. Proc. Natl Acad. Sci. USA 114, E2709–E2718 (2017).
CAS PubMed PubMed Central Google Scholar
Dou, X., Chen, K., Brown, M. R. & Strand, M. R. Multiple endocrine factors regulate nutrient mobilization and storage in Aedes aegypti during a gonadotrophic cycle. Insect Sci. 30, 425–442 (2023).
Article CAS PubMed Google Scholar
Mukherjee, T. et al. Pyridoxal phosphate: biosynthesis and catabolism. Biochim. Biophys. Acta 1814, 1585–1596 (2011).
Article CAS PubMed Google Scholar
Richts, B. & Commichau, F. M. Underground metabolism facilitates the evolution of novel pathways for vitamin B6 synthesis. Appl. Micro Biotech. 105, 2297–2305 (2021).
Article CAS Google Scholar
Dzul-Manzanilla, F. Indoor resting behavior of Aedes aegypti (Diptera: Culicidae) in Acapulco, Mexico. J. Med. Ent. 54, 501–504 (2016).
Google Scholar
Ziegler, R., Blanckenhorn, W. U., Mathis, A. & Verhulst, N. O. Video analysis of the locomotory behaviour of Aedes aegypti and Ae. japonicus mosquitoes under different temperature regimes in a laboratory setting. J. Therm. Biol. 105, 103205 (2022).
Article CAS PubMed Google Scholar
Van Voorhies, W. A., Khazaeli, A. A. & Curtsinger, J. W. Testing the “rate of living” model: further evidence that longevity and metabolic rate are not inversely correlated in Drosophila melanogaster. J. Appl. Physiol. 97, 1915–1922 (2004).
Article PubMed Google Scholar
Powell, J. R. & Tabachnick, W. J. History of domestication and spread of Aedes aegypti-a review. Mem. Inst. Oswaldo Cruz 108, 11–17 (2013).
Article PubMed PubMed Central Google Scholar
Weiss, B. & Aksoy, S. Microbiome influences on insect host vector competence. Trends Parasitol. 27, 514–522 (2011).
Article CAS PubMed PubMed Central Google Scholar
Hegde, S., Rasgon, J. L. & Hughes, G. L. The microbiome modulates arbovirus transmission in mosquitoes. Curr. Op. Virol. 15, 97–102 (2015).
Article CAS Google Scholar
Van Tol, S. & Dimopoulos, G. Influences of the mosquito microbiota on vector competence. Adv. Insect Physiol. 51, 233–291 (2016).
Google Scholar
Yin, C. et al. Roles of symbiotic microorganisms in arboviral infection of arthropod vectors. Trends Parasitol. 36, 607–615 (2020).
Article CAS PubMed Google Scholar
Flyg, C., Kenne, K. & Boman, H. G. Insect pathogenic properties of Serratia marcescens: phage-resistant mutants with a decreased resistance to Cecropia immunity and decreased virulence to Drosophila. J. Gen. Micro 120, 173–181 (1980).
CAS Google Scholar
Wu, P. et al. A gut commensal bacterium promotes mosquito permissiveness to arboviruses. Cell Host Microbe 25, 101–112 (2019).
Article CAS PubMed Google Scholar
Apte-Deshpande, A., Paingankar, M., Gokhale, M. D. & Deobagkar, D. N. Serratia odorifera a midgut inhabitant of Aedes aegypti mosquito enhances its susceptibility to Dengue-2 virus. PLoS One 7, e40401 (2012).
Article CAS PubMed PubMed Central Google Scholar
Harrison, R. E., Brown, M. R. & Strand, M. R. Whole blood and blood components from vertebrates differentially affect egg formation in three species of anautogenous mosquitoes. Parasit. Vectors 14, 1–19 (2022).
Google Scholar
Harrison, R. E. et al. Ad libitum consumption of protein- or peptide-sucrose solutions stimulates egg formation by prolonging the vitellogenic phase of oogenesis in anautogenous mosquitoes. Parasit. Vectors 15, 127 (2022).
Article CAS PubMed PubMed Central Google Scholar
Dada, N. et al. Comparative assessment of the bacterial communities associated with Aedes aegypti larvae and water from domestic storage containers. Parasit. Vectors 7, 391 (2014).
Article PubMed PubMed Central Google Scholar
Garcia-Angulo, V. A. Overlapping riboflavin supply pathways in bacteria. Crit. Rev. Microbiol. 43, 196–209 (2017).
Article CAS PubMed Google Scholar
LeBlanc, J. G. et al. Bacteria as vitamin suppliers to their host: a gut microbiota perspective. Curr. Op. Biotech. 23, 160168 (2013).
Google Scholar
Phasomkusolsil, S. et al. Sugar and multivitamin diet effects on the longevity and mating capacity of laboratory-reared male anopheline mosquitoes. J. Am. Mosq. Con. Assoc. 33, 175–183 (2017).
Article Google Scholar
Nascimento, D. A. S., Trindade, F. T. T. & Silva, A. A. E. Dietary supplementation with vitamins and minerals improves larvae and adult rearing conditions of Anopheles darlingi (Diptera: Culicidae). J. Med. Ent 5, 71–78 (2020).
Google Scholar
Hosokawa, T. et al. Wolbachia as a bacteriocyte-associated nutritional mutualist. Proc. Natl Acad. Sci. USA 107, 769–774 (2010).
Article CAS PubMed Google Scholar
Newton, I. L. & Rice, D. W. The Jekyll and Hyde symbiont: could Wolbachia be a nutritional symbiont? J. Bacteriol. 202, e00589–19 (2020).
Article CAS PubMed PubMed Central Google Scholar
Kandel, Y. et al. Long-Term Mosquito culture with SkitoSnack, an artificial blood meal replacement. PLoS Negl. Trop. Dis. 14, e0008591 (2020).
Article PubMed PubMed Central Google Scholar
Edward, D. A. & Chapman, T. Mechanisms underlying reproductive trade-offs: costs of reproduction. Pg. 137-152. In Mechanisms of Life History Evolution: The Genetics and Physiology. Of Life History Traits and Trade-Offs. Flatt, T., & Heyland, E. eds. (Oxford Univ. Press 2011).
Attisano, A., Moore, A. J. & Moore, P. J. Reproduction-longevity trade-offs reflect diet, not adaptation. J. Evol. Biol. 25, 873–880 (2012).
Article CAS PubMed Google Scholar
Hwang, A. B., Jeong, D.-E. & Lee, S.-J. Mitochondria and organismal longevity. Curr. Genomics 13, 519–532 (2012).
Article CAS PubMed PubMed Central Google Scholar
Sun, N., Youle, R. J. & Finkel, T. The mitochondrial basis of aging. Mol. Cell 61, 654–666 (2016).
Article CAS PubMed PubMed Central Google Scholar
Petrova, E. et al. Uncovering flavivirus host dependency factors through a genome-wide gain-of-function screen. Viruses 11, 68 (2019).
Article CAS PubMed PubMed Central Google Scholar
Vial, T. et al. Mosquito metabolomics reveal that dengue virus replication requires phospholipid reconfiguration via the remodeling cycle. Proc. Natl Acad. Sci. USA 117, 27627–27636 (2020).
Article CAS PubMed PubMed Central Google Scholar
Kolmogorov, M., Yuan, J., Lin, Y. & Pevzner, P. A. Assembly of long, error-prone reads using repeat graphs.”. Nat. Biotechnol. 37, 540–546 (2019).
Article CAS PubMed Google Scholar
Koren, S. et al. Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. Genome Res 27, 722–736 (2017).
Article CAS PubMed PubMed Central Google Scholar
Gurevich A., Saveliev, V., Vyahhi, N. & Tesler, G. QUAST: quality assessment tool for genome assemblies. Bioinformatics 29, 1072–1075 (2013).
Tatusova, T. et al. NCBI prokaryotic genome annotation pipeline. Nuc. Acids Res. 44, 6614–6623 (2016).
Article CAS Google Scholar
Lowe, T. M. & Eddy, S. R. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nuc. Acids Res 25, 955–964 (1997).
Article CAS Google Scholar
Lagesen, K. et al. RNAmmer: consistent and rapid annotation of ribosomal RNA genes.” Nuc. Acids Res 35, 3100–3108 (2007).
Article CAS Google Scholar
Moriya, Y. KAAS: an automatic genome annotation and pathway reconstruction server.” Nuc. Acids Res. 35, W182–W185 (2007).
Article Google Scholar
Kanehisa, M. & Sato, Y. KEGG Mapper for inferring cellular functions from protein sequences. Protein Sci. 29, 28–35 (2020).
Article CAS PubMed Google Scholar
U’Ren, J. M., Lutzoni, F., Miadlikowska, J. & Arnold, A. E. Community analysis reveals close affinities between endophytic and endolichenic fungi in mosses and lichens. Microbiol. Ecol. 60, 340–353 (2010).
Article Google Scholar
Thomas, P. et al. Optimization of single plate-serial dilution spotting (SP-SDS) with sample anchoring as an assured method for bacterial and yeast cfu enumeration and single colony isolation from diverse samples. Biotechnol. Rep. 8, 45–55 (2015).
Article Google Scholar
McKinney, D. A., Strand, M. R. & Brown, M. R. Evaluation of ecdysteroid antisera for a competitive enzyme immunoassay and extraction procedures for the measurement of mosquito ecdysteroids. Gen. Comp. Endocrinol. 253, 60–69 (2017).
Article CAS PubMed PubMed Central Google Scholar
Yatsenko, A. S., Marrone, A. K., Kucherenko, M. M. & Shcherbata, H. R. Measurement of metabolic rate in Drosophila using respirometry. J. Vis. Exp. 2, e51681 (2014).
Google Scholar
Richardson, J., Molina-Cruz, A., Salazar, M. I. & Black, W. Quantitative analysis of dengue-2 virus RNA during the extrinsic incubation period in individual Aedes aegypti. Am. J. Trop. Med. Hyg. 74, 132–141 (2006).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank Jena A. Johnson, Lilith South, Severen Brown, and Jaron Brant Singco for assistance with rearing of the insects used in the study. We also thank Drs. Melinda Brindley and Courtney Murdock for DENV-2 stocks, Vero cells, and suggestions for performing infectious feeds. This work was supported by funds from the National Institutes of Health under award numbers R01AI106892 (M.R.S. and M.R.B.) and R01AI033108 (M.R.S.). R.E.H. was also partially supported by National Institutes of Health predoctoral training grant T32AI060546.

Author information

Ruby E. Harrison
Present address: Department of Cellular Biology and Center for Tropical and Emerging Global Diseases, University of Georgia, Athens, GA, 30602, USA

Authors and Affiliations

Department of Entomology and Center for Tropical and Emerging Global Diseases, University of Georgia, Athens, GA, 30602, USA
Ruby E. Harrison, Xiushuai Yang, Jai Hoon Eum, Xiaoyi Dou, Yin Wang, Mark R. Brown & Michael R. Strand
Department of Biology, University of New Mexico, Albuquerque, NM, 87131, USA
Vincent G. Martinson
Institut Curie, 20 Rue d’Ulm, 75238, Paris, Cedex 05, France
Luca Valzania
Center for Biological Data Science, Virginia Commonwealth University, Richmond, VA, 23284, USA
Bret M. Boyd

Authors

Ruby E. Harrison
View author publications
You can also search for this author in PubMed Google Scholar
Xiushuai Yang
View author publications
You can also search for this author in PubMed Google Scholar
Jai Hoon Eum
View author publications
You can also search for this author in PubMed Google Scholar
Vincent G. Martinson
View author publications
You can also search for this author in PubMed Google Scholar
Xiaoyi Dou
View author publications
You can also search for this author in PubMed Google Scholar
Luca Valzania
View author publications
You can also search for this author in PubMed Google Scholar
Yin Wang
View author publications
You can also search for this author in PubMed Google Scholar
Bret M. Boyd
View author publications
You can also search for this author in PubMed Google Scholar
Mark R. Brown
View author publications
You can also search for this author in PubMed Google Scholar
Michael R. Strand
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

R.E.H., M.R.B. and M.R.S. contributed to study design. R.E.H., Y.W. and B.M.B. developed methods to produce axenic adult mosquitoes. R.E.H., X.Y., J.E., V.G.M., X.D. and L.V. participated in data collection. R.E.H., X.Y. and M.R.S. analyzed the data. R.E.H. and M.R.S. wrote the manuscript and all authors contributed to its revision.

Corresponding author

Correspondence to Michael R. Strand.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Communications Biology thanks Paolo Gabrieli and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Primary Handling Editors: Hannes Schuler and Tobias Goris.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Reporting Summary

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Harrison, R.E., Yang, X., Eum, J.H. et al. The mosquito Aedes aegypti requires a gut microbiota for normal fecundity, longevity and vector competence. Commun Biol 6, 1154 (2023). https://doi.org/10.1038/s42003-023-05545-z

Download citation

Received: 09 January 2023
Accepted: 03 November 2023
Published: 13 November 2023
DOI: https://doi.org/10.1038/s42003-023-05545-z

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.