Validated assays for the quantification of C9orf72 human pathology

Salomonsson, S. E.; Maltos, A. M.; Gill, K.; Aladesuyi Arogundade, O.; Brown, K. A.; Sachdev, A.; Sckaff, M.; Lam, K. J. K.; Fisher, I. J.; Chouhan, R. S.; Van Laar, V. S.; Marley, C. B.; McLaughlin, I.; Bankiewicz, K. S.; Tsai, Y.-C.; Conklin, B. R.; Clelland, C. D.

doi:10.1038/s41598-023-50667-3

Download PDF

Article
Open access
Published: 08 January 2024

Validated assays for the quantification of C9orf72 human pathology

S. E. Salomonsson^1,2^na1,
A. M. Maltos³^na1,
K. Gill^1,2,3,
O. Aladesuyi Arogundade^1,2,
K. A. Brown^1,2,
A. Sachdev³,
M. Sckaff^1,2,3,
K. J. K. Lam^1,2,
I. J. Fisher^1,2,
R. S. Chouhan^1,2,
V. S. Van Laar^4,5,
C. B. Marley³,
I. McLaughlin⁶,
K. S. Bankiewicz^4,5,
Y.-C. Tsai⁶,
B. R. Conklin^3,7 &
…
C. D. Clelland^1,2

Scientific Reports volume 14, Article number: 828 (2024) Cite this article

2252 Accesses
1 Citations
23 Altmetric
Metrics details

Subjects

Abstract

A repeat expansion mutation in the C9orf72 gene is the leading known genetic cause of FTD and ALS. The C9orf72-ALS/FTD field has been plagued by a lack of reliable tools to monitor this genomic locus and its RNA and protein products. We have validated assays that quantify C9orf72 pathobiology at the DNA, RNA and protein levels using knock-out human iPSC lines as controls. Here we show that single-molecule sequencing can accurately measure the repeat expansion and faithfully report on changes to the C9orf72 locus in what has been a traditionally hard to sequence genomic region. This is of particular value to sizing and phasing the repeat expansion and determining changes to the gene locus after gene editing. We developed ddPCR assays to quantify two major C9orf72 transcript variants, which we validated by selective excision of their distinct transcriptional start sites. Using validated knock-out human iPSC lines, we validated 4 commercially available antibodies (of 9 tested) that were specific for C9orf72 protein quantification by Western blot, but none were specific for immunocytochemistry. We tested 15 combinations of antibodies against dipeptide repeat proteins (DPRs) across 66 concentrations using MSD immunoassay, and found two (against poly-GA and poly-GP) that yielded a 1.5-fold or greater signal increase in patient iPSC-motor neurons compared to knock-out control, and validated them in human postmortem and transgenic mouse brain tissue. Our validated DNA, RNA and protein assays are applicable to discovery research as well as clinical trials.

Assessing average somatic CAG repeat instability at the protein level

Article Open access 16 December 2019

Comprehensive short and long read sequencing analysis for the Gaucher and Parkinson’s disease-associated GBA gene

Article Open access 06 July 2022

Insights into the multifaceted role of circular RNAs: implications for Parkinson’s disease pathogenesis and diagnosis

Article Open access 10 January 2022

Introduction

Heterozygous expansion of an intronic GGGGCC repeat in the C9orf72 (C9) gene is the most frequent known genetic cause of both frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS)^1,2,3. C9-ALS/FTD pathology is thought to result from toxic products derived from expression of the C9orf72 repeat expansion itself. For instance, transcripts that harbor a large repeat expansion produce toxic dipeptide repeat proteins (DPRs) through repeat-associated non-AUG (RAN) translation^{4,5,6,7,8,9,10,11,12,13}.

Tools to accurately measure gene products from both the non-expanded and expanded gene are critical to understanding C9orf72 gene function in non-diseased and diseased states. We were inspired by another published effort to validate C9orf72 antibodies for Western blot¹⁴, which has been as a touchstone by many in the field, to publish our efforts to validate DNA, RNA and DPR reagents and methods using engineered patient and wild-type (WT) knock-out (KO) iPSC lines. Here we report on reagents and methods (such as single molecule sequencing to size the repeat expansion, or using KO iPSC lines for RNA and protein reagent validation) that greatly improve the characterization of C9orf72 and its gene products.

Results

Single-molecule sequencing distinguishes repeat expansion lengths in patient-derived iPSC lines

Currently, long-range PCR¹⁵ and Southern blot¹⁶ are used to clinically diagnose repeat expansion mutations in the C9orf72 gene, but these approaches lack precision, especially for large expansions. Sizing repeat expansions above ~ 100 repeats is not possible using traditional sequencing techniques that require amplification, because amplification fails across GC-rich repetitive DNA regions. Patients can have C9orf72 repeats into the thousands! Newer optical genomic mapping techniques have been reported to size large repetitive regions¹⁷ (even up to 45 kb) but they have limited resolution, which could result in missing as many 80 hexanucleotide C9-repeats. We turned instead to single-molecule sequencing, which has been demonstrated to traverse the expanded repeats of C9orf72 in plasmid¹⁸ and human tissue^19,20. We collected patient iPSC lines from previously published or publicly available sources^21,22,23,24 and optimized PacBio single-molecule sequencing of DNA from these lines to size their repeat expansions (Fig. 1). Using Cas9 to generate double-stranded breaks (DSBs) in purified DNA, adapter ligation to capture the cut genomic region of interest, and exonuclease digestion to eliminate DNA fragments without adapters, we were able to enrich for a 3.6–10 kb genomic region centering on the repeat expansion without amplification (Fig. 1A). Sequencing these single, circular DNA fragments gave us a more precise count of the number of repeats present in each cell line (Figs. 1B, 2) than Southern blots (Fig. 1B,C) or gene specific, repeat primed (GS/RP)-PCR (Figs. 1B, S1) did. Single molecule sequencing was more sensitive, requiring an input of only 3 µg DNA versus 20 µg for Southern blot, and more accurate than GS/RP-PCR, which could not quantify repeat lengths greater than 145 repeats.

Single-molecule sequencing affords better resolution of editing outcomes after dual gRNA excisions of the repeat region than Sanger sequencing does

We made an isogenic correction of the C9orf72 repeat expansion by dual-gRNA excision of the repeat region in a patient iPSC line harboring 1400 repeats. Single-molecule sequencing was critical to phasing the repeat expansion and determining the outcomes of edits targeting the expanded allele (Fig. 3). Using Sanger sequencing, it is not possible to determine whether an edit removed the repeat region from both the expanded and WT alleles or just from the WT allele, since the mutant allele fails amplification, and hence detection. Because of its low sensitivity, Southern blot may not reveal the impurity of a cell line harboring a mix of mutant and edited clones. With its high sensitivity and ability to read through long repeat expansions, we found single-molecule sequencing to be superior to current ways of determining editing outcome at the C9orf72 locus, and recommend it becomes the new gold standard for verifying lines with C9orf72 edits. Single molecule sequencing can also determine editing outcomes that differ on each allele (Fig. 3A). We also found that 20–80% of our edited clones remained impure even after single-cell sorting (Fig. 3B), indicating that even best practices for line engineering need to be confirmed. These events are impossible to detect with traditional sequencing, which does not differentiate individual alleles, and are likely to be missed by Southern blotting given its requirement for high DNA input.

ddPCR probes identify and quantify novel C9orf72 mRNA variant in iPSC-derived neurons

The C9orf72 locus is known to produce at least three sense mRNAs: variant 1 (exon 1A-short through exon 5), variant 2 (exon 1B-exon 11) and variant 3 (exon 1A-long through exon 11)¹. We designed ddPCR probes to span the exon 1A-exon 2 or exon 1B-exon 2 splice junctions to differentiate between the two major splice isoforms, variant 2 and variant 3 (Fig. 4A, Table S1). We were not able to detect variant 1 in our lines, consistent with its low to undetectable expression in human tissue^25,26.

To validate the specificity of the probes, we made selective and homozygous knock-outs of exon 1A (Fig. 4A, 1Ax) or exon 1B (Fig. 4A, 1Bx) in a non-diseased (WT) control line. Before carrying out our edits, we had engineered our iPSC lines to contain the hNIL transgene cassette with a TET-on system in the CLYBL safe-harbor locus^27,28. When exposed to doxycycline for three days, the iPSCs harboring the hNIL cassette turn on 3 human transcription factors; NGN2, ISL1, and LHX3, that drive them to differentiate into lower motor neurons (iPSC-MNs). The neurons express high levels of motor neuron markers HB9 and ChAT compared to iPSCs at the time point investigated in our expression studies (2 weeks of age)^27,29.

We evaluated the performance of each of the probes (Fig. 4B) on C9orf72 RNA expression in motor neurons derived from the edited and unedited iPSC lines. Most (96%) of the C9orf72 neuronal mRNAs contained exon 1B, while exon 1A-containing transcripts represented only a small proportion (4%) of total transcripts (Fig. 4C). Homozygous excision of exon 1A eliminated all 1A-containing transcripts (Fig. 4C). Homozygous excision of exon 1B eliminated all 1B-containing transcripts (Fig. 4C). These findings demonstrate that the probes faithfully report on their targeted transcript variant (i.e., demonstrate specificity). Interestingly, we found that excision of exon 1A decreased the amount of 1B transcript by approximately 50%, but excision of exon 1B did not significantly alter the amount of 1A transcript (Fig. 4C). In addition, although 1A-transcripts are a minority, they increased 10–15 fold in motor neurons compared to iPSCs, whereas 1B-transcripts remained relatively stable between iPSCs and motor neurons (Fig. 4D).

Knock-out validation of commercial C9orf72 antibodies for Western blot

We tested the specificity of commercially available antibodies against C9orf72 in 2-week-old patient iPSC-derived motor neurons using homozygous KO iPSC-derived motor neurons as a negative control. We generated a homozygous KO of the C9orf72 gene in a patient iPSC line harboring approximately 200 repeats, using bi-allelic excisions starting upstream of exon 1A and ending in exon 3. Of 9 commercially available Western blot-indicated primary antibodies (Table S2), including 5 antibodies not previously tested in systematic KO-validation screens^14,30, we found 4 antibodies to be specific for C9orf72 in motor neuron lysates at supplier-indicated concentrations: GTX632041, GTX634482, 2575-1-AP and B01-5F2 (Fig. 5). The other 5 antibodies showed either no signal or equivalent signal in KO motor neurons.

Lack of specificity of commercial C9orf72 antibodies for immunocytochemistry in iPSC-derived motor neurons

To test the specificity of antibodies for C9orf72 when applied to immunocytochemistry, we used the previously described 200-repeat C9-patient line and isogenic homozygous C9orf72 KO line and generated a further homozygous C9orf72 KO line on our human WT line background, using bi-allelic excisions starting upstream of exon 1A and ending in exon 2. We were interested in understanding the spatial localization of the C9orf72 protein in iPSC-derived motor neurons, but unfortunately, after testing 9 commercially available antibodies for immunocytochemistry, we found none that were specific to C9orf72: they either showed no signal in any line or showed signal in our two KO lines (Fig. S2, Table S2).

Identification of antibodies specific to dipeptide repeat proteins in patient-derived iPSC-motor neurons, patient postmortem brain, C9orf72 mutant BAC transgenic mouse brain

C9orf72 is transcribed off of both the sense and antisense strands in normal and diseased cells (Fig. 6A)^7,31,32,33. In diseased cells, some transcripts retain their intronic repeat expansion, which can undergo non-canonical RAN translation, leading to the production of two amino acid strings called dipeptide repeat (DPR) proteins^{4,5,6,7,8,9,10,11,12,13}. DPRs result from translation in any open reading frame from the sense or antisense strand, including poly-GA and poly-GR from the sense strand; poly-PA and poly-PR from the antisense strand; and poly-GP from both the sense and antisense strands (Fig. 6A).

Many of the antibodies used to quantify DPRs have been raised against or validated through positive selection to recombinant protein^6,9,10,34. Negative validation is important because the two amino acid combinations present in the DPRs are also common in other peptides. We designed an assay using Meso Scale Discovery’s (MSD) electrochemiluminescence-based sandwich immunoassay to evaluate the specificity of commercially available antibodies or antibodies available through the TargetALS consortium. We evaluated 10 antibodies, across various combinations of 8 conditions (capture antibody identity and concentration, detection antibody identity and concentration, lysate concentration, plate type, blocking buffer and diluent solution (TBS vs PBS)) (Fig. S3). We assessed these variables to increase the likelihood of DPR detection, with a total of 60 tested conditions. We first compared signals in 2-week-old motor neurons induced from our patient iPSC line harboring ~ 200 repeats to those of motor neurons induced from the isogenic C9orf72 KO line. A signal ratio of 1 between the unedited and KO lines indicates equal (and therefore nonspecific) signal, due to either equally low or high signal in both lines. A ratio > 1 demonstrates signal specific for the DPR. We found 2 antibody combinations (against poly-GA and poly-GP) that produced a greater than twofold signal in the unedited patient versus KO line (Fig. S3, green highlights), and therefore could detect the presence of DPRs above the background signal defined by our KO line.

Because low-abundance arginine-rich DPRs may not be detectable in all patient-derived iPSC lines, we next validated our findings in tissue lysates from human C9-ALS postmortem cerebellum and C9orf72 mutant BAC transgenic mouse striatum (Table S3), using optimized parameters from our initial optimization assays. Signal ratios were calculated by dividing signals from repeat-expansion containing tissues with signals from non-diseased tissue-matched negative controls. Poly-GA antibody MABN889 and poly-GP antibody TALS828.179 (lots A-I 0756 and A-I 0757) showed specificity with a ratio greater than 1.5 across all sample types (Fig. 6B, Table S4). Under our assay parameters, no other antibody showed specificity (i.e., had signal in C9-lysate greater than signal in KO/WT lysate) across samples. Interestingly, poly-PR antibody ABN1354 displayed a signal ratio of 2.4 in transgenic compared to WT control mouse brain, but not in human postmortem tissue or iPSC-derived motor neurons. In summary, we confirmed the specificity of 2 commercially available DPR antibodies against poly-GA and poly-GP across different C9-sample types.

Discussion

C9orf72 is a particularly challenging gene to work with because the repetitive DNA of the mutation and the mutant allele’s products are hard to measure. Here we share our efforts to create human-specific validated assays to measure C9orf72 DNA, mRNA and dipeptide repeats using patient-derived iPSC lines.

Measuring the length of the C9orf72 repeat expansion accurately is important for a number of reasons. Current methods used to clinically diagnose C9orf72 repeat expansion tell us that the region is expanded, but do not size long repeats (i.e. repeat-primed PCR (GS/RP-PCR), which lacks accuracy) or require high DNA input and fail to detect rare repeats or repeats of mixed sizes (i.e. Southern blot, which lacks sensitivity). We demonstrate that long range, single-molecule sequencing can accurately size the repeat expansion across a range of repeat lengths up to the thousands, with less DNA input than required for Southern blot and increased accuracy compared to GS/RP-PCR (Fig. 1). Additionally, single molecule sequencing could foster greater reproducibility of repeat expansion sizing across labs or genetic backgrounds, which has been a challenge in the field³⁵. In particular, because single-molecule sequencing does not require primer or probe binding (as PCR and Southern blot do, respectively), it can still perform when genetic variation (such as indels) is present around the repeat expansion. With this tool, we can now address important biological questions about C9orf72 pathobiology, including whether mosaicism in repeat lengths exists across cell types and whether or not the repeat expansion is stable over time in one individual or cell population.

Our approach builds upon the success of long-range sequencing to size the repeat expansion from plasmid¹⁸ and human tissue^19,20, and demonstrates its usefulness to additional applications, in particular in the context of CRISPR gene editing. We show that using SNPs, we can phase the repeat expansion to allele-specific sequences, and use single-molecule long-range sequencing to assess our edits on each allele separately (Fig. 3). Furthermore, we show that CRISPR editing can result in mixed clones with multiple editing outcomes. We suspect mixed clones, including some that retained an intact repeat expansion, have occurred in prior CRISPR editing experiments, and have confounded the analysis of these edits. With single molecule sequencing, we show that we can determine the clonality of a cell line. Moreover, we can quantify editing outcomes that differ by only a few nucleotides, showing that this method can be used to characterize small insertions or deletions (indels) induced at cut sites by CRISPR editing.

Distinguishing the transcripts emanating from C9orf72’s multiple start sites is important to understand the biology of the locus. For instance, the Genotype-Tissue Expression Project (GTEx)³⁶ shows that C9orf72 is expressed throughout the body, yet the mutant repeat expansion only seems deleterious in the central nervous system. Using ddPCR probes specific to exon 1A or 1B and cell lines with bi-allelic excisions of these exons, we uncovered interesting aspects of gene regulation at the C9orf72 locus. First, excision of exon 1A decreased the expression of 1B-containing transcripts in iPSC-derived motor neurons. Second, 1A-containing transcripts are nearly undetectable in iPSCs, but are upregulated 10–15× in iPSC-derived motor neurons. In contrast, 1B-containing RNAs constitute the majority of transcripts and their expression levels remain constant between iPSCs and induced motor neurons. Since sense expression of the repeat expansion is driven by exon 1A-transcription (and not exon 1B), the upregulation of exon 1A transcripts in motor neurons may explain why the repeat expansion manifests as a neurologic disease. In the future, our ddPCR probes could be used on human samples to determine whether 1A transcripts are specific to the subset of neurons vulnerable to ALS/FTD neurodegeneration.

How exactly expanded repeats cause toxicity is still debated, but it is clear that the C9orf72 repeat expansion encodes DPRs that can be produced by non-conventional translation off of both strands, and that these DPRs are likely to be toxic to cells. It is therefore important to distinguish and quantify these DPRs, to locate them in the cell and to determine whether genetic manipulations can eliminate them. It is also important to detect and localize C9orf72 protein, and to determine how its production is affected by the repeat and genetic manipulations aimed at neutralizing it, or by genetic background. It is disappointing that we did not find any current-generation C9orf72 antibodies that were specific for immunocytochemistry in iPSC-derived motor neurons (Fig. S2), extending prior work that also noted a lack of specificity of many C9orf72 antibodies^14,30. Nevertheless, we succeeded in identifying 4 commercial antibodies specific for C9orf72 protein via Western blot, additionally validating a previous report¹⁴ (Fig. 5). We limited our survey of Western blot-indicated commercial C9orf72 antibodies to those with evidence from publication or claim from the manufacturer of knock-out validation. Given the observed differences in antibody performance at supplier-indicated concentrations, we recommend knock-out validation of newly developed antibodies. Contrary to previous reports, we did not observe that a high amount of protein was necessary to detect C9orf72 in our iPSC-derived motor neuron lysates, as we loaded 17 µg protein versus 50 µg as previously reported^14,30. Importantly, we also identified two commercial antibodies against poly-GA and poly-GP (Fig. 6B) appropriate for DPR quantification by MSD immunoassay. We caution the field that the C9orf72 and DPR antibodies that show high signal in KO lines may have led to spurious results and recommend that KO lines be used for validation of all antibodies in the future.

There are important limitations to the methods we have described. The first is that the number of sequencing reads decreases as the repeat expansion increases. Even with this limitation we were able to detect mixed clones with mutations up to 1500 repeats (~ 9 kb). We expect that this limitation will keep receding as read depth continues to increase and the cost of sequencing decreases. Secondly, we were unable to detect the short version of C9orf72 1A transcripts (1A-short, or variant 1 transcripts) in iPSC-derived motor neurons. As a result, we cannot vouch for the specificity of our probe for 1A-long versus 1A-short RNAs. The 1A-short transcript appears to be expressed at low levels in brain tissue and may be altered by the mutation. Because the 1A-long (variant 3) and 1A-short (variant 1) overlap in exon 1A, validating probe specificity will require more selective genetic knockouts than those we performed here. Alternatively, more mature or aged cell culture systems may allow us to detect 1A-short transcripts in vitro. Thirdly, neither ddPCR nor any current sequencing method can directly measure RNA containing the repeat expansion, because amplification fails across the repeat expansion. Perhaps no-amplification RNA sequencing methods, similar for the methods we’ve used on DNA, would resolve the issue. Finally, while we have validated antibodies for poly-GA and poly-GP quantification, other DPRs are expected from endogenous RAN translation of the sense and antisense repeat-containing transcripts. At the moment, we cannot fully rule out that our failure to detect additional DPRs meant that current antibodies are not specific enough, or that our assay conditions (e.g. protein and antibody concentrations or sample preparation) were not optimal for detection of poly-GR, poly-PR and poly-PA, which are the least abundant of the five DPR species under endogenous RAN translation.

In summary, we offer validated methods for the quantification of C9orf72 at the DNA, RNA and protein levels. We recommend that RNA and protein quantification assays be validated in C9orf72 KO lines. In addition, we recommend single-molecule sequencing as the gold standard for verifying unedited and edited cell lines, since it can accurately size the repeat expansion, report on clonality, phase surrounding polymorphisms and determine editing outcomes (conflict of interest declaration: two of the authors work for PacBio with one holding company stocks; the academic authors who independently validated the assays described here made this recommendation). Adoption of these or similar measures will ensure transparency and reproducibility in the field.

Methods

Cell line maintenance

We used iPSC generated by others^21,23,24 from patients harboring the C9orf72 mutation and a control cell line without mutation³⁷ (WT-control). We maintained iPSCs in mTesR plus plated on Matrigel (Corning 356231), passaging at 60–80% confluency. All cell lines had a normal karyotype and negative quarterly mycloplasma testing.

PacBio single molecule sequencing to size the repeat expansion and detect repeat expansion excision

Because polymerase amplification fails to accurately size the entirety of the C9orf72 GC-rich repetitive region, we used single molecule sequencing^18,38 of a genomic region containing the repeat region. We collected high-molecular-weight DNA using Genomic Tip (Qiagen 10243) and confirmed absence of smearing by running the DNA on a 1.5% agarose gel. The Gladstone Genomics Core performed library preparation according to the “No Amp Targeted Sequencing” published protocol^18,39 using 3–5 µg of DNA per sample as measured by Qubit. Briefly, we blocked the free ends of purified genomic DNA and then excised the gene region of interest using spCas9, a gRNA targeting 5′ to the repeat expansion (GGAAGAAAGAATTGCAATTA) and a gRNA targeting 3′ to the repeat expansion (TTGGTATTTAGAAAGGTGGT). Excising the genomic region harboring the repeat expansion yields a 3639 bp fragment from the WT allele and a fragment of variable size from the mutant allele depending on the size of the GGGGCC repeat. We then ligated adapters and barcodes to blunt free ends and sequenced 3–5 barcoded lines per SMRT Cell on either a Sequel I or Sequel II sequencer. We used a 3-pass filter such that each molecule of DNA had to be sequenced at least 3 times to be included in analysis. We compared repeat counts from sequencing to Southern blot, performed by Celplor using 20 µg of input DNA and the previously published protocol¹⁶, and GS/RP-PCR, performed by Asuragen using 20–80 µg of input DNA and the previously published protocol¹⁵.

iPSC line CRISPR engineering

Before generating the 1Ax, 1Bx and KO isogenic series in our WT iPSC³⁷ line, we first knocked-in the inducible motor neuron transcription factor transgene cassette^27,28 in the CLYBL safe-harbor locus using spCas9 and ATGTTGGAAGGATGAGGAAA gRNA. This transgene includes human NGN2, ISL1, LHX3 (hNIL) under the TET operator and is inducible by doxycycline. The transgene also drives mCherry (for positive selection) and neomycin antibiotic resistance (for negative selection). Red-fluorescing cells were sorted via FACS to isolate single, live cells. Each resulting clonal cell line was analyzed for incorporation of the transgene in the CLYBL locus by PCR (left homology arm junction primers CAGACAAGTCAGTAGGGCCA and AGAAGACTTCCTCTGCCCTC) with preservation of one of the alleles (CLYBL wild-type primers TGACTAAACACTGTGCCCCA and AGGCAGGATGAATTGGTGGA). We used Copy Number Variation (CNV) ddPCR to pick a clone with a single transgene insertion of the hNIL plasmid (Nemomycin primers CATGGCTGATGCAATGCG and TCGCTTGGTGGTCGAATG, probe FAM; Primers UBE2D2—Bio-Rad 10031255, probe HEX) to mitigate the risk of integration of the transgene at genomic loci other than CLYBL.

For iPSC CRISPR engineering we used HiFi spCas9 protein (Macolabs, UC Berkeley) and two gRNAs to create an excision, using our published protocol⁴⁰. The gRNA pairs are listed in Table S5. gRNAs were designed to have no exact off-target matches and the lowest predicted off-targets using CRISPOR (Homo sapiens—USCS Dec. 2013 (GRCh38/hg38))⁴¹. gRNAs were ordered from IDT or Synthego. Cas9-gRNA RNP (spCas9 (40 µM), sgRNA (100 µM)) was delivered by nucleofection (Lonza AAF-1002B, Lonza AAF-1002X, Pulse Code = DS138) to 350,000 iPSCs suspended in 20 µl of P3 Buffer. The cells were recovered with mTesR plus supplemented with ROCK1 inhibitor (Selleckchem S1049) at 10 µM and Clone R (Stemcell 05888). Approximately 50% of iPSCs died within the first 24 h of electroporation, as expected. Following a 48–72-h recovery, we collected the pool of edited cells and either hand-picked 48 clones or sorted single live cells via FACS to a single well on a 96-well plate. Single-cell sorting was performed using a BD FACSAria Fusion (Beckton Dickinson) by the Gladstone Flow Cytometry Core. The QC alignment of each laser was verified with Cytometer Setup and Tracking Beads (Becton Dickinson) before sample acquisition. A forward scatter threshold of 15,000 was set to eliminate debris from list mode data, and a fixed number of events was collected. In some experiments mCherry fluorescence (excitation 561 nm, emission 610 nm) was also used to define sorting parameters. Drop delay determination and 96-well plate setup was done using Accudrop beads (Becton Dickinson). Gating on forward scatter area versus height and on side scatter area versus height was used to make the single cell determination. The specifications of the sort layout included single cell precision, 96-well collection device and target event of 1. After cultures reached 60–70% confluency, each well was split into two wells of a new 48- or 96-well plate, one for sequencing and the other to continue the cell line. We screened clones based on the presence of an excision band using PCR (primers and expected band size from Table S5. We also performed PCR across each the 5′ and 3′ cut site (Table S5), with one primer site located inside the excision region, to ensure absence of a band (for homozygous edits). For all lines except the patient repeat expansion excision line, we then Sanger sequenced the excision band (MCLAB, Quintara). If the sequence was ambiguous (i.e., had overlapping nucleotide reads at the same mapped nucleotide position) we subcloned the line to achieve clone purity and clean sequencing. All lines were karyotyped (WiCell or Cell Line Genetics) after editing.

iPSC differentiation into motor neurons

We used the hNIL transgene cassette TET-on system in the CLYBL safe-harbor locus of a C9-patient line and WT-control line. Introduction of doxycycline for 3 days induced the expression of 3 human transcription factors: NGN2, ISL1, LHX3. We followed the previously published protocol^27,28 with notable exceptions, including higher concentrations of the growth factors BDNF, GDNF and NT-3 (each at 20 ng/ml). Our detailed protocol is published⁴².

RNA quantification by ddPCR

2-week-old induced neurons were lysed with papain (Worthington LK003178) and RNA was isolated using Quick-RNA Microprep Kit (Zymo R1051). cDNA was synthesized using iScript™ Reverse Transcription Supermix (Biorad 1708841) from 500 ng of RNA. ddPCR was run with 3 technical replicates of each of 3 biologic replicates (independent wells of differentiated neurons) on the QX100 Droplet Reader (Bio-Rad 186-3002). Each ddPCR reaction consisted of 12.5 µL of 2× SuperMix for Probes (no dUTP) (Bio-Rad 186-3024), primer/probe (see Table S1), 5 ng of cDNA, and nuclease-free water up to 25 µL. Droplets were generated with QX 100 Droplet Generator (Bio-Rad 186-3001) and 20 µL of the reaction mixture with 70 µL of oil. The ddPCR reactions were run in a Deep Well C1000 Thermal Cycler (Bio-Rad 1851197) with the following cycling protocol: (1) 95 °C for 10 min; (2) 94 °C for 30 s; (3) 58 °C for 1 min; (4) steps 2; and 3 repeat 39 times; (5) 98 °C for 10 min; (6) hold at 4 °C. We thresholded positive samples as those with > 10 positive droplets to avoid error due to noise. We quantified positive droplets for each target and normalized the amount to our loading control (UBE2D2) (Bio-Rad QuantaSoft™ Analysis Pro Software). We chose this housekeeping gene because its expression level remained stable across iPSCs and differentiated neurons⁴³.

C9orf72 immunoassays

For immunocytochemistry, 2-week-old iPSC-derived motor neurons were fixed by adding 4% PFA directly to culture media for 30 min followed by 3 PBS washes of 10 min each. Cells were permeabilized by 1X DPBS 0.1% Triton-X in 3 washes of 10 min each at room temperature and blocked with 1X DPBS 0.1% Triton-X + 5% BSA for 1 h at room temperature. Primary antibodies (concentrations reported in Table S2) were incubated overnight at 4 °C. Secondary antibodies (Table S2) were incubated at room temperature for 1 h. DAPI (D1306, ThermoFisher Scientific) was added to the penultimate of five, 5 min PBS washes. Our detailed immunocytochemistry protocol is published⁴⁴.

For Western blot, 2-week-old iPSC-derived motor neurons were lysed in RIPA buffer (89900, Pierce) with 3X Halt Protease and Phosphatase Inhibitor Cocktail (78441, Thermo Scientific) and prepared for SDS-PAGE electrophoresis by boiling for 5 min at 95 °C in NuPAGE LDS Sample Buffer (NP0007, Invitrogen) and NuPAGE Sample Reducing Agent (NP0009, Invitrogen). 17 µg of protein was loaded per well. Next, the separated proteins were transferred to nitrocellulose membranes via iBlot 2 rapid transfer device (Invitrogen), followed by blocking either in 3% skim milk powder in PBS + 0.1% Tween-20 (PBS-T), or Intercept PBS Blocking Buffer (927-70001, Licor) for 1 h at room temperature. Membranes were incubated with C9orf72 antibodies diluted in blocking buffer overnight at 4 °C. C9orf72 primary antibodies were diluted to concentrations indicated for Western blot by the supplier (Table S2). Beta-actin primary antibodies (Table S2) were used 1:1000 and incubated for 1.5 h at room temperature. Following primary antibody incubation, membranes were washed 5 times for 5 min each in PBS-T, followed by secondary antibody (detailed in Table S2) incubation at room temperature for 1 h. Next, membranes were washed 5 times for 5 min each in PBS-T and imaged on an Odyssey M Imaging System (Licor). Uncropped Western blots are shown in Fig. S4.

Dipeptide repeat protein quantification by Meso Scale Discovery (MSD) immunoassay

We followed the manufacturer’s protocol for the Small Spot Streptavidin Plate (L45SA, MSD). Antibodies, concentrations and reagents used are detailed in Figs. 6B and S3 and Table S2. The plate was coated with biotinylated capture antibody overnight at 4 °C without agitation, following a 15 min agitation at room temperature at 600 rpm. The plate was blocked with 3% MSD Blocker A (R93BA, MSD) or skim milk powder in 1X DPBS for 1 h at 600–750 rpm, then incubated for 1–2 h with protein lysates at 600–750 rpm at room temperature or at 4 °C. Next, SULFO-TAG labeled detection antibody was added for 1 h at room temperature at 600–750 rpm. Washes were performed between steps thrice with 1X DPBS + 0.05% Tween-20. MSD Read Buffer A (R92TG, MSD) was added to the plate before immediate reading on an MSD Model 1250 Sector Imager 2400 plate reader. Signal ratios were calculated by dividing electrochemiluminescence intensities of positive control samples with background intensities defined by KO or WT negative control samples of the same sample type. Data were presented as fold changes (ratios) above baseline (background) level. Our detailed MSD immunoassay protocol is published⁴⁵.

Data availability

Single molecule sequencing data are available at NIH Bioproject, https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1006439.

References

DeJesus-Hernandez, M. et al. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron 72, 245–256 (2011).
Article CAS PubMed Central Google Scholar
Renton, A. E. et al. A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron 72, 257–268 (2011).
Article CAS PubMed PubMed Central Google Scholar
Majounie, E. et al. Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: A cross-sectional study. Lancet Neurol. 11, 323–330 (2012).
Article CAS PubMed PubMed Central Google Scholar
Ash, P. E. A. et al. Unconventional translation of C9ORF72 GGGGCC expansion generates insoluble polypeptides specific to c9FTD/ALS. Neuron 77, 639–646 (2013).
Article CAS PubMed PubMed Central Google Scholar
Gendron, T. F. et al. Cerebellar c9RAN proteins associate with clinical and neuropathological characteristics of C9ORF72 repeat expansion carriers. Acta Neuropathol. 130, 559–573 (2015).
Article CAS PubMed PubMed Central Google Scholar
Mori, K. et al. The C9orf72 GGGGCC repeat is translated into aggregating dipeptide-repeat proteins in FTLD/ALS. Science 339, 1335–1338 (2013).
Article ADS CAS PubMed Google Scholar
Mori, K. et al. Bidirectional transcripts of the expanded C9orf72 hexanucleotide repeat are translated into aggregating dipeptide repeat proteins. Acta Neuropathol. 126, 881–893 (2013).
Article CAS PubMed Google Scholar
Wen, X. et al. Antisense proline-arginine RAN dipeptides linked to C9ORF72-ALS/FTD form toxic nuclear aggregates that initiate in vitro and in vivo neuronal death. Neuron 84, 1213–1225 (2014).
Article CAS PubMed PubMed Central Google Scholar
Zu, T. et al. RAN proteins and RNA foci from antisense transcripts in C9ORF72 ALS and frontotemporal dementia. Proc. Natl. Acad. Sci. USA 110, E4968–E4977 (2013).
Article CAS PubMed PubMed Central Google Scholar
Mackenzie, I. R. et al. Dipeptide repeat protein pathology in C9ORF72 mutation cases: Clinico-pathological correlations. Acta Neuropathol. 126, 859–879 (2013).
Article CAS PubMed Google Scholar
Mann, D. M. A. et al. Dipeptide repeat proteins are present in the p62 positive inclusions in patients with frontotemporal lobar degeneration and motor neurone disease associated with expansions in C9ORF72. Acta Neuropathol. Commun. 1, 68 (2013).
Article PubMed PubMed Central Google Scholar
Ryan, S., Rollinson, S., Hobbs, E. & Pickering-Brown, S. C9orf72 dipeptides disrupt the nucleocytoplasmic transport machinery and cause TDP-43 mislocalisation to the cytoplasm. Sci. Rep. 12, 4799 (2022).
Article ADS CAS PubMed PubMed Central Google Scholar
Nanaura, H. et al. C9orf72-derived arginine-rich poly-dipeptides impede phase modifiers. Nat. Commun. 12, 5301 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Laflamme, C. et al. Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. eLife https://doi.org/10.7554/eLife.48363 (2019).
Article PubMed PubMed Central Google Scholar
Bram, E. et al. Comprehensive genotyping of the C9orf72 hexanucleotide repeat region in 2095 ALS samples from the NINDS collection using a two-mode, long-read PCR assay. Amyotroph. Lateral Scler. Frontotemporal Degener. 20, 107–114 (2019).
Article CAS PubMed Google Scholar
Buchman, V. L. et al. Simultaneous and independent detection of C9ORF72 alleles with low and high number of GGGGCC repeats using an optimised protocol of Southern blot hybridisation. Mol. Neurodegener. 8, 12 (2013).
Article CAS PubMed PubMed Central Google Scholar
Garcia-Heras, J. Optical genome mapping: A revolutionary tool for “next generation cytogenomics analysis” with a broad range of diagnostic applications in human diseases. J. Assoc. Genet. Technol. 47, 191–200 (2021).
PubMed Google Scholar
Ebbert, M. T. W. et al. Long-read sequencing across the C9orf72 “GGGGCC” repeat expansion: Implications for clinical use and genetic discovery efforts in human disease. Mol. Neurodegener. 13, 46 (2018).
Article PubMed PubMed Central Google Scholar
Giesselmann, P. et al. Analysis of short tandem repeat expansions and their methylation state with nanopore sequencing. Nat. Biotechnol. 37, 1478–1481 (2019).
Article CAS PubMed Google Scholar
DeJesus-Hernandez, M. et al. Long-read targeted sequencing uncovers clinicopathological associations for C9orf72-linked diseases. Brain 144, 1082–1088 (2021).
Article PubMed PubMed Central Google Scholar
Pribadi, M. et al. CRISPR-Cas9 targeted deletion of the C9orf72 repeat expansion mutation corrects cellular phenotypes in patient-derived iPS cells. BioRxiv https://doi.org/10.1101/051193 (2016).
Article Google Scholar
Shi, Y. et al. Haploinsufficiency leads to neurodegeneration in C9ORF72 ALS/FTD human induced motor neurons. Nat. Med. 24, 313–325 (2018).
Article CAS PubMed PubMed Central Google Scholar
CS52iALS-C9nxx-Cedars-Sinai Biomanufacturing Center. https://biomanufacturing.cedars-sinai.org/product/cs52ials-c9nxx/.
CS29iALS-C9nxx-Cedars-Sinai Biomanufacturing Center. https://biomanufacturing.cedars-sinai.org/product/cs29ials-c9nxx/.
van Blitterswijk, M. et al. Novel clinical associations with specific C9ORF72 transcripts in patients with repeat expansions in C9ORF72. Acta Neuropathol. 130, 863–876 (2015).
Article PubMed PubMed Central Google Scholar
Rizzu, P. et al. C9orf72 is differentially expressed in the central nervous system and myeloid cells and consistently reduced in C9orf72, MAPT and GRN mutation carriers. Acta Neuropathol. Commun. 4, 37 (2016).
Article PubMed PubMed Central Google Scholar
Fernandopulle, M. S. et al. Transcription factor-mediated differentiation of human iPSCs into neurons. Curr. Protoc. Cell Biol. 79, e51 (2018).
Article PubMed PubMed Central Google Scholar
Feliciano, C. M. et al. Allele-specific gene editing rescues pathology in a human model of Charcot-Marie-tooth disease type 2E. Front. Cell Dev. Biol. 9, 723023 (2021).
Article PubMed PubMed Central Google Scholar
Sckaff, M. et al. Two therapeutic CRISPR/Cas9 gene editing approaches revert FTD/ALS cellular pathology caused by a C9orf72 repeat expansion mutation in patient derived cells. BioRxiv https://doi.org/10.1101/2022.05.21.492887 (2022).
Article Google Scholar
Frick, P. et al. Novel antibodies reveal presynaptic localization of C9orf72 protein and reduced protein levels in C9orf72 mutation carriers. Acta Neuropathol. Commun. 6, 72 (2018).
Article PubMed PubMed Central Google Scholar
Lagier-Tourenne, C. et al. Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration. Proc. Natl. Acad. Sci. USA 110, E4530–E4539 (2013).
Article CAS PubMed PubMed Central Google Scholar
Gendron, T. F. et al. Antisense transcripts of the expanded C9ORF72 hexanucleotide repeat form nuclear RNA foci and undergo repeat-associated non-ATG translation in c9FTD/ALS. Acta Neuropathol. 126, 829–844 (2013).
Article CAS PubMed PubMed Central Google Scholar
Mizielinska, S. et al. C9orf72 frontotemporal lobar degeneration is characterised by frequent neuronal sense and antisense RNA foci. Acta Neuropathol. 126, 845–857 (2013).
Article CAS PubMed PubMed Central Google Scholar
May, S. et al. C9orf72 FTLD/ALS-associated Gly-Ala dipeptide repeat proteins cause neuronal toxicity and Unc119 sequestration. Acta Neuropathol. 128, 485–503 (2014).
Article CAS PubMed PubMed Central Google Scholar
Akimoto, C. et al. A blinded international study on the reliability of genetic testing for GGGGCC-repeat expansions in C9orf72 reveals marked differences in results among 14 laboratories. J. Med. Genet. 51, 419–424 (2014).
Article CAS PubMed Google Scholar
GTEx Portal. https://gtexportal.org/home/.
Miyaoka, Y. et al. Isolation of single-base genome-edited human iPS cells without antibiotic selection. Nat. Methods 11, 291–293 (2014).
Article CAS PubMed PubMed Central Google Scholar
Genomic Structural Variants in Nervous System Disorders | SpringerLink. https://link.springer.com/book/9781071623565.
No-Amp targeted sequencing-PacBio. https://www.pacb.com/products-and-services/applications/targeted-sequencing/no-amp-targeted-sequencing/.
Gill, K. Creating iPSC lines with Ribonucleoprotein (RNP): Nucleofection, Single-cell Sorting, Genotyping, and Line Maintenance Protocol. https://doi.org/10.17504/protocols.io.4r3l2oeopv1y/v1.
CRISPOR. http://crispor.tefor.net/.
Sckaff, M. Differentiation of iPSCs with the hNIL construct into motor neurons protocol v1. (2022) https://doi.org/10.17504/protocols.io.14egn76kqv5d/v1.
iNeuron RNA-Seq | Kampmann Lab. https://kampmannlab.ucsf.edu/ineuron-rna-seq.
Sckaff, M. Immunocytochemistry of motor neurons derived from iPSCs with the hNIL construct protocol v1. (2022) https://doi.org/10.17504/protocols.io.6qpvr68bovmk/v1.
Gill, K. & Sckaff, M. MSD gold streptavidin antibody preparation and plate run protocol v1. (2022) https://doi.org/10.17504/protocols.io.5qpvobkj9l4o/v1. Sciwheel inserting bibliography.

Download references

Acknowledgements

C.D.C. Is supported by NIH/NINDS K08-NS112330KO8, U19NS132303, Alzheimer’s Association AACSF-17-531484, UCSF CTSI TL1 Fellowship 5TL1TR001871-04, Bright Focus Foundation A20201490F, Carol and Gene Ludwig Award for Early Career Research, Larry H. Hillblom Fellowship, Shupin Fellowship from the UCSF Neurology Endowment, Weill Institute for Neurosciences and UCSF Memory & Aging Center. C.D.C. is grateful to Nancy Sakamoto, Joe DiSabatao, the Wolfen Family Foundation and Kathleen D. Mayhew and Mayhew family for their generous support. C.D.C and B.R.C. are supported by RF1-AG072052. OAA is supported by NIH/NIA SC-00080. B.R.C. is supported by R01-HL130533, R01-HL13535801, P01-HL146366. B.R.C. acknowledges support through a gift from the Roddenberry Foundation, Keenon Werling and Pauline and Thomas Tusher. We thank F. Chanut and M. Bernardi for technical advice and editorial comments. Human brain tissue was supplied from the TargetALS Postmortem Consortium.

Author information

These authors contributed equally: S. E. Salomonsson and A. M. Maltos.

Authors and Affiliations

Weill Institute for Neurosciences, University of California San Francisco, San Francisco, CA, USA
S. E. Salomonsson, K. Gill, O. Aladesuyi Arogundade, K. A. Brown, M. Sckaff, K. J. K. Lam, I. J. Fisher, R. S. Chouhan & C. D. Clelland
Memory & Aging Center, Department of Neurology, University of California San Francisco, San Francisco, CA, USA
S. E. Salomonsson, K. Gill, O. Aladesuyi Arogundade, K. A. Brown, M. Sckaff, K. J. K. Lam, I. J. Fisher, R. S. Chouhan & C. D. Clelland
Gladstone Institutes, San Francisco, CA, USA
A. M. Maltos, K. Gill, A. Sachdev, M. Sckaff, C. B. Marley & B. R. Conklin
Department of Neurological Surgery, The Ohio State University, Columbus, OH, USA
V. S. Van Laar & K. S. Bankiewicz
The Gene Therapy Institute, The Ohio State University, Columbus, OH, USA
V. S. Van Laar & K. S. Bankiewicz
Pacific Biosciences, Menlo Park, CA, USA
I. McLaughlin & Y.-C. Tsai
Departments of Medicine, Ophthalmology, and Pharmacology, University of California San Francisco, San Francisco, CA, USA
B. R. Conklin

Authors

S. E. Salomonsson
View author publications
You can also search for this author in PubMed Google Scholar
A. M. Maltos
View author publications
You can also search for this author in PubMed Google Scholar
K. Gill
View author publications
You can also search for this author in PubMed Google Scholar
O. Aladesuyi Arogundade
View author publications
You can also search for this author in PubMed Google Scholar
K. A. Brown
View author publications
You can also search for this author in PubMed Google Scholar
A. Sachdev
View author publications
You can also search for this author in PubMed Google Scholar
M. Sckaff
View author publications
You can also search for this author in PubMed Google Scholar
K. J. K. Lam
View author publications
You can also search for this author in PubMed Google Scholar
I. J. Fisher
View author publications
You can also search for this author in PubMed Google Scholar
R. S. Chouhan
View author publications
You can also search for this author in PubMed Google Scholar
V. S. Van Laar
View author publications
You can also search for this author in PubMed Google Scholar
C. B. Marley
View author publications
You can also search for this author in PubMed Google Scholar
I. McLaughlin
View author publications
You can also search for this author in PubMed Google Scholar
K. S. Bankiewicz
View author publications
You can also search for this author in PubMed Google Scholar
Y.-C. Tsai
View author publications
You can also search for this author in PubMed Google Scholar
B. R. Conklin
View author publications
You can also search for this author in PubMed Google Scholar
C. D. Clelland
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

C.D.C. conceived of the study, designed the studies, analyzed and interpreted the data, co-wrote the manuscript and funded the studies with additional funding support from B.R.C. S.E.S. performed DPR MSD and Western blot, analyzed and interpreted the data and co-wrote the manuscript. A.S., K.G., C.M., K.J.K.L. generated the cell lines. A.M. and O.A. performed and quantified ddPCR. A.M. performed C9orf72 ICC. K.G., M.S. performed and analyzed DPR MSD in iPSC-motor neurons. K.A.B. oversaw and analyzed GS/RP-PCR. I.M., Y.-C.T. performed and quantified single-molecule sequencing and I.J.F. processed the sequencing data. R.S.C. cultured iPSC-derived motor neurons for DPR MSD and Western blot. V.V.-L. and K.S.B. collected animal tissue.

Corresponding author

Correspondence to C. D. Clelland.

Ethics declarations

Competing interests

B.R.C. is a founder of Tenaya Therapeutics (https://www.tenayatherapeutics.com/), a company focused on finding treatments for heart failure, including genetic cardiomyopathies. B.R.C. holds equity in Tenaya. C.D.C. is a founder, with equity, in Ciznor Co., a CNS therapeutics company. I.M and Y-C.T. are full-time employees at Pacific Biosciences (PacBio), a company developing single-molecule sequencing technologies and I.M holds stock in PacBio. K.S.B. is a consultant at Asklepios BioPharmaceutical Inc, Scribe Therapeutics and Aviado Bio. The other authors declare no competing interests.

Additional information

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary Information.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Salomonsson, S.E., Maltos, A.M., Gill, K. et al. Validated assays for the quantification of C9orf72 human pathology. Sci Rep 14, 828 (2024). https://doi.org/10.1038/s41598-023-50667-3

Download citation

Received: 02 August 2023
Accepted: 22 December 2023
Published: 08 January 2024
DOI: https://doi.org/10.1038/s41598-023-50667-3

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.