Introduction

Small Ruminant Lentiviruses (SRLV) constitute a wide phylogenetic group of retroviruses1. These are commonly divided into Caprine Lentivirus (CLV), which includes strains that cause Caprine Arthritis Encephalitis (CAE)2 in goats, and Ovine Lentivirus (OLV), which includes those that cause Maedi-Visna (MV) disease in sheep3,4. However, these viral agents have high mutagenic potential and frequently cross the interspecific barrier between ruminants5,6. In addition, these infections are contagious and incurable diseases that cause significant economic losses in goat and sheep production3,7,8. Currently, there are no effective treatments or vaccines available9,10, and the search for novel prevention strategies is necessary. The CAE virus can be transmitted in several ways. Among these, the lactogenic pathway is an important mechanism by which this disease may pass between animals, and may occur through the ingestion of infected colostrum and milk, either by free viral particles or by viruses contained in monocytes/macrophages11,12. Hence, blocking this form of transmission is important because of the large dissemination of the virus in flocks13,14. Notable among these techniques is the use of artificial colostrum, which is composed of 700 mL of healthy bovine milk, 300 mL of blood serum from negative goats or sheep, and a hen’s egg15. It is also recommended to use (healthy) cow colostrum to feed goats and sheep15,16. The pasteurization of milk can also be mentioned, as it maintains the organoleptic and nutritional characteristics, while ensuring the destruction of pathogenic microorganisms, making it a healthy food17. Another widely used method is the thermization procedure, which can be performed on colostrum, transitional milk, and regular milk, in which these are heated in a water bath at 56 °C for one hour and then stored at – 15 °C16,18. However, this method requires equipment and trained staff, making it laborious to execute18. Therefore, it is important to research new practical alternatives that are low cost for producers and are effective in preventing dissemination of the disease via the lactogenic pathway in flocks.

In this context, validation of antiviral agents for the treatment of curable, incurable, chronic, and acute viral infections is in constant evolution19,20,21,22,23. Among medicines, plants of the Meliaceae family, such as A. indica (neem) and M. azedarach (chinaberry tree), have demonstrated several applications in human and veterinary medicine, including as insecticides, bactericides and antivirals22,23,24. Leaf extracts of A. indica were tested against the human immunodeficiency virus (HIV) in the form of vaginal tablets, and promising results for the control and dissemination of this pathogen in India were found25. In addition, neem demonstrated effects on the dengue virus, inhibiting protease activity by means of bioflavonoids, which could contribute to the development of an effective drug against viral infection24.

Melia azedarach inhibits the multiplication of herpes simplex virus type 2 (HSV-2) in epithelial cells and increases the cytokine production in macrophages, which are important traits for viral elimination26. Furthermore, it showed potent antiviral activity against several strains of influenza virus (H5N1, H1N1, H3N2, H7N9 and H9N2) in in vitro and in vivo studies23. Therefore, this study aimed to evaluate in vitro the use of ethanolic leaf extracts of A. indica and M. azedarach as antiviral agents against CLV in goat colostrum and milk.

Results

Toxicological analysis by mean lethal concentration (LC50) in Artemia salina Leach

After carrying out toxicity tests with Artemia salina Leach (A. salina), the LC50 of all treatments was established [Control, CEE-AI (crude ethanolic extract—Azadirachta indica), EAF-AI (ethyl acetate fraction—Azadirachta indica), MF-AI (fraction methanol—Azadirachta indica), CEE-MA (crude ethanolic extract—Melia azedarach), EAF-MA (ethyl acetate fraction—Melia azedarach), MF-MA (fraction methanol—Melia azedarach)], and their respective estimated concentrations (µg/mL), in the period of 24 h, 48 h and 72 h (Table 1). The LC50 values obtained for A. indica in CEE-AI and its EAF-AI and MF-AI fractions were 210.614, 160.562, and 155.715 µg/mL, respectively, in the 24 h period. Taking into account this same period, the estimated values in the LC50 of M. azedarach in the CEE-MA, EAF-MA, and MF-MA fractions were 109.134 (with maximum use limits of 207.826 µg/mL), 179.099 (with maximum use limits of 334.472 µg/mL), and 147.350 µg/mL (with maximum use limits of 268.793 µg/mL), respectively.

Table 1 Estimating the mean lethal concentration (LC50) of crude extracts of Azadirachta indica and Melia azedarach their respective fractions of ethyl acetate and methanol in Artemia salina Leach with 95% confidence limits for concentration (µg/mL).
Full size table

After 24 h, an increase in the death of crustaceans was evident with low dosages of the extracts of both Meliaceae. For the control treatment, the LC50 related to the concentration of NaCl was estimated to be 26.095 g/L; it should be noted that only the concentration of NaCl was estimated because it is the only component present in the treatment.

The linear regression obtained using the probit test is shown in Fig. 1, which shows an estimate in log10 with a reliability limit of 95% [Concentration (µg/mL)], which can be observed as the dependent variable “y” (concentration) as a function of “x” (time). The longer the concentrations of extracts of A. indica and M. azedarach were in contact with A. salina, the greater the toxicity level, thus reducing the number of living crustaceans in the study and increasing the toxicity and decreasing the estimated dose of the LC50.

Figure 1
figure 1

Estimate visualized in log10 with a reliability limit of 95% (Concentration (µg/mL)) in which can be observed the dependent variable “y” (concentration) as a function of “x” (time). The longer the concentrations of extracts of Azadirachta indica. and Melia azedarach and are in contact with Artemia Salina, the greater the toxicity level, thus reducing the number of living crustaceans in the study. CEE-AI: crude ethanolic extract—Azadirachta indica; EAF-AI: ethyl acetate fraction—Azadirachta indica; MF-AI: fraction methanol—Azadirachta indica; CEE-MA: crude ethanolic extract—Melia azedarach; EAF-MA: ethyl acetate fraction—Melia azedarach; MF-MA: fraction methanol—Melia azedarach.

Full size image

Cell viability analysis using the MTT test (3-4,5-dimethyl-thiazol-2-yl-2,5-diphenyltetrazolium bromide)

The results of cell viability tests are shown in Fig. 2. At 24 h, the concentration of 10 µg/mL did not significantly differ between most treatments and controls for both plants, except for EAF-MA, which had a higher absorbance value than the others, with an approximate difference of 0.0103 nm (P < 0.05; P = 0.04). At a concentration of 100 µg/mL, the treatments Control, EAF-AI, MF-AI, CEE-MA, and MF-MA did not differ statistically among themselves; only treatments CEE-AI (P < 0.05; P = 0.01) and EAF-MA (P < 0.05; P = 0.01) differed from the others and between them. At 1000 µg/mL, all treatments were similar, except for the control group, with an approximate difference of 0.0402 nm (P < 0.05; P = 0.004). Among the concentrations of 10, 100, and 1000 µg/mL, at this same time (24 h), only the MF-AI and CEE-MA treatments were statistically equal, whereas the others were different (P < 0.05; P ≤ 0.004). In the control, CEE-AI, EAF-AI, and MF-MA treatments, the results were similar between the concentrations of 10 and 100 µg/mL and differed at 1000 µg/mL (P < 0.05; P ≤ 0.005). This indicated that all fractions from both plants, at a dosage of 1000 µg/mL, inhibited cell proliferation in the 24 h period compared to the control (Fig. 2a).

Figure 2
figure 2

Tabulated and graphed values of absorbance (570 nm) obtained by the 3–4,5-dimethyl-thiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT) test after the action of crude extracts of Azadirachta indica and Melia azedarach and their respective fractions of ethyl acetate and methanol for 24 h, 48 h, and 72 h. (a) treatment with the extracts and their respective fractions at concentrations of 10, 100, and 1000 µg/mL within 24 h; (b) treatment with the extracts and their respective fractions at concentrations of 10, 100, and 1000 µg/mL within 48 h; (c) treatment with the extracts and their respective fractions at concentrations of 10, 100, and 1000 µg/mL within 72 h CEE-AI: crude ethanolic extract—Azadirachta indica; EAF-AI: ethyl acetate fraction—Azadirachta indica; MF-AI: fraction methanol—Azadirachta indica; CEE-MA: crude ethanolic extract—Melia azedarach; EAF-MA: ethyl acetate fraction—Melia azedarach; MF-MA: fraction methanol—Melia azedarach.

Full size image

At 48 h, the 10 µg/mL concentration was statistically similar for all treatments. At a concentration of 100 µg/mL, the Control, CEE-AI, EAF-AI, CEE-MA, EAF-MA, and MF-MA groups were similar, and MF-AI treatment differed from EAF-MA (P < 0.05; P = 0.009). However, EAF-MA was similar to the control group and other treatments. At 1000 µg/mL, all treatments were identical and distinct from the control group (P < 0.05; P = 0.001). At concentrations of 10 µg/mL, 100 µg/mL, and 1000 µg/mL, at the same time, they were identical to each other in the control group. EAF-MA differed significantly among the three concentrations (P < 0.05; P = 0.001). The groups CEE-AI, EAF-AI, MF-AI, CEE-MA, and MF-MA obtained similar results, comparing 10 and 100 µg/mL. The concentration of 1000 µg/mL, on the other hand, was similar to 10 µg/mL in CEE-AI, MF-AI, CEE-MA, and EAF-AI treatments with identical results compared to 10 and 100 µg/mL, but different from 1000 µg/mL (P < 0.05; P = 0.002). Thus, all Meliaceae fractions studied at a concentration of 1000 µg/mL induced cell apoptosis within 48 h compared with the control. Furthermore, the EAF-MA fraction was inhibited at a dose of 100 µg/mL at 48 h (Fig. 2b).

At a time of 72 h, at a concentration of 10 µg/mL, the MF-AI, CEE-MA, and MF-MA treatments were similar to the control group, whereas the EAF-AI and EAF-MA treatments were similar to each other but differed significantly (P < 0.05; P = 0.003). CEE-AI showed a difference in all treatments, including the control group (P < 0.05; P ≤ 0.014). At a concentration of 100 µg/mL, only MF-MA was similar to that of the control group. The treatments MF-AI and CEE-MA were identical to each other and differed from the others, as were CEEI-AI, EAF-AI, and EAF-MA (P < 0.05; P ≤ 0.003). At a concentration of 1000 µg/mL, all treatments differed from the control group (P < 0.05; P ≤ 0.001) but were similar between them. Between the concentrations of 10, 100, and 1000 µg/mL, at the same time, the treatments Control, MF-AI, CEE-MA, EAF-MA, MF-MA were statistically different in all concentrations (P < 0.05; P ≤ 0.02). The CEE-AI and EAF-AI treatments were similar between 10 and 100 µg/mL and different at (P < 0.05; P 0.02) 1000 µg/mL. Thus, except for treatment with EAF-MA, which caused a reduction in cell multiplication at a concentration of 100 µg/mL, the other fractions showed this effect only at the highest dose (1000 µg/mL) of the control (Fig. 2c).

Potential antiviral activity of leaf extracts of Azadirachta indica and Melia azedarach

Cell destruction and syncytium formation, which are cytopathic effects (CPE) typically caused by CLV, were observed in ovine third eyelid (OTE) cells during culture, even after treatment with both ethanolic leaf extracts. However, a gradual reduction in CPE was verified, which was directly proportional to the times (30, 60, and 90 min) in which phytocompounds were in contact with cells (Table 2).

Table 2 Levels of cytopathic effects in ovine third eyelid (OTE) cells after co-culture with somatic cells of goat colostrum and milk (CSC/MSC) treated with crude ethanolic extract (CEE) and the respective organic ethyl acetate (EAF) and methanol (MF) fractions of Azadirachta indica (AI) and Melia azedarach (MA) leaves.
Full size table

Significant destruction of cellular monolayers and moderate presence of syncytia occurred in colostrum samples submitted for 30 min to crude extracts of A. indica and M. azedarach and their respective ethyl acetate and methanol fractions. These CPEs were constant in the treatments for 60 min for the three A. indica extracts. However, a slight reduction in CPE was observed during the same period for all tested M. azedarach fractions. At 90 min, all extracts caused a greater reduction in CPEs.

For milk samples, the three fractions tested for 30 min yielded a slight reduction in cell destruction with a moderate presence of syncytia. In the 60 min treatment, CPE results of all A. indica extracts were similar to those of the previous period. In contrast, no CPE was observed after treatment with the crude extract and ethyl acetate fraction of M. azedarach for 60 min. After 90 min, only samples submitted to the ethyl acetate fraction of A. indica presented CPE, while in the remainder, and with respect to M. azedarach, only in the methanolic fraction, a slight formation of CPEs characteristic of goat lentivirus was observed.

These results demonstrated that the efficacy of both Meliaceae plants against CLV was more significant in the 90 min treatments for both colostrum and milk. In tests with colostrum, there was initially a cell culture of OTE, which represented the negative control culture, without evidence of CPE (Fig. 3a). Low levels of cell destruction and syncytium formation were observed in OTE cells treated with the crude ethanolic extract of A. indica (Fig. 3b, arrow). Nonetheless, no typical CLV CPE was observed with the crude extract of M. azedarach (Fig. 3e). The ethyl acetate fractions from both plants did not exhibit typical CPE (Fig. 3c,f). Furthermore, the methanol fraction of A. indica eliminated CPE entirely (Fig. 3d). However, syncytium formation was observed in the methanol fraction of M. azedarach (Fig. 3g, arrows). Regarding the positive controls of the tests, colostrum without previous treatment and culture with the standard CAEVCO strain are shown in Fig. 3, in items 1h and 1i, respectively.

Figure 3
figure 3

Co-culture with ovine third eyelid cells (OTE) and somatic cells from colostrum infected with CAEVCO (SCC+) treated with Azadirachta indica and Melia azedarach leaf extracts for 90 min after 63 days of culture. (a) Negative culture control with OTE cells (×100 magnification). (b) Co-culture of OTE and SCC+ cells submitted to CEE-AI treatment, with syncytia (arrows) (×100 magnification). (c) Co-culture of OTE and SCC+ cells subjected to EAF-AI treatment (×100 magnification). (d) Co-culture of OTE and SCC+ cells subjected to MF-AI treatment (×100 magnification). (e) Co-culture of OTE and SCC+ cells submitted to CEE-MA treatment (×100 magnification). (f) Co-culture of OTE and SCC+ cells subjected to EAF-MA treatment (×100 magnification). (g) Co-culture of OTE and SCC+ cells subjected to MF-MA treatment (×200 magnification). (h) Co-culture of OTE and SCC+ with syncytia (arrows) (control treatment without extract) (×200 magnification). (i) Positive control of CAEVCO-infected OTE cells with syncytia (arrows) (×200 magnification). CEE-AI: crude ethanolic extract—Azadirachta indica; EAF-AI: ethyl acetate fraction—Azadirachta indica; MF-AI: fraction methanol Azadirachta indica; CEE-MA: crude ethanolic extract—Melia azedarach; EAF-MA: ethyl acetate fraction—Melia azedarach; MF-MA: fraction methanol—Melia azedarach.

Full size image

The antiviral activity of the extracts was also observed in milk samples treated with both plants for 90 min. The Fig. 4a shows the negative control cells without any identified viral effects. In the treatment with A. indica, light levels of CPEs were observed, which were identified by the presence of syncytia in the culture using crude CEE and MF, respectively (Fig. 4b,d—arrows). Only the EAF of this plant completely inhibited the occurrence of typical CLV cytopathic effects (Fig. 4c). Concerning M. azedarach treatments, with the use of the crude extract and ethyl acetate fraction, CPE characteristics for goat lentivirus were not identified, and very light CPE was observed in the methanolic fraction (Fig. 4e–g). These data indicate the antiretroviral potential of the fractions that inhibited CPE formation in the co-culture. Lastly, the positive controls of the tests, colostrum without previous treatment, and culture with the standard CAEVCo strain are shown in Fig. 4, in items 2h and 2i, respectively.

Figure 4
figure 4

Co-culture with ovine third eyelid cells (OTE) and somatic cells from milk infected with CAEVCO (SCM+) treated with Azadirachta indica and Melia azedarach leaf extracts for 90 min after 63 days of culture. (a) Negative culture control with OTE cells (×100 magnification). (b) Co-culture of OTE and SCM+ cells submitted to CEE-AI treatment, with syncytia (arrows) (×200 magnification). (c) Co-culture of OTE and SCM+ cells subjected to EAF-AI treatment (×100 magnification). (d) Co-culture of OTE and SCM + cells subjected to MF-AI treatment, with syncytia (arrows) (×100 magnification). (e) Co-culture of OTE and SCM+ cells submitted to CEE-MA treatment (×100 magnification). (f) Co-culture of OTE and SCM+ cells subjected to EAF-MA treatment (×100 magnification). (g) Co-culture of OTE and SCM+ cells subjected to MF-MA treatment (×100 magnification). (h) Co-culture of OTE and SCM+ with syncytia (arrows) (control treatment without extract) (×200 magnification). (i) Positive control of CAEVCO-infected OTE cells with syncytia (arrows) (×200 magnification). CEE-AI: crude ethanolic extract—Azadirachta indica; EAF-AI: ethyl acetate fraction—Azadirachta indica; MF-AI: fraction methanol Azadirachta indica; CEE-MA: crude ethanolic extract—Melia azedarach; EAF-MA: ethyl acetate fraction—Melia azedarach; MF-MA: fraction methanol—Melia azedarach.

Full size image

Viral titration of samples

The evidence found in the presence or absence of cytopathic effects typical of CLV in treatments with leaf extracts of A. indica and M. azedarach was confirmed by viral titration. A decrease in the number of infectious viral particles in the cell suspension of milk and colostrum samples subjected to 90 min of treatment with ethanolic extracts of the plants was observed in comparison to the controls (Fig. 5).

Figure 5
figure 5

Viral titers of milk and colostrum samples co-cultured with ovine third eyelid (OTE) cells submitted to 90 min treatment composed of ethanolic leaf extracts of Azadirachta indica and Melia azedarach. (a) Colostrum samples treated with crude extract of A. indica and M. azedarach leaves and respective ethyl acetate and methanol fractions. (b) Milk samples treated with crude extract of A. indica and M. azedarach leaves and respective ethyl acetate and methanol fractions. *TCID50/mL: tissue culture infection dose is the highest dilution that presented, at 14 days post-inoculation, syncytia in 50% of inoculated wells, C+: positive control of standard CAEVCO strain, C + T.: positive control of treatments.

Full size image

In goat infected colostrum samples (C + T), the initial viral titer was 105.2 TCID50/mL, which was close to the result observed in the positive control of CAEVCO (C+), 105.5 TCID50/mL. After treatment with plant extracts, decreases in viral titers were observed to 102.5, 102.2 and 104 TCID50/mL in samples treated with crude extract, ethyl acetate fraction, and methanol fraction of A. indica, respectively (Fig. 5a). Extracts of M. azedarach yielded similar results, which were 102.2, 102.2, 103.5 TCID50/mL for crude extract, ethyl acetate fraction and methanol fraction, respectively. Furthermore, the ethyl acetate fraction presented the best results in both tests in comparison to the C + T control with a logarithmic difference of 3 lg between viral titers, demonstrating a relevant and promising antiviral potential.

In milk samples, the antiviral potential of ethyl acetate fractions of A. indica and M. azedarach were constant, presenting values of 102.5 and 102.2 TCID50/mL, respectively. These values also demonstrated that there was logarithmic difference of 2.3 lg and 2.8 lg, respectively, between titers in comparison to the positive milk control (C + T), which was 105 TCID50/mL (Fig. 5b). Crude extracts and organic methanol fractions from both plants showed elevated titer values, 103.2 and 103.2 TCID50/mL for crude extract, and 103.3 and 103.8 TCID50/mL for methanol fraction of A. indica and M. azedarach, respectively. These values demonstrated lower efficacy than those from the ethyl acetate fractions of both plants.

Hence, 150 µg/mL concentration of ethyl acetate fractions of ethanolic extracts from A. indica and M. azedarach leaves could potentially reduce the viral titer of CLV in colostrum by a thousandfold. The inhibition in milk was 500–800 times for the respective plants.

Somatic cell count (SCC) of colostrum and milk after treatment with extracts of A. indica and M. azedarach

From the data obtained in the co-culture and in the viral titration, it was observed that the 90-min treatment with the crude extracts of the leaves of A. indica and M. azedarach and their respective EFA and MF obtained the best antiviral responses. To determine the number of cells and, consequently, the quality of colostrum and milk, the somatic cell counts of the samples obtained after treatment with the extracts were determined.

Figure 6 shows somatic cell count data after these treatments. SCC of colostrum samples did not differ statistically; the control treatment resulted in an average of 524.000 SC/mL (somatic cell/milliliters), and the other results were statistically similar to it, with P < 0.01. There was a significant difference in milk between the control sample, with an average of 4.545.600 SC/mL (P = 0.008), concerning the EAF-AI treatments, with an average of 1.851.100 SC/mL, and MF-AI, 2.671.900 SC/mL (P = 0.003). In the treatment with M. azedarach extracts, a statistical difference was detected only in the MF-MA, with a mean value of 2.823.400 CS/mL (P = 0.009), with P < 0.01. Thus, we can observe a reduction in SCC in the milk samples that had contact with the strata with the EAF-AI, MF-AI, and MF-MA treatments at a 150 µg/mL concentration.

Figure 6
figure 6

Tabulated values (a) and graphs (b) of somatic cell count (SCC) by the microscopic method in colostrum and goat milk samples after treatment with the crude extracts of Azadirachta. indica and Melia azedarach and the organic fractions of Ethyl Acetate and Methanol for 90 min of action. Different letters in the same column differ from each other by Tukey's test P < 0.01 CEE-AI: crude ethanolic extract—Azadirachta indica; EAF-AI: ethyl acetate fraction—Azadirachta indica; MF-AI: fraction methanol Azadirachta indica; CEE-MA: crude ethanolic extract—Melia azedarach; EAF-MA: ethyl acetate fraction—Melia azedarach; MF-MA: fraction methanol—Melia azedarach.

Full size image

Chromatograms of A. indica and M. azedarach extracts

The chromatograms for the ethyl acetate (a), methanol (b), and crude ethanol extract (c) fractions of A. indica leaves are shown in Fig. 7-1. In the ethyl acetate fraction (Fig. 7-1a), nimbandiolactone-23 isomer II (8), azedarachin C isomer I (10), isomer II (11), isomer III (12), flowerone (13), trisinlin A (15), licoflavanone (16), sulfoquinovosylmonoacylglycerol (SQMG) 18:3 (17), monogalactosylmonoacylglycerol (MGMG) 18:3 (20), melianone (22), and MGMG 16:0 (23). In the methanolic fraction (Fig. 7-1b) and crude ethanolic extract (Fig. 7-1c), rutin (1), quercetin-O-hexoside (2), kaempferol-O-rutinoside (3), kaempferol-O-hexoside (4), and quercetin-O-rhamnoside (5) were predominant.

Figure 7
figure 7

UPLC-ESI-QTOF-MSE chromatograms of Azadirachta indica (1) and Melia azedarach (2) leaves extracts in negative ionization mode: (a) crude ethanol extract; (b) methanol fraction; (c) ethyl acetate. The numbers on the peaks are referenced in Tables 3 and 4.

Full size image
Table 3 Compounds putatively identified in ethyl acetate fraction from Azadirachta indica leaves by UPLC-ESI-QTOF-MSE in negative ionization mode.
Full size table
Table 4 Compounds putatively identified of extract in ethyl acetate fraction from Melia azadirachta leaves by UPLC-ESI-QTOF-MSE in negative ionization mode.
Full size table

With regard to M. azedarach, the chromatograms for the crude ethanolic extract (a), methanolic fraction (b) and ethyl acetate (c) are shown in Fig. 7-2. In the crude ethanol extract (Fig. 7-2a) and methanolic fraction (Fig. 7-2b), the flavonoids rutin (1), quercetin-O-hexoside (2), and kaempferol-O-rutinoside (3). In the ethyl acetate fraction (Fig. 7-2c), compounds 9,12,13-trihydroxyoctadeca-dienoic acid (6) and linolenic acid (26) stood out, in addition to the unknown compound 14.

Chemical composition and characterization of A. indica and M. azedarach leaf extracts

The organic EAF from both plants showed a greater reduction in the viral titer of the CAEVCO strain in the colostrum and milk samples, and consequently, a better antiviral action. Thus, in negative ionization mode, their chemical compositions were determined by ultra-performance liquid chromatography-mass spectrometry (UPLC/MS). In the fraction derived from A. indica, 24 compounds were identified, of which eight were flavonoids (1–5, 7, 13, and 16), ten were triterpenoids (limonoids-type—6, 8–12, 14, 15, 19 and tirucalane-type–22), five were glycolipids (17, 18, 20, 21, and 23), and one was an unknown compound (24) (Table 3). In the chemical composition of ethyl acetate from M. azedarach, 27 compounds were determined, of which four were flavonoids (1–3 and 5), eight were fatty acids (6, 9, 19–21 and 25–27), eight were triterpenoids (limonoids-type—7, 8, 10–13, 16, and 17), a monoterpene lactone (4), a sesquiterpene (18), and five unknown compounds (14, 15, and 22–24) (Table 4).

Discussion

Much research has been conducted on bioactive substances to investigate their possible antiviral effects against infections in humans and animals. In this context, plants from several botanical families, and their parts, such as the leaves, roots, flowers, and seeds, have been studied and revealed to possess promising substances in their composition27.

From bibliographic research, it was shown that potential antiviral effects with species of Meliaceae were achieved at an approximate concentration of 150 µg/mL28. From this, pilot tests were carried out with this concentration, which showed promising results; therefore, it was decided to elucidate its possible antiviral effect against SRLV in more detail.

Countless researchers use tests with A. salina Leach as an effective bioassay for the elucidation of lethal dosages of bioactive components present in natural products that are screened for different purposes29,30,31,32, owing to their speed, low cost, and reliability of results29. In general, a natural product is considered toxic when its lethal concentration is less than 1000 µg/mL, within 24 h29. It is noteworthy that this 24-h period is standard in several studies29,31,32,33. However, in the present study, toxicity was observed after 48 h of incubation in all treatments. Thus, the results of the toxicity test with A. salina Leach demonstrated that a dosage of 150 µg/mL is a safe margin for using extracts of both Meliaceae in 24 h, with no toxic effect observed. Although the CEE-MA and MF-MA treatments obtained LC50 lower than the test concentration, they remained within the maximum limits for use of these extracts during the study period.

The toxic effects of some extracts are often directly linked to solvents33. In the present study, we chose to use dimethylsulfoxide (DMSO) because it is highly soluble and does not cause molecular interference in the phytochemical components34, unlike Tween 80, which is reported to be more toxic than other solvents through causing protein denaturation and inhibition of physiological processes35,36. In determining the LC50 of NaCl, it was shown that the test dosage, which has already been adopted in previous studies30,37,38, was lower than the dose considered lethal in this study, thus not exerting any effect on the outcomes of no treatment.

In the evaluation of the viability of OTE cells via the MTT test, it was shown that the extracts of both Meliaceae and their respective fractions at the dosage tested did not cause toxicity to this cell type, and there was no inhibition of cell proliferation. Interestingly, in the literature, there are reports of cytotoxicity of some species of Meliaceae that, when used at high doses (1 mg/mL), induced cell death by apoptosis at 24 and 48 h, while lower concentrations (10 µg/mL and 100 µg/mL) did not show a reduction in cell viability39 as in the present study.

The use of cell viability assays is always an effective way to determine biological toxicity when working with plant extracts, and MTT, in general, is the method of choice for in vitro evaluations to detect the harmful effects of natural products40 in the most distinct cell types. In this study, we chose to use nictitating membrane cells because of the ease of obtaining them, the absence of animal sacrifice41, and because it was used throughout this antiviral experiment. Thus, this cell type is not widespread, making it difficult to provide data in the literature that can serve as comparative parameters.

Hence, the data obtained in this study performed with co-culture of SC of colostrum and SC of milk and OTE cells after use of ethanolic extracts of A. indica and M. azedarach may reveal a possible antiviral activity against CLV. This fact was observed mainly in the organic fraction of ethyl acetate, with an action time of 90 min, with marked inhibition of syncytium formation and cell destruction, which are considered the main characteristic cytopathic effects of CVL elucidated even in previous research studies, where the adoption of a qualitative evaluation through the visualization of their occurrence levels in cultured cells is standard19,42,43,44,45,46.

Thus, the virulence of positive colostrum and milk samples for CLV was affected by treatments with leaf extracts of A. indica and M. azedarach, as observed in co-culture, since co-culture has several applications in biology and in the study of natural or synthetic interactions among cell populations. This technique may be defined as a variation in cell culture, in which two or more different cell populations are incubated with some degree of contact between them47. Therefore, free viral transmission may occur in the extracellular environment or through cell-to-cell interactions, involving direct contact between them48.

Concerning antiviral activity, the reported findings consolidate the use of these Meliaceae species as promising herbal medicines. Antiviral activity of A. indica has been reported against coxsackievirus (group B) using ketone extracts49, and against dengue virus using aqueous extracts28 and specific isolates, such as triterpenoids50. HIV is also inhibited by neem when administered via intravaginal tablets in women, as demonstrated by studies in India performed in vivo25 and in vitro51 with CD4+ cells. This plant has also been tested against papillomavirus type 1 (PV-1)52 and herpes simplex virus (HSV)53 using polysaccharides. In addition, aqueous extracts of this herbal medicine have been shown to be effective against foot-and-mouth disease24,54. Furthermore, flavonoids from this species of Meliaceae inhibited the viral activity of several influenza strains (H1N1, H1N2, H2N2, H2N3, H5N1, H7N2, H7N3, H7N7 and H9N2)55.

Basic studies performed with extracts of M. azedarach reported antiviral activity against Sindbis virus56. In 1998, Castilla et al.57 inhibited the multiplication of the Junin virus using meliacine peptide. More recent findings have demonstrated that extracts from chinaberry trees affect DNA synthesis, maturation, and egress of HSV-158,59 and inhibit viral multiplication of HSV-226. In addition, fruit extracts of M. azedarach inactivated dengue virus, yellow fever virus, and West Nile virus60. Furthermore, strains of the influenza virus (H1N1, H3N2, H5N1, H7N9 and H9N2)23 and HSV-361 were inhibited by aqueous and ethanolic extracts of the same plant, respectively.

The viral titration method used in this study after co-culture investigated the antiviral activity of ethanolic leaf extracts of A. indica and M. azedarach in colostrum and milk samples infected with CLV. The use of these plants reduced CLV titers, which means a decreased number of viral particles in the cell supernatant, in the order of 1000 times in colostrum and 800 times in milk. However, complete elimination of CLV did not occur in these samples. However, these plants may be considered efficient herbal medicines for antiretroviral control. Similar data was reported in research by Narovlianskiĭ et al.62, which studied antiviral effects of sodium polyprenyl phosphate (PPP) against hepatitis C virus (HCV) in swine embryo kidney cells (SPEV) and demonstrated that 60 µg of PPP decreased HCV titers with a 3.5 lg difference.

Moreover, the more intense reduction in viral titers in colostrum samples may be attributed to the interaction of secondary metabolites with proteins that naturally occur more frequently in this type of biological sample. One example is lactoferrin, a glycoprotein that has variable concentrations according to the animal species63 and contributes to the development of the immune system64. This protein has been reported to be effective against rotavirus65 because of its possible role in stopping the entry of this pathogen into host cells through blocking viral receptors or via direct ligation with viral particles66. This fact may have been potentiated by the synergistic activity of components found in ethanolic leaf extracts of the investigated plants,and may have favored an improved antiretroviral activity of fractions in goat colostrum, considering that flavonoids are capable of interacting with lactoferrin in the secretions of ruminants67.

In this study, a higher concentration of distinct ethanolic fractions from both Meliaceae plants was used in comparison with other studies. Values of 12.1 to 80 µg/mL of A. indica were effective against PV-152, while 63.5 µg/mL of M. azedarach was efficient in inhibiting herpes simplex virus type 1 (HSV-1)59. However, the effective dose of a substance against a strain varies according to viral type. This occurs because of the high capacity of mutation of viruses and the necessity for greater concentrations of substances for satisfactory inhibitory effects against viral agents19,24,68.

There are reports that the number of somatic cells (macrophages, lymphocytes, neutrophils, epithelial desquamation cells, etc.) may be related to the presence of proviruses in the samples, mainly in macrophages12,13. Thus, in this study, there was a reduction in the viral titer after treatment with the extracts of both Meliaceae, showing that all colostrum samples had SCC similar to the control and within the standards established for the species69, the extracts in this biological sample had a potent antiviral effect. Furthermore, in milk, the reduction of SCC due to the action of some treatments (EAF-AI, MF-AI, and MF-MA) is likely to be associated with this drop in the viral titer attributed to the antiviral effect of the extracts since the referred fractions where this effect was observed showed lower SCC. In general, high numbers of somatic cells are indicative of caprine lentivirus infection, as values > 1,000,000 cells/mL are considered evidence of subclinical mastitis in goats infected with this viral agent70,71,72. Thus, the reduction in somatic cells in some samples may be associated with a reduction in viral particles caused by the Meliaceae tested, which consequently led to a reduction in viral multiplication.

It is worth noting that information on SCC in goat colostrum is scarce73, and Brazilian legislation still requires a certain number of SC in goat milk74. In addition, numerous variables (species, level of infection, physiological state, and management practices) influence the SCC in milk75. Although there have been attempts to establish SCC in non-infected goats, biological and instrumental limitations make it difficult to compare results and establish this parameter in goats74. However, with SCC in the treatments in which there was a reduction, the amount was still within the established limits (1,000,000 SC/mL) by some authors referring to this parameter for small ruminants69,74.

Chemical analysis of the different fractions used in this study revealed a composition of phenols, flavonones, flavonols, xanthones, steroids, flavonoids, triterpenoids, saponins, and alkaloids. These components are usually reported in plants from the Meliaceae family59, and the antiviral effect is attributed to secondary metabolites that may act alone or synergistically76,77,78. Furthermore, when acting in consonance, these substances present great pharmacological variability and may, in the future, be used as broad-spectrum antimicrobial agents79,80.

In terms of phytochemical composition, in several other studies, with the exception of glycolipids (17, 18, 20, 21, and 23), the other compounds were previously reported in A. indica (1–9, 13, 14, 16, and 19)55,81,82,83,84 and in the Meliaceae family (10–12, 15, 22)67,85,86,87. In M. azedarach, with the exception of fatty acids (6, 9, 19–21 and 25) and unknown compounds (14, 15 and 22–24), the other compounds have been previously reported (1–3, 5, 7, 8, 10–13, 16–18, 26, and 27)67,83,84,85,86,87. Thus, it is suggested that limonoid-type flavonoids (6, 8–12, 14, 15, and 19), tirucalane-type (22), and glycolipids (17, 18, 20, 21, and 23) are the compounds that determine the antiviral activity of the ethyl acetate fraction of A. indica. In M. azedarach, limonoid-type compounds (7, 8, 10–13, 16, and 17) determine the antiviral activity of the ethyl acetate fraction.

In addition, the vast majority of phytocompounds with antiviral activity are derived from aqueous and ethanolic extracts23,24,28,54,60,61. The study of pharmacological applications of plant components, such as alkaloids, flavonoids, and terpenoids, is fundamental in researching efficient antivirals. Moreover, flavonoids are bioactive substances with antiviral activity in isolated preparations or distinct vegetable extracts55,77,88,89. These phytocompounds may act in the inhibition of proteases and enzymes, such as reverse transcriptase55,89, which is responsible for catalyzing the reverse transcription of viral RNA (ribonucleic acid) in dsDNA (double-stranded deoxyribonucleic acid) molecules that may be integrated into the host cell genome90.

Although they are found in all polarities, some authors have identified and reported that they are common for secondary metabolites (flavonoids, triterpenoids, etc.)91,92. This fact corroborates the present study, in which treatment with the ethyl acetate fraction of both plants resulted in a reduction in cytopathic effects and a reduction in the viral titer of the CAEVCO strain, indicating a potential antiviral effect.

Among the 300 chemically active compounds isolated from A. indica79, most belong to the flavonoid class, as Meliaceae is one of the few species that produces them in such abundance93, which are attributed to its vast biological and physiological activities79,94. One of the main flavonoids evidenced in phytochemical analyses in A. indica is quercetin, which is often found in extracts from this plant. and which in general, quercetin is involved in the mechanism of action of the most distinct pharmacological properties92,93,94,95,96, including antiviral97, against hepatitis C virus98, herpesvirus99, H1N1100, and coronavirus101. Quercetin has promising antiviral effects via inhibition of proteases, suppression of protein receptors on the viral capsid, and blockade of reverse transcriptase102,103,104. It is noteworthy that SRLV requires reverse transcriptase to transcribe viral RNA into proviral DNA, which is integrated into the host cell genome via an integrase enzyme, a primordial step throughout the viral replication cycle90. Thus, the bioactive compound that acts in this process may play a valuable role in combating these viral agents.

In addition to flavonoids, triterpenoids were also present in the fractions of both Meliaceae species. In the case of M. azedarach, the triterpenoids had a greater number of representatives than the flavonoid classes in the fraction that had the best antiviral activity against SRLV. These phytoconstituents, such as quercetin, are the targets of investigation in the search for bioactive components with the most distinct pharmacological properties105. There are reports of antiviral activity attributed to triterpenoids present in vegetables against the dengue virus50,106, enterovirus 71107, coronavirus108, HIV, H1N1, H5N1 and HSV109. The mechanism by which triterpenoids exert their antiviral action mainly involves blocking the enzymes involved in the replicative process109.

Studies involving antiretroviral therapy have focused mostly on the development of novel formulations or combinations of drugs. However, HIV-1 and SRLVs infections are incurable with current therapies. Therefore, new drug approaches are needed110, which makes research on phytocompounds crucial for the development of effective therapeutics. Furthermore, the biodiversity of Brazilian flora offers a great opportunity for research on the use of plant compounds, including those with antiviral potential that may be used in human and veterinary medicine in alternative or complementary manners111.

In conclusion, the ethanolic fraction of ethyl acetate from both Meliaceae species showed better efficacy against CLV in colostrum and milk. Despite the lack of complete elimination of CLV, these natural products are interesting alternatives for the treatment of retroviral infections, and further studies are necessary for technical validation.

Material and methods

Bioethical aspects

This project was submitted and approved by the Ethics Committee for the Use of Animals (CEUA) of Embrapa Goats and Sheep (protocol number 002/2018), following the guidelines of the National Council for Control of Animal Experimentation (CONCEA, law 11794 of October 8, 2008) and subsequent normative resolutions. The steps of this study are illustrated in Fig. 8.

Figure 8
figure 8

Illustration of the experimental design adopted in the evaluation antiviral in vitro activity ethanolic extracts of Azadirachta indica and Melia azedarach against the caprine lentivirus in colostrum and milk. OTE: ovine third eyelid; SRLV: Small Ruminant Lentiviruses; WB: Western Blot; nPCR: nested-Polymerase Chain Reaction; CAEVCO: standard viral strain; C-: Negative Control; C + T: Positive Control of Treatments; C+: Positive Control.

Full size image

Collection and processing of Azadirachta indica and Melia azedarach ethanolic extracts

A. indica and M. azedarach leaves were collected from the Ceará and Piauí states, respectively, in a total volume of 5 kg each. These were then identified in exsiccates with vouchers 18,898 and 18,897, respectively, in Professor Francisco José Abreu de Matos’s herbarium, State University of Acaraú Valley (UVA), Sobral, Brazil.

Following identification, the leaves were separated from the branches and dried at ambient temperature. Then, 2.025 kg of A. indica and 1.26 kg of M. azedarach were submerged in 12 L and 13 L of 96% ethyl alcohol, respectively, and maintained for seven days in sealed recipients. Afterwards, the obtained solutions were subjected to a roto-evaporation process until 80–90% of the solvent was evaporated. The concentrate was maintained in a water bath to evaporate the remaining solvent until a pasty consistency was obtained, which formed the crude ethanolic leaf extracts of both the plants57.

Organic fractions of ethyl acetate and methanol were obtained via preparative vacuum-filtration chromatography. Thus, 25 g of each crude extract was added to 50 g of silica gel (1:2 ratio). Then, using a Buchner funnel, these mixtures were subjected to vacuum filtration and eluted with the organic solvents ethyl acetate and methanol, resulting in the respective fractions. The products were roto-evaporated and subjected to a water bath for complete evaporation of solvents, and the ethyl acetate and methanol fractions from both Meliaceae plants were obtained and stored at 4 °C until use.

Mean lethal concentration toxicity test (LC50)

Cultivation of Artemia salina Leach cysts

Artemia salina Leach cysts were purchased from a specific store that sells products of animal origin. For cyst cultivation, a plastic beaker measuring approximately 2 L was used, containing 1000 mL of distilled, chlorine-free water, and 15 g of sea salt. Then, approximately 2.5 g of sodium bicarbonate was added until the pH stabilized at 8.0. Then, 5 g of A. salina cysts was immersed in this saline solution for hatching; the cysts were kept at a constant temperature of 25 °C, for 48 h, under white light and constant aeration to maintain the O2 levels in the medium29. After this period, the larvae hatched, reached the nauplii stage, and were subjected to test protocol for the average lethal concentration with crude extracts of A. indica and M. Azedarach and their respective fractions of ethyl acetate and methanol.

Concentration toxicity test (LC50)

12-well plates were used for the tests. 2 mL of saline solution with 1% DMSO was added to each plate at concentrations of 100, 500, and 1000 µg/mL of extracts from both plants in the respective fractions. A total of 27 wells (approximately four plates) were used. For the test, treatments were ordered as indicated in Table 5, containing three replicates and n = 10 individuals per well29.

Table 5 Sampling distribution of Artemia salina Leach nauplii in the LC50 test with the crude extracts of Azadirachta indica and Melia azedarach and their respective fractions of ethyl acetate and methanol.
Full size table

After preparing the plates, they were incubated at 25 °C for 24 h under white light. After this period, the number of live and dead nauplii in each treatment group was counted. Subsequently, the data were analyzed to determine the toxicity and percentage of mortality of 50% of the larvae (50) using the probit analysis method using IBM SPSS 21 software.

MTT (3-4,5-dimethyl-thiazol-2-yl-2,5-diphenyltetrazolium bromide) test for cell viability

The MTT assay was based on the methodology described by Dias et al.43 A cell suspension was prepared at a concentration of 2.0 × 105 cells/mL in 12 96-well plates. The samples were then incubated in a CO2 oven for 24 h. Afterward, the wells were washed with 200 µl sterile PBS-1X at 37 °C. Then, the crude ethanolic extract (CEE), ethyl acetate fraction (EAF), and methanol fraction (MF) of A. indica and M. azedarach were added at concentrations of 10, 100 and 1000 µg/mL, and 6 repetitions, respectively. The plates were then kept in a CO2 oven for 24, 48, or 72 h. After each period, the wells were washed with 200 µl of buffer sodium phosphate (BSP) of each concentration, and 100 µl of the MTT solution (0.5 mg/mL) was added. They were then placed in a CO2 environment for four hours. Subsequently, the MTT solution was removed from the plates, and 100 µL of DMSO was added to each well, and each plate was shaken for 5 min. The absorbance at 570 nm was measured using a spectrophotometer.

Statistical analysis of absorbance was performed using mixed Repeated Measures Analysis of Variance, with the assumption of normality verified using the Shapiro–Wilk test and the assumption of sphericity of the variance–covariance matrix verified using the sphericity test of Mauchy. To verify the interaction between groups, time, and concentrations, we performed multiple comparisons of pairs of means with Bonferroni correction, as described by Marôco112, with a significance level of 5%. Statistical tests were performed using the IBM SPSS 21 software.

Colostrum and milk samples

The experiment was performed using animals from the dairy flock of Embrapa Goats and Sheep in Sobral City, Ceará, Brazil. Approximately 100 mL of colostrum was collected from sterile recipients of eight goat nannies that recently gave birth and were positive for SRLV via nested polymerase chain reaction (nPCR)113. The first round of nPCR was performed, followed by a second round to amplify a final fragment of 185 base pairs (bp) of proviral DNA, which corresponds to the SRLV gag gene.

All oligonucleotide primers (gag1 CAAGCAGCAGGAGGGAGAAGCTG, gag2 TCCTACCCCCATAATTTGATCCAC, gag3 GTTCCAGCAACTGCAA ACAGTAGCAATG, and gag4 ACCTTTCTGCTTCTTCATTTAATTTCCC) were produced based on the standard CAEV-Co sequence (M33677.1)114.

In addition to the tested samples and for each round of amplification, a negative control (without DNA) and a positive control referring to CAEVCO.

The nPCR reactions were performed in a thermocycler (BIO-RAD, T100TM Thermal Cycler) in a total volume of 50 μL, containing buffer (10 mM tris–HCl, 50 mM KCl and 1.5 mM MgCl2—Sigma-Aldrich®, USA), 100 μM of each deoxynucleotide triphosphate (dNTP; Sigma-Aldrich®, USA), 20 pmol of each primer, 2U of Taq Platinum DNA polymerase (Thermo Fisher®, USA); 3 μL of sample in the first round and 1 μL of first round product in the second round. Amplification by nPCR was performed at 94 °C for five minutes, 35 cycles of 94 °C for one minute, 56 °C for one minute and 72 °C for 45 s; and a final extension at 72 °C for seven minutes. The amplified samples and controls (positive and negative) were subjected to electrophoresis in 2% agarose gel (Sigma-Aldrich®, USA), stained with ethidium bromide (Sigma-Aldrich®, USA), and visualized using an ultraviolet transilluminator (UVP, Benchtop UV Transiluminator M-26)115.

The samples were combined in a pool. This solution was reinfected with 450 µL of the standard CLV strain (CAEVCO, kindly provided by the Federal Rural University of Pernambuco (UFRPE) and derived from the Laboratoire Associé de Recherches sur les Petits Ruminants–INRA–ENVL, France) with an initial titer of 104.8 TCID50/mL for 60 min at 37 °C under agitation. The same methodology was followed for the goat milk samples.

Treatment of colostrum and milk samples

Crude ethanolic leaf extracts from A. indica and M. azedarach and ethyl acetate, and methanol fractions were diluted in dimethyl sulfoxide (DMSO) at 0.5%. Then, these solutions were added to colostrum/milk samples in the concentration of 150 µg/mL for 30, 60 and 90 min, individually. In addition, control treatments for colostrum and milk (no extract addition) were prepared. The samples were centrifugated at 3000g for 15 min at 4 °C. Somatic cells from colostrum/milk (SCC/SCM) were obtained with the methodology described by Karanikolaou et al.116 and submitted to co-culture with OTE cells.

Co-culture with third eyelid (OTE) cells

For the co-culture, 12 24-well plates were prepared 72 h before the beginning of this step with the addition of OTE41 cells at a concentration of 2.5 × 105 cells/mL. After confluence of approximately 80% OTE cells, SCC/SMC were distributed in plates at the same concentrations with four repetitions. In the wells, 500 µL of minimum essential medium (MEM) was added along with 2% amphotericin B, 3% penicillin and streptomycin, 1% gentamycin, and 5% fetal calf serum (FCS). Per plate, eight control wells were divided in a part with only OTE cells, negative control wells (C−), and the other half with positive controls (C+P) composed of OTE cells infected with the CLV standard strain. The plates were then incubated in a 5% CO2 environment at 37 °C. Media were replaced at seven-days intervals and cellular trypsinization was performed every 21 days. After 63 days of culture, the cell supernatant was collected and the wells were stained with crystal violet (0.1%) for visualization of viral cytopathic effects19.

Titration of samples with antiviral activity

After visualization of viral cytopathic effects, samples with the best antiviral results in colostrum and milk were subjected to viral titrations117.

For this procedure, supernatants from the last collection of OTE + SCC/SCM co-culture cells were titrated in a microplate via decimal dilutions in minimum essential means (MEM) without fetal bovine serum (SFB) in four repetitions per dilution. For every 50 µL of viral dilution, 50 µL of OTE cell suspension at a concentration of 2.5 × 105 cells/mL was added. Positive (OTE cells, MEM, and CLV with known titers) and negative (OTE cells and MEM) control wells were prepared. Microplates were incubated at 37 °C with 5% CO2 for 14 days with daily observations for typical cytopathic effects (CPE) and stained with 0.1% crystal violet. The titer was calculated according to the method described by Reed and Muench117. It was defined as the reciprocal of the highest dilution that was present 14 days after inoculation and syncytia in 50% of the inoculated wells117.

Somatic cell count (SCC) of colostrum and milk samples

The colostrum and milk were in direct contact with the extracts of A. indica and M. azedarach for a maximum period of 90 min, after which the somatic cells contained in this material were obtained and used in the co-culture. Thus, for a detailed analysis, the somatic cell count (SCC) was performed according to the methodology recommended by Zeng et al.118.

To perform this test, approximately 100 mL of colostrum from eight goats (the same goats as in the initial experiment) was collected, and a pool of this material was formed, which was divided into 16 aliquots of 15 mL each. Colostrum samples were treated with 150 µg/mL crude extract from each plant and two respective fractions. Milk treatment was performed 30 days following the same methodology.

A clean and degreased histological slide was used for each colostrum and milk sample. Four smears of 1.0 cm2 were made on each slide, containing 0.01 mL of the samples. The slides were dried at room temperature and fixed using a Bunsen burner flame. Subsequently, the slides were immersed in xylene for three minutes, drained, and dried. The cells were then stained for six minutes with MGP (pyronine Y-methyl green; Sigma-Aldrich). For the reading, 50 fields of two smears from each slide were analyzed under an optical microscope in a 100× objective with the aid of immersion oil. The result was calculated by calculating the mean of the results obtained multiplied by the microscope's work factor, which is expressed as the number of somatic cells per mL of colostrum/milk (SC/mL), comparing the means of the treatments with the controls, using the Tukey test (ANOVA—BioEstat Software 5.3).

Phytochemical testing of Azadirachta indica and Melia azedarach extracts by UPLC-HRMS (ultra-performance liquid chromatography coupled to high resolution mass spectrometry)

The extracts and their fractions were analyzed by UPLC-HRMS using a method previously described by Carvalho et al.119, with modifications. Prior to analysis, the samples were cleaned up through Supel-clean SPE-C18 cartridges (500 mg, Supelco, St. Louis, MO, USA) and posteriorly filtered with 0.22 μm PTFE syringe filters (Simplepure, Plano, TX, USA). Chromatographic separations were performed on an Acquity/Xevo UPLC-ESI-qTOF system (Waters Co., Milford, MA, USA), equipped with an Acquity UPLC BEH C18 column (Waters, 150.0 × 2.1 mm × 1.7 μm) at 40 °C. The mobile phase was composed of water and acetonitrile, both containing 0.1% formic acid, ranging from 2 to 95% acetonitrile for 22 min at a flow of 0.22 mL/min. The samples were filtered and injected into aliquots of 5.0 μL. The mass accuracy and reproducibility were maintained by infusing a 0.2 ng/µL leucine–enkephalin solution ([M−H]− ion at m/z 556.2771) through LockSpray (Waters Corporation™) at a flow rate of 20 µL/min. MS data were recorded for m/z values in the range 110–1180 Da in both ionization modes. The compounds were tentatively characterized using the molecular formula provided by MassLynx 4.1 software on their accurate masses (error < 5 ppm), isotopic patterns (i-fit), and MS fragmentation patterns, as well as a literature survey of previous occurrences in the species studied and/or the Meliaceae family using the Scifinder Scholar database. Additionally, compounds were identified by comparison with reference standards when available.