Loss of Pax3 causes reduction of melanocytes in the developing mouse cochlea

Udagawa, Tomokatsu; Takahashi, Erisa; Tatsumi, Norifumi; Mutai, Hideki; Saijo, Hiroki; Kondo, Yuko; Atkinson, Patrick J.; Matsunaga, Tatsuo; Yoshikawa, Mamoru; Kojima, Hiromi; Okabe, Masataka; Cheng, Alan G.

doi:10.1038/s41598-024-52629-9

Download PDF

Article
Open access
Published: 26 January 2024

Loss of Pax3 causes reduction of melanocytes in the developing mouse cochlea

Tomokatsu Udagawa^1,2,3^na1,
Erisa Takahashi^1,2^na1,
Norifumi Tatsumi²,
Hideki Mutai⁴,
Hiroki Saijo²,
Yuko Kondo¹,
Patrick J. Atkinson⁵,
Tatsuo Matsunaga⁴,
Mamoru Yoshikawa³,
Hiromi Kojima¹,
Masataka Okabe² &
…
Alan G. Cheng⁵

Scientific Reports volume 14, Article number: 2210 (2024) Cite this article

1019 Accesses
Metrics details

Subjects

Abstract

Cochlear melanocytes are intermediate cells in the stria vascularis that generate endocochlear potentials required for auditory function. Human PAX3 mutations cause Waardenburg syndrome and abnormalities of skin and retinal melanocytes, manifested as congenital hearing loss (~ 70%) and hypopigmentation of skin, hair and eyes. However, the underlying mechanism of hearing loss remains unclear. Cochlear melanocytes in the stria vascularis originated from Pax3-traced melanoblasts and Plp1-traced Schwann cell precursors, both of which derive from neural crest cells. Here, using a Pax3-Cre knock-in mouse that allows lineage tracing of Pax3-expressing cells and disruption of Pax3, we found that Pax3 deficiency causes foreshortened cochlea, malformed vestibular apparatus, and neural tube defects. Lineage tracing and in situ hybridization show that Pax3⁺ derivatives contribute to S100⁺, Kir4.1⁺ and Dct⁺ melanocytes (intermediate cells) in the developing stria vascularis, all of which are significantly diminished in Pax3 mutant animals. Taken together, these results suggest that Pax3 is required for the development of neural crest cell-derived cochlear melanocytes, whose absence may contribute to congenital hearing loss of Waardenburg syndrome in humans.

Deletion of the Notch ligand Jagged1 during cochlear maturation leads to inner hair cell defects and hearing loss

Article Open access 18 November 2022

Expression of the human usherin c.2299delG mutation leads to early-onset auditory loss and stereocilia disorganization

Article Open access 12 September 2023

Gata3 is required in late proneurosensory development for proper sensory cell formation and organization

Article Open access 03 August 2023

Introduction

Pax3 regulates induction and differentiation from neural crest cells which are critical in the development of many organs such as eye, hair, skin, neural tube, cranium, face and inner ear^1,2,3,4. During embryonic development, Pax3⁺ neuroepithelial cells including neural crest cells migrate into the otic vesicle, which is primordium of the inner ear, and give rise to melanocytes and glial cells in the developing cochlea^5,6,7,8.

Heterozygous mutations in human PAX3 gene cause type 1 Waardenburg syndrome, which is characterized by telecanthus (widely spaced eyes), heterochromia iridis, patchy pigmentation of hair and skin, and profound sensorineural hearing loss^9,10,11,12. Heterozygous PAX3 mutations also cause type 3 Waardenburg syndrome, which consists of upper limb abnormalities with type 1 Waardenburg syndrome phenotypes^9,13,14. There are also reports of homozygous PAX3 mutations among type 3 Waardenburg syndrome patients^15,16,17. Thus, both heterozygous and homozygous PAX3 mutations are associated with Waardenburg syndrome.

Sensorineural hearing loss is estimated to occur in 71% of Waardenburg syndrome patients¹⁸. It has been postulated that congenital hearing loss in Waardenburg syndrome results from developmental defects of cochlear melanocytes, which are located as intermediate cells in the stria vascularis and necessary for generating the endocochlear potential required for auditory function^{6,19,20,21,22}. Although radiographic imaging of temporal bone of patients with PAX3 mutations shows normal inner ear structure, one PAX3 mutant mouse (Sp^2H/Sp^2H) has been reported to display a complete absence of cochlear components such as the organ of Corti or stria vascularis^23,24, suggesting that the phenotype of Pax3-deficient mice is more severe than that of Pax3-heterozygous patients.

Pax3 deficiency has been postulated to prevent development of Pax3⁺ derivatives including intermediate cells in the developing stria vascularis⁶. Recently, fate-mapping experiments showed that intermediate cells have dual embryonic origins: melanoblasts and Schwann cell precursors, which are derived from neural crest cells and begin to migrate into the stria vascularis around embryonic day 15.5 (E15.5) first in the base and proceeds towards the apex⁸.

In this study, we examined Pax3-Cre knock-in mice²⁵ which allows fate-mapping of Pax3 expressing cells and ablation of the Pax3 gene, and found that complete loss of Pax3 prevents formation of melanocytes (intermediate cells) in the developing cochlea. We analyzed cochleae at E18.5 as Pax3^Cre/Cre homozygous mice were perinatally lethal²⁵. At E18.5, Pax3 knockout cochleae showed 2 major phenotypes: 57% of animals showed smaller cochleae with normal organization of the organ of Corti, whereas 43% showed severely shortened cochlea in addition to gross organ dysgenesis such as exencephaly. Mice of both phenotypes lacked Pax3 protein expression. Furthermore, with fate-mapping and immunostaining for cochlear melanocytes, we uncovered that S100⁺ Pax3^Cre-EGFP⁺ intermediate cells were diminished in the stria vascularis of E18.5 Pax3 knockout cochleae, with remaining intermediate cells continuing to differentiate into Dct⁺ or Kir4.1⁺ melanocytes. Our results suggest that loss of Pax3 leads to reduction of cochlear melanocytes, which may contribute to congenital hearing loss in Waardenburg syndrome.

Results

Auditory function and cytoarchitecture of the Pax3 ^Cre/+ mice

To determine the cell fate of Pax3⁺ derivatives in the cochlea, we used a lineage tracing approach (Pax3-Cre; CAG-CAT-EGFP or Rosa-mTmG) where Pax3-traced cells are labeled with EGFP. This approach has been used previously to fate-map derivatives of Pax3⁺ neuroepithelial cells including neural crest cells in various organs including the cochlea^5,6,25,26. We first confirmed that Pax3^Cre-EGFP⁺ cells were distributed primarily in the stria vascularis and modiolar regions, while occasionally EGFP⁺ cells were detected in the organ of Corti and greater epithelial ridge (GER) region in the E18.5 and P1 Pax3^Cre/+ heterozygous cochleae (Fig. 1A,B). We also confirmed that Pax3^Cre/+ heterozygous embryos had normal cochlear development (Fig. 1A), consistent with prior reports^5,6. Previously, Pax3 heterozygous mice (splotch mice, Sp) show normal hearing even though they have patchy pigmentation of skin hair like human Waardenburg syndrome patients²⁷. We further assessed auditory responses of adult P56 Pax3^Cre/+ heterozygous mice with patchy pigmentation of skin hair and similarly found that they had auditory brain responses comparable to wildtype littermates at all frequencies tested (8, 16, 32 kHz) (Fig. 1C).

Like wildtype cochlea, the P43 Pax3^Cre/+ heterozygous cochlea displayed normal cytoarchitecture of the stria vascularis, organ of Corti and spiral ganglion (Fig. 1D,E). These data indicate that Pax3^Cre/+ heterozygous cochlea is grossly normal and may serve as a control for Pax3^Cre/Cre homozygous cochlea, and also as an excellent model to examine the Pax3⁺ derived cellular populations in the cochlea.

Pax3 knockout embryos show cochlear and vestibular defects in the late embryonic period

During normal development, the otic vesicle rapidly expands and gives rise to the cochlear duct and vestibular apparatus shortly after E10.5^28,29,30. Previously, Pax3^Cre/Cre homozygous embryos have been shown to display several developmental anomalies including loop tail and spina bifida with complete loss of Pax3 protein²⁵. The degrees of anomaly are classified as mild or severe, with the latter showing exencephaly and shortened cochlea^5,6. In this current study, Sox2 was expressed in the neuroepithelial layer of both Pax3^Cre/+ and Pax3^Cre/Cre brain (Supplementary Fig. S1A–C), and Pax3^Cre-EGFP⁺ cells were found in the neural tube and roof plate of E11.5 Pax3^Cre/+ and Pax3^Cre/Cre mice with a mild phenotype (Supplementary Fig. S1A,B). Pax3^Cre-EGFP⁺ cells were located in the lateral neural tube region of E11.5 Pax3^Cre/Cre mice with a severe phenotype including exencephaly (Supplementary Fig. S1C). At E11.5, Pax3^Cre/+ heterozygous mice expressed Pax3 in both Sox2⁺ and Pax3^Cre-EGFP⁺ neural tube cells and roof plate cells (Supplementary Fig. S1A). In contrast, Pax3 expression was not detected in either Sox2⁺ neural tube cells or roof plate cells in E11.5 Pax3^Cre/Cre homozygous mice with a mild or severe phenotype, indicating that Pax3 was effectively ablated regardless of the severity of the phenotype (Supplementary Fig. S1B,C). Pax3^Cre/Cre homozygous embryos also die by P0²⁵. Thus, we characterized the morphology of embryos shortly before birth at E18.5 (27 wildtype, 37 Pax3^Cre/+ heterozygous, 14 Pax3^Cre/Cre homozygous embryos from 7 litters) (Supplementary Fig. S2A–D, Table S1). We found that 8 Pax3^Cre/Cre homozygous embryos displayed mild anomalies (mostly loop tail and spina bifida) (Supplementary Fig. S2C, Table S1), and 6 were severe (visibly smaller, displayed exencephaly, loop tail, and spina bifida) (Supplementary Fig. S2D, Table S1).

To further examine the morphology of the inner ear of Pax3^Cre/Cre homozygous mice, we performed paint-fill of E15.5 cochleae, using wildtype as controls. The inner ear of E15.5 Pax3^Cre/Cre homozygous mice with a mild phenotype was smaller but exhibited similar morphology to wildtype control (Fig. 2A,B). However, Pax3^Cre/Cre homozygous embryo with a severe phenotype showed several malformations of both vestibular and cochlear organs, including underdeveloped semicircular canals, vestigial endolymphatic duct, and foreshortened cochlear duct (Fig. 2C). Similarly, at E18.5, Pax3^Cre/Cre homozygous inner ear with severe phenotype was noticeably smaller than wildtype, the Pax3^Cre/+ heterozygous inner ear and Pax3^Cre/Cre homozygous inner ear with mild phenotype (Fig. 2D–G). These results indicate that development of the inner ear is grossly normal in Pax3^Cre/Cre homozygous embryo with mild phenotype but is dramatically perturbed in Pax3^Cre/Cre homozygous embryo with the more generalized severe phenotype.

Some Pax3 ⁺ derivatives distribute as the intermediate cells in the stria vascularis of Pax3 knockout cochleae

Lineage tracing experiments using Wnt1-Cre, Plp1-Cre and Pax3-Cre mice demonstrate that neural crest cells migrate and develop as glial cells including Schwann cells and satellite cells in the spiral ganglion and cochlear melanocytes (intermediate cells) in the stria vascularis^5,6,8.

We first determined the cellular contribution of the Pax3⁺ lineage in the spiral ganglion region. At E18.5, we found Pax3^Cre-EGFP⁺ cells populating the spiral ganglion regions in the Pax3^Cre/+ heterozygous cochleae (Figs. 1A, 3A), consistent with previous reports^5,6. At E18.5, the Pax3^Cre/Cre homozygous cochleae appeared smaller than the Pax3^Cre/+ heterozygous cochleae, although Pax3^Cre-EGFP⁺ cells remained present in the spiral ganglion regions throughout the cochlea in both mild and severe homozygous animals (Figs. 1A, 3A,B, Supplementary Figs. S3A,B, S4A).

The mature stria vascularis has three cell types: marginal cells, basal cells and intermediate cells, the latter of which are melanocytes. By contrast, the embryonic stria vascularis is composed of only marginal cells and intermediate cells³¹. Previously, Pax3^Cre/Cre homozygous cochlea has been shown to display a complete loss of Pax3⁺ derivatives and Dct⁺ cochlear melanocytes in the stria vascularis at E15.5⁶. As melanocytes originate from both melanoblasts and Schwann cell precursors⁸, we hypothesize that Pax3 deficiency leads to a partial, and not complete, loss of cochlear melanocytes in the late embryonic period. First, we analyzed the distribution of the Pax3⁺ derivatives in the stria vascularis of the E18.5 Pax3^Cre/Cre homozygous cochlea. Kcnq1 is a marker for the marginal cells, and S100 marks both the marginal cells and intermediate cells in the stria vascularis^31,32. In the Pax3^Cre/+ heterozygous cochlea, many S100⁺ Pax3^Cre-EGFP⁺ intermediate cells were detected next to Kcnq1⁺ S100⁺ marginal cells in the stria vascularis in all cochlear turns (Fig. 3A). By contrast, in the E18.5 Pax3^Cre/Cre homozygous cochlea with a mild and severe phenotype, rare or no S100⁺ Pax3^Cre-EGFP⁺ intermediate cells were detected in the stria vascularis of the apical (Fig. 3Bʹʹ, Supplementary Fig. S4Aʹ), middle (Fig. 3Bʹ, Bʹʹʹʹ, Supplementary Fig. S4Aʹʹ) and basal turns (Fig. 3Bʹʹʹ, Supplementary Fig. S4Aʹʹʹ).

Next, we quantified intermediate cells and compared the Pax3^Cre/Cre homozygous (mild phenotype) cochlea with that of the Pax3^Cre/+ heterozygous or wildtype cochlea at E18.5. All of them displayed four cochlear regions (apex, mid-apex, mid-base and base) in cross-section (Figs. 1A, 3A,B, 4A,B, 5A,B, Supplementary Fig. S3A). In each cochlear turn, there were noticeably fewer S100⁺ Pax3^Cre-EGFP⁺ intermediate cells in the stria vascularis of Pax3^Cre/Cre homozygous embryos with mild phenotype than Pax3^Cre/+ heterozygous embryos. The reduction is most dramatic in the apical turn relative to the base (Fig. 3C). Collectively, these data suggest that loss of Pax3 prevents normal development of intermediate cells in the cochlea, with the apical and middle cochlear turns more severely affected than the base.

Characterizing melanocytes in the stria vascularis in the Pax3 knockout embryos

To further characterize whether cochlear melanocytes were perturbed in Pax3^Cre/Cre homozygous mouse, we performed in situ hybridization for markers of melanocytes. Dct, a classical marker of melanocytes, was detected in all three turns in the E18.5 wildtype cochlea (Fig. 4A). In the Pax3^Cre/Cre homozygous cochlea (mild phenotype), we discovered markedly fewer Dct⁺ melanocytes in all turns, with the greatest reduction observed in the apical turn (Fig. 4B,C).

Moreover, we examined expression of the inwardly rectifying potassium channel Kir4.1, whose expression in the stria vascularis is crucial for development of the endocochlear potential after P7^19,20,33. Because Pax3^Cre/Cre homozygous mice are lethal perinatally, we investigated Kir4.1 mRNA expression in the E18.5 cochleae²⁵. Kir4.1 mRNA was detected in the stria vascularis of both control and the Pax3^Cre/Cre homozygous mild phenotype cochlea. Kir4.1 mRNA was also detected in the organ of Corti and spiral ganglion (Fig. 5A,B). In the Pax3^Cre/Cre homozygous embryos with mild phenotype, there were significantly fewer Kir4.1⁺ cells in the stria vascularis in the mid-basal and basal turns than those in Pax3^Cre/+ heterozygous embryos, although the apical and mid-apical turns showed no significant reduction in the number of Kir4.1⁺ cells between those groups (Fig. 5C). Together, these data reveal that Pax3 deficiency perturbs development of cochlear melanocytes.

Discussion

Waardenburg syndrome is characterized by hearing loss and developmental abnormalities of melanocytes^12,34. Genetic studies suggest that Waardenburg syndrome is caused by mutations of PAX3 and other genes such as MITF, SOX10, EDN3, EDNRB and SNAI2^{1,9,13,35,36,37}. Approximately 70% of Waardenburg syndrome patients suffer from sensorineural hearing loss through life and Pax3 is the most common causative mutation for Waardenburg syndrome (type 1 and 3)¹⁸. Here, we used a mouse model of Pax3 deficiency and found that loss of Pax3 causes a reduction of melanocytes in the developing cochlea, possibly stemming from a disruption to the distribution of neuroepithelial cells including neural crest cells. We showed that Pax3^Cre/+ heterozygous mice had normal cochlear development and no hearing loss, while Pax3^Cre/Cre homozygous mice showed fewer cochlear melanocytes (intermediate cells) which are required for normal hearing. Although the Pax3 knockout mice do not fully phenocopy Waardenburg syndrome in human, our and others’ results^6,23 suggest that disruption of cochlear melanocytes as a result of Pax3 deficiency may contribute to their hearing loss. As a case in point, homozygous PAX3 mutations have been reported in type 3 Waardenburg syndrome patients^15,16,17.

Sensory epithelial cells in the inner ear are mostly derived from the otic vesicle^5,30. Neuroepithelial cells including neural crest cells have also been proposed to contribute to the otic vesicle and later the sensory epithelium⁵. Neural crest cells detached from the neural tube ectoderm migrate to the otic vesicle and differentiate into various cell types such as melanocytes, Schwann cells and satellite cells in the developing cochlea³⁸. Humans carrying PAX3 mutations have abnormal development of melanocytes, manifested as heterochromia¹. They also present with profound hearing loss despite grossly radiographically normal inner ear structures²⁴. Previously, Pax3 mutants including Sp, Sp^2H and Pax3-Cre mice have been analyzed for cochlear development and those heterozygous mice are identified by the presence of patchy pigmentation of skin hair, which is one of the major phenotypes of type 1 and 3 Waardenburg syndrome patients^{5,6,9,10,12,23,27}. Although type 1 and 3 Waardenburg syndrome patients with Pax3 heterozygous mutation typically exhibit severe-to-profound hearing loss, Sp heterozygous mice display normal hearing as do Pax3-Cre heterozygous mice in this study (Fig. 1C)^18,27. Thus, the phenotype of heterozygous Pax3-Cre mice is less severe than in Pax3-heterozygous humans. In addition, we show that loss of Pax3 causes shortened cochlea and malformed vestibular apparatus using Pax3^Cre/Cre homozygous mice which are inserted with the Cre recombinase cDNA followed by a stop codon and a polyA signal in Pax3 exon 1, while having cochlear structures such as the stria vascularis²⁵. Our study stands in contrast to the results of previous work using Sp^2H/Sp^2H homozygous embryo, in which 32 nucleotides deletion of Pax3 exon 5 by irradiation causes a truncated protein of its C-terminal half and prevents the formation of stria vascularis in the late embryonic cochlea^23,39,40. This difference may be because the Sp^2H/Sp^2H homozygous mice still expressed some Pax3 protein whereas Pax3^Cre/Cre homozygous mice displayed no detectable Pax3 protein. Furthermore, Pax3^Cre/Cre homozygous embryos in our study represent two distinct severities of phenotype. These diversities in phenotype may also be reflected in the variable degrees of hearing loss in type 1 and 3 Waardenburg syndrome caused by various PAX3 gene mutations^41,42,43.

Neural crest cells with pluri-potent potential differentiate into the various cell types including melanocytes and play important roles in the development of various organs^2,25. Melanocytes originating from neural crest cells migrate into specific locations within the skin and hair follicles, and to other sites including stria vascularis in the cochlea⁴⁴. Cochlear melanocytes are known as intermediate cells which generate high concentration of potassium ions in the cochlear endolymph^20,45. Endocochlear potential in-turn drives depolarization of hair cells and is required for hearing function⁴⁶. One may hypothesize that the hearing loss associated with Waardenburg syndrome is a result of a disruption of the endocochlear potential arising from the developmental disorder of cochlear melanocytes, among other factors^6,27. In this study, we demonstrated that Pax3 is necessary for the development of a full complement of cochlear melanocytes, with Pax3 deficiency leading to a reduction of cochlear melanocytes still expressing S100, Dct and Kir4.1 in the stria vascularis. Thus, our study pointed out that a small number of cochlear melanocytes can still develop despite Pax3 deficiency, suggesting the presence of alternative regulators of differentiation of Pax3⁺ derivatives. During development, Schwann cell precursors migrate into the stria vascularis starting at around E15.5 to give rise to cochlear melanocytes⁸. Interestingly, a previous report using Pax3-Cre knock-in mice²⁵ found no Pax3⁺ derivatives or Dct⁺ melanocytes in the stria vascularis at E15.5, although the distribution of Pax3⁺ derivatives remained normal in the glial cell region⁶. With the same mouse line as the above report, we observed Pax3⁺ derivatives in both the glial cell region and stria vascularis, and Dct⁺ melanocytes in the stria vascularis in the late embryonic period (E18.5). These divergent findings may be indicative of a delayed migration of Pax3⁺ derived cells from the glial region to other domains within the cochlea.

Finally, our data exhibited a degree of variance in the number of cochlear melanocytes in the stria vascularis caused by loss of Pax3. Whether this variance is indicative of the variable degree of hearing loss in Waardenburg syndrome remains unclear, as neither Pax3 heterozygous or homozygous mice phenocopy Waardenburg syndrome patients^41,42,43. As such, a mouse model (e.g. Pax3 hypomorph) that more accurately models human Waardenburg syndrome is needed. The developing melanocytes in the human cochlea are considered as the prime target cells of gene therapy for Waardenburg syndrome³⁷. Our results indicate that neuroepithelial cells with loss of Pax3 can differentiate as melanocytes if they properly migrate into the stria vascularis. In conclusion, our data would guide future studies to develop hearing therapies for Waardenburg syndrome.

Methods

Mice

The following mouse strains were used: Pax3^Cre/+ (Stock #005549, Jackson Laboratory)²⁵, CAG^CAT-EGFP/+ (gift from J. Miyazaki, Osaka Univ.)⁴⁷, R26R^mTmG mice (stock #007576, Jackson Laboratory)⁴⁸. Mouse embryos of both genders were used. Institutional Animal Care and Use Committee of The Jikei University School of Medicine (protocol number: 21-025, 2020-060) and Stanford University School of Medicine (protocol number: 18606) approved all procedures. All experimental procedures were performed in accordance with relevant guidelines and regulations. This study is reported in accordance with ARRIVE guidelines, https://arriveguidelines.org.

Genotyping

Mouse genomic DNA was isolated from collected tail tips by adding 180 μl of 50 mM NaOH and incubating at 98 °C for 10 min, followed by the addition of 20 μl of 1 M Tris–HCl. PCR was performed to genotype transgenic mice with three specific primers which sequences were described in a previous paper²⁵.

Auditory physiology measurements

Auditory brainstem responses were recorded as described in a previous paper⁴⁹. Briefly, P56 mice were anesthetized with a ketamine/xylazine mixture (100 mg/kg ketamine and 10 mg/kg xylazine, IP) and placed on a heating pad at 37 °C. Auditory brain responses were measured with a needle electrode which was located inferior to the tympanic bulla, referenced to an electrode on the vertex of the head, and a ground electrode was inserted at the hind limb. Tone burst stimuli were delivered with frequencies ranging from 8 to 32 kHz (8.0, 16.0, 32.0 kHz) up to 90 dB sound pressure level (SPL) in 5 dB steps. At each frequency and SPL, 512 trials were tested and averaged. Two-way analysis of variance (ANOVA) with Sidak’s multiple comparisons test was used for comparison of ABR thresholds.

H&E staining

P43 mice were deeply anesthetized with pentobarbital sodium (50 mg/kg, IP), and perfused transcardially with 4% paraformaldehyde (PFA) in 0.1 M phosphate-buffered saline (PBS), pH 7.4. Temporal bones were harvested and additionally fixed in 4% PFA overnight at 4 °C. After PBS wash, inner ears were dissected from temporal bones and decalcified in 0.125 M EDTA for 2 weeks. Inner ears were dehydrated, embedded in paraffin wax, and sectioned to 4 µm using microtome REM-710 (YAMATO). Then, sections were stained with Hematoxylin and Eosin.

Immunohistochemistry

Methods were modified as previously reported^50,51. Briefly, E11.5 and E18.5 heads were harvested and fixed in 4% PFA overnight at 4 °C and then embedded in Tissue Tek OCT compound (Sakura, Tokyo, Japan) and frozen. Sections (10 μm thickness) were prepared using a cryostat CM3050S (Leica). P1 whole mount cochleae were dissected and fixed in 4% PFA for 1 h at room temperature (RT). Tissues were permeabilized with 0.5% TritonX-100 in PBS for 1 h at RT, and then blocked with 10% goat or donkey serum, 0.1% TritonX-100 and 1% bovine serum albumin in PBS for 30 min at RT. The following primary antibodies were used: chicken anti-GFP (1:1,000, GFP-1020, Aves labs), rabbit anti-Myosin7a (1:1,000; Proteus Bioscience), goat anti-Kcnq1 (1:100, sc-10646, Santa Cruz Biotechnology), mouse anti-Pax3 (1:1,000, Developmental Studies Hybridoma Bank), rabbit anti-S100 (ready-to-use liquid, GA504, Dako) and goat anti-Sox2 (1:200, sc-17320, Santa Cruz Biotechnology). Primary antibodies were applied overnight in a humidified chamber at 4 °C. The following day, tissues were washed with PBS three times at 5 min intervals and then incubated with Alexa Fluor secondary antibodies (488, 546 or 647, 1:500, Invitrogen or Jackson ImmunoResearch) which were diluted in PBS containing 0.1% TritonX-100 and 1% bovine serum albumin for 2 h at RT. DAPI (1:10,000, Invitrogen) was also used for nuclear staining.

In situ hybridization

Harvested E18.5 heads were fixed in 4% PFA overnight at 4 °C, embedded for cryosections and sliced into 10 μm sections as described above. RNA probe synthesis and section in situ hybridization were performed as previously described with some modifications⁵¹. Briefly, a digoxigenin-labeled antisense RNA probe was synthesized using the DIG RNA Labeling Kit (Promega) with plasmids containing the following mouse genes: Dct (forward primer, TCCCGAGGCAACCAACATCT; reverse primer, CAGTAGGGCAACGCAAAGGA) and Kir4.1 (forward primer, GGACAAACCCTTATCTGATTCCA; reverse primer, TGCGCAATAAGAAGCACGAT). Slides were permeabilized with protein K (Roche, 5 μg/ml) in PBS with 0.1% Tween 20 for 10 min at 37 °C, incubated with 1 μg/ml digoxigenin-labeled riboprobe in hybridization buffer for 16 h at 70 °C, blocked with 10% heat-inactivated sheep serum in Tris-buffered saline containing 0.1% Tween 20 for 30 min at RT, incubated with anti-digoxigenin antibody-conjugated alkaline phosphatase (1:2,000, Roche) in Tris-buffered saline containing 0.1% Tween 20 and 1% heat-inactivated sheep serum for 2 h at RT. Antibody detection was performed by incubating slides with 0.2% nitroblue tetrazolium and 0.2% 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt in detection solution (0.1 M NaCl, 0.1 M Tris–HCl [pH 9.5], 50 mM MgCl2, 1% Tween 20) for 40–48 h at RT.

Imaging and cell quantification

Section cochleae were captured using Axio Imager D1 (Zeiss) for bright field images or LSM500/880 (Zeiss) for fluorescent images. Image analyses were performed using Zen Software (Zeiss) and Photoshop CS6 (Adobe Systems). Cells were quantified from each turn (apical, mid-apical, mid-basal and basal turn) in the developing stria vascularis of section images. Melanocytes in the stria vascularis were identified as Dct⁺ or Kir4.1⁺ cells immediately next to marginal cells.

Statistical analyses

Statistical analyses were performed using Microsoft Excel (Microsoft) and GraphPad Prism 7.03 (GraphPad). Two-way ANOVA was used for comparison with two independent variables. P < 0.05 was considered statistically significant.

Paint injection

Paint-filling of the inner ear was performed as previously described³⁰. E15.5 mouse embryos were harvested and fixed overnight in Bodian’s fixative. Samples were then dehydrated with ethanol and cleared with methyl salicylate. Glass micropipette was inserted in the utricle, and then inner ears were visualized by injecting white latex paint in 0.1% methyl salicylate into the membranous labyrinth. Samples were captured with stereomicroscope SZ61 (Olympus).

Morphological picture

Harvested E18.5 mouse embryos were captured and then temporal bones were harvested and fixed in 4% PFA overnight at 4 °C. Following several PBS washes, inner ears were isolated from temporal bones including cochlear capsule in PBS. Samples were captured with stereomicroscope Lumar.V12 (Zeiss).

Data availability

All data analyzed in this study are included in this article and its supplementary information files. Mouse nucleotide sequences of Dct (Accession Number: NM_010024.3) and Kir4.1 (Accession Number: NM_001039484.1) genes were referenced from the National Institutes of Health (NIH) genetic sequence database GenBank, https://www.ncbi.nlm.nih.gov/genbank/.

References

Lee, C. Y. et al. Identification of nine novel variants across PAX3, SOX10, EDNRB, and MITF genes in Waardenburg syndrome with next-generation sequencing. Mol. Genet. Genom. Med. 10, e2082. https://doi.org/10.1002/mgg3.2082 (2022).
Article CAS Google Scholar
Martik, M. L. & Bronner, M. E. Riding the crest to get a head: Neural crest evolution in vertebrates. Nat. Rev. Neurosci. 22, 616–626. https://doi.org/10.1038/s41583-021-00503-2 (2021).
Article CAS PubMed PubMed Central Google Scholar
Milet, C., Maczkowiak, F., Roche, D. D. & Monsoro-Burq, A. H. Pax3 and Zic1 drive induction and differentiation of multipotent, migratory, and functional neural crest in Xenopus embryos. Proc. Natl. Acad. Sci. U.S.A. 110, 5528–5533. https://doi.org/10.1073/pnas.1219124110 (2013).
Article ADS CAS PubMed PubMed Central Google Scholar
Steingrimsson, E., Copeland, N. G. & Jenkins, N. A. Melanocyte stem cell maintenance and hair graying. Cell 121, 9–12. https://doi.org/10.1016/j.cell.2005.03.021 (2005).
Article CAS PubMed Google Scholar
Freyer, L., Aggarwal, V. & Morrow, B. E. Dual embryonic origin of the mammalian otic vesicle forming the inner ear. Development 138, 5403–5414. https://doi.org/10.1242/dev.069849 (2011).
Article CAS PubMed PubMed Central Google Scholar
Kim, H. et al. Pax3 function is required specifically for inner ear structures with melanogenic fates. Biochem. Biophys. Res. Commun. 445, 608–614. https://doi.org/10.1016/j.bbrc.2014.02.047 (2014).
Article CAS PubMed Google Scholar
Renauld, J. M., Davis, W., Cai, T., Cabrera, C. & Basch, M. L. Transcriptomic analysis and ednrb expression in cochlear intermediate cells reveal developmental differences between inner ear and skin melanocytes. Pigment Cell Melanoma Res. 34, 585–597. https://doi.org/10.1111/pcmr.12961 (2021).
Article CAS PubMed PubMed Central Google Scholar
Renauld, J. M., Khan, V. & Basch, M. L. Intermediate cells of dual embryonic origin follow a basal to apical gradient of ingression into the lateral wall of the cochlea. Front. Cell Dev. Biol. 10, 867153. https://doi.org/10.3389/fcell.2022.867153 (2022).
Article PubMed PubMed Central Google Scholar
Milunsky, J. M. GeneReviews((R)) (eds Adam, M. P. et al.) (1993).
Morell, R. et al. A frameshift mutation in the HuP2 paired domain of the probable human homolog of murine Pax-3 is responsible for Waardenburg syndrome type 1 in an Indonesian family. Hum. Mol. Genet. 1, 243–247. https://doi.org/10.1093/hmg/1.4.243 (1992).
Article CAS PubMed Google Scholar
Read, A. P. & Newton, V. E. Waardenburg syndrome. J. Med. Genet. 34, 656–665. https://doi.org/10.1136/jmg.34.8.656 (1997).
Article CAS PubMed PubMed Central Google Scholar
Waardenburg, P. J. A new syndrome combining developmental anomalies of the eyelids, eyebrows and nose root with pigmentary defects of the iris and head hair and with congenital deafness. Am. J. Hum. Genet. 3, 195–253 (1951).
CAS PubMed PubMed Central Google Scholar
Hoth, C. F. et al. Mutations in the paired domain of the human PAX3 gene cause Klein–Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I). Am. J. Hum. Genet. 52, 455–462 (1993).
CAS PubMed PubMed Central Google Scholar
Tekin, M., Bodurtha, J. N., Nance, W. E. & Pandya, A. Waardenburg syndrome type 3 (Klein–Waardenburg syndrome) segregating with a heterozygous deletion in the paired box domain of PAX3: A simple variant or a true syndrome? Clin. Genet. 60, 301–304. https://doi.org/10.1034/j.1399-0004.2001.600408.x (2001).
Article CAS PubMed Google Scholar
Ayme, S. & Philip, N. Possible homozygous Waardenburg syndrome in a fetus with exencephaly. Am. J. Med. Genet. 59, 263–265. https://doi.org/10.1002/ajmg.1320590227 (1995).
Article CAS PubMed Google Scholar
Wollnik, B. et al. Homozygous and heterozygous inheritance of PAX3 mutations causes different types of Waardenburg syndrome. Am. J. Med. Genet. A 122A, 42–45. https://doi.org/10.1002/ajmg.a.20260 (2003).
Article PubMed Google Scholar
Zlotogora, J., Lerer, I., Bar-David, S., Ergaz, Z. & Abeliovich, D. Homozygosity for Waardenburg syndrome. Am. J. Hum. Genet. 56, 1173–1178 (1995).
CAS PubMed PubMed Central Google Scholar
Song, J. et al. Hearing loss in Waardenburg syndrome: A systematic review. Clin. Genet. 89, 416–425. https://doi.org/10.1111/cge.12631 (2016).
Article CAS PubMed Google Scholar
Hibino, H. et al. An ATP-dependent inwardly rectifying potassium channel, KAB-2 (Kir4.1), in cochlear stria vascularis of inner ear: Its specific subcellular localization and correlation with the formation of endocochlear potential. J. Neurosci. 17, 4711–4721 (1997).
Article CAS PubMed PubMed Central Google Scholar
Nin, F. et al. The endocochlear potential depends on two K+ diffusion potentials and an electrical barrier in the stria vascularis of the inner ear. Proc. Natl. Acad. Sci. U.S.A. 105, 1751–1756. https://doi.org/10.1073/pnas.0711463105 (2008).
Article ADS PubMed PubMed Central Google Scholar
Takeuchi, S., Ando, M. & Kakigi, A. Mechanism generating endocochlear potential: Role played by intermediate cells in stria vascularis. Biophys. J. 79, 2572–2582. https://doi.org/10.1016/S0006-3495(00)76497-6 (2000).
Article CAS PubMed PubMed Central Google Scholar
Wangemann, P. et al. Loss of KCNJ10 protein expression abolishes endocochlear potential and causes deafness in Pendred syndrome mouse model. BMC Med. 2, 30. https://doi.org/10.1186/1741-7015-2-30 (2004).
Article PubMed PubMed Central Google Scholar
Buckiova, D. & Syka, J. Development of the inner ear in Splotch mutant mice. Neuroreport 15, 2001–2005. https://doi.org/10.1097/00001756-200409150-00002 (2004).
Article PubMed Google Scholar
Yu, Y. et al. Two novel mutations of PAX3 and SOX10 were characterized as genetic causes of Waardenburg syndrome. Mol. Genet. Genom. Med. 8, e1217. https://doi.org/10.1002/mgg3.1217 (2020).
Article CAS Google Scholar
Engleka, K. A. et al. Insertion of Cre into the Pax3 locus creates a new allele of Splotch and identifies unexpected Pax3 derivatives. Dev. Biol. 280, 396–406. https://doi.org/10.1016/j.ydbio.2005.02.002 (2005).
Article CAS PubMed Google Scholar
Jan, T. A. et al. Tympanic border cells are Wnt-responsive and can act as progenitors for postnatal mouse cochlear cells. Development 140, 1196–1206. https://doi.org/10.1242/dev.087528 (2013).
Article CAS PubMed PubMed Central Google Scholar
Steel, K. P. & Smith, R. J. Normal hearing in Splotch (Sp/+), the mouse homologue of Waardenburg syndrome type 1. Nat. Genet. 2, 75–79. https://doi.org/10.1038/ng0992-75 (1992).
Article CAS PubMed Google Scholar
Basch, M. L., Brown, R. M. 2nd., Jen, H. I. & Groves, A. K. Where hearing starts: The development of the mammalian cochlea. J. Anat. 228, 233–254. https://doi.org/10.1111/joa.12314 (2016).
Article PubMed Google Scholar
Kelley, M. W. Regulation of cell fate in the sensory epithelia of the inner ear. Nat. Rev. Neurosci. 7, 837–849. https://doi.org/10.1038/nrn1987 (2006).
Article CAS PubMed Google Scholar
Morsli, H., Choo, D., Ryan, A., Johnson, R. & Wu, D. K. Development of the mouse inner ear and origin of its sensory organs. J. Neurosci. 18, 3327–3335 (1998).
Article CAS PubMed PubMed Central Google Scholar
Trowe, M. O., Maier, H., Schweizer, M. & Kispert, A. Deafness in mice lacking the T-box transcription factor Tbx18 in otic fibrocytes. Development 135, 1725–1734. https://doi.org/10.1242/dev.014043 (2008).
Article CAS PubMed Google Scholar
Buckiova, D. & Syka, J. Calbindin and S100 protein expression in the developing inner ear in mice. J. Comp. Neurol. 513, 469–482. https://doi.org/10.1002/cne.21967 (2009).
Article PubMed Google Scholar
Marcus, D. C., Wu, T., Wangemann, P. & Kofuji, P. KCNJ10 (Kir4.1) potassium channel knockout abolishes endocochlear potential. Am. J. Physiol. Cell Physiol. 282, C403-407. https://doi.org/10.1152/ajpcell.00312.2001 (2002).
Article CAS PubMed Google Scholar
Morton, C. C. & Nance, W. E. Newborn hearing screening—A silent revolution. N. Engl. J. Med. 354, 2151–2164. https://doi.org/10.1056/NEJMra050700 (2006).
Article CAS PubMed Google Scholar
Bondurand, N. et al. Interaction among SOX10, PAX3 and MITF, three genes altered in Waardenburg syndrome. Hum. Mol. Genet. 9, 1907–1917. https://doi.org/10.1093/hmg/9.13.1907 (2000).
Article CAS PubMed Google Scholar
DeStefano, A. L. et al. Correlation between Waardenburg syndrome phenotype and genotype in a population of individuals with identified PAX3 mutations. Hum. Genet. 102, 499–506. https://doi.org/10.1007/s004390050732 (1998).
Article CAS PubMed Google Scholar
Huang, S. et al. Genetic insights, disease mechanisms, and biological therapeutics for Waardenburg syndrome. Gene Ther. https://doi.org/10.1038/s41434-021-00240-2 (2021).
Article PubMed Google Scholar
Liu, T. et al. Age-dependent alterations of Kir4.1 expression in neural crest-derived cells of the mouse and human cochlea. Neurobiol. Aging 80, 210–222. https://doi.org/10.1016/j.neurobiolaging.2019.04.009 (2019).
Article CAS PubMed PubMed Central Google Scholar
Epstein, D. J., Vogan, K. J., Trasler, D. G. & Gros, P. A mutation within intron 3 of the Pax-3 gene produces aberrantly spliced mRNA transcripts in the splotch (Sp) mouse mutant. Proc. Natl. Acad. Sci. U.S.A. 90, 532–536. https://doi.org/10.1073/pnas.90.2.532 (1993).
Article ADS CAS PubMed PubMed Central Google Scholar
Marean, A., Graf, A., Zhang, Y. & Niswander, L. Folic acid supplementation can adversely affect murine neural tube closure and embryonic survival. Hum. Mol. Genet. 20, 3678–3683. https://doi.org/10.1093/hmg/ddr289 (2011).
Article CAS PubMed PubMed Central Google Scholar
Liu, X. Z., Newton, V. E. & Read, A. P. Waardenburg syndrome type II: Phenotypic findings and diagnostic criteria. Am. J. Med. Genet. 55, 95–100. https://doi.org/10.1002/ajmg.1320550123 (1995).
Article CAS PubMed Google Scholar
Newton, V. Hearing loss and Waardenburg’s syndrome: Implications for genetic counselling. J. Laryngol. Otol. 104, 97–103. https://doi.org/10.1017/s002221510011196x (1990).
Article CAS PubMed Google Scholar
Oysu, C., Baserer, N. & Tinaz, M. Audiometric manifestations of Waardenburg’s syndrome. Ear Nose Throat J. 79, 704–709 (2000).
Article CAS PubMed Google Scholar
Mort, R. L., Jackson, I. J. & Patton, E. E. The melanocyte lineage in development and disease. Development 142, 620–632. https://doi.org/10.1242/dev.106567 (2015).
Article CAS PubMed PubMed Central Google Scholar
Hibino, H. & Kurachi, Y. Molecular and physiological bases of the K+ circulation in the mammalian inner ear. Physiology (Bethesda) 21, 336–345. https://doi.org/10.1152/physiol.00023.2006 (2006).
Article CAS PubMed Google Scholar
Zdebik, A. A., Wangemann, P. & Jentsch, T. J. Potassium ion movement in the inner ear: Insights from genetic disease and mouse models. Physiology (Bethesda) 24, 307–316. https://doi.org/10.1152/physiol.00018.2009 (2009).
Article CAS PubMed Google Scholar
Kawamoto, S. et al. A novel reporter mouse strain that expresses enhanced green fluorescent protein upon Cre-mediated recombination. FEBS Lett. 470, 263–268. https://doi.org/10.1016/s0014-5793(00)01338-7 (2000).
Article CAS PubMed Google Scholar
Muzumdar, M. D., Tasic, B., Miyamichi, K., Li, L. & Luo, L. A global double-fluorescent Cre reporter mouse. Genesis 45, 593–605. https://doi.org/10.1002/dvg.20335 (2007).
Article CAS PubMed Google Scholar
Mutai, H., Miya, F., Fujii, M., Tsunoda, T. & Matsunaga, T. Attenuation of progressive hearing loss in DBA/2J mice by reagents that affect epigenetic modifications is associated with up-regulation of the zinc importer Zip4. PLoS ONE 10, e0124301. https://doi.org/10.1371/journal.pone.0124301 (2015).
Article CAS PubMed PubMed Central Google Scholar
Udagawa, T. et al. Lineage-tracing and translatomic analysis of damage-inducible mitotic cochlear progenitors identifies candidate genes regulating regeneration. PLoS Biol. 19, e3001445. https://doi.org/10.1371/journal.pbio.3001445 (2021).
Article CAS PubMed PubMed Central Google Scholar
Udagawa, T. et al. Inwardly rectifying potassium channel Kir4.1 is localized at the calyx endings of vestibular afferents. Neuroscience 215, 209–216. https://doi.org/10.1016/j.neuroscience.2012.04.037 (2012).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

The authors thank our laboratory for insightful comments on the manuscript, J. Miyazaki (Osaka Univ.) for mouse sharing, and K. Yokota and E. Hayashi (Jikei Univ.) for excellent technical support. This work was supported by a Grant-in-Aid for Young Scientists from the Ministry of Education, Culture, Sports, Science and Technology, Japan, KAKENHI (25861596) (T.U.), (20K22986) (E.T.), (20890228) (N.T) and NIDCD/NIH RO1DC021110 (A.G.C.).

Author information

These authors contributed equally: Tomokatsu Udagawa and Erisa Takahashi.

Authors and Affiliations

Department of Otorhinolaryngology, The Jikei University School of Medicine, 3-25-8 Nishi-Shimbashi, Minato-ku, Tokyo, 105-8461, Japan
Tomokatsu Udagawa, Erisa Takahashi, Yuko Kondo & Hiromi Kojima
Department of Anatomy, The Jikei University School of Medicine, Tokyo, Japan
Tomokatsu Udagawa, Erisa Takahashi, Norifumi Tatsumi, Hiroki Saijo & Masataka Okabe
Department of Otorhinolaryngology, Toho University School of Medicine, Tokyo, Japan
Tomokatsu Udagawa & Mamoru Yoshikawa
Division Hearing and Balance Research, National Institute of Sensory Organs, NHO Tokyo Medical Center, Tokyo, Japan
Hideki Mutai & Tatsuo Matsunaga
Department of Otolaryngology-Head and Neck Surgery, Stanford University School of Medicine, Stanford, CA, 94305, USA
Patrick J. Atkinson & Alan G. Cheng

Authors

Tomokatsu Udagawa
View author publications
You can also search for this author in PubMed Google Scholar
Erisa Takahashi
View author publications
You can also search for this author in PubMed Google Scholar
Norifumi Tatsumi
View author publications
You can also search for this author in PubMed Google Scholar
Hideki Mutai
View author publications
You can also search for this author in PubMed Google Scholar
Hiroki Saijo
View author publications
You can also search for this author in PubMed Google Scholar
Yuko Kondo
View author publications
You can also search for this author in PubMed Google Scholar
Patrick J. Atkinson
View author publications
You can also search for this author in PubMed Google Scholar
Tatsuo Matsunaga
View author publications
You can also search for this author in PubMed Google Scholar
Mamoru Yoshikawa
View author publications
You can also search for this author in PubMed Google Scholar
Hiromi Kojima
View author publications
You can also search for this author in PubMed Google Scholar
Masataka Okabe
View author publications
You can also search for this author in PubMed Google Scholar
Alan G. Cheng
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

T.U., E.T., N.T., H.M. designed experiments, T.U., E.T., N.T., H.M., H.S. performed experiments, T.U., E.T., N.T., H.M., Y.K. analyzed data, T.U., E.T., N.T., H.M., T.M., P.J.A., M.Y., H.K., M.O., A.G.C. wrote the manuscript.

Corresponding author

Correspondence to Tomokatsu Udagawa.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary Information.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Udagawa, T., Takahashi, E., Tatsumi, N. et al. Loss of Pax3 causes reduction of melanocytes in the developing mouse cochlea. Sci Rep 14, 2210 (2024). https://doi.org/10.1038/s41598-024-52629-9

Download citation

Received: 28 May 2023
Accepted: 22 January 2024
Published: 26 January 2024
DOI: https://doi.org/10.1038/s41598-024-52629-9

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.