Runx1-Stat3-Tgfb3 signaling network regulating the anterior palatal development

Sarper, Safiye E.; Kurosaka, Hiroshi; Inubushi, Toshihiro; Ono Minagi, Hitomi; Kuremoto, Koh-ichi; Sakai, Takayoshi; Taniuchi, Ichiro; Yamashiro, Takashi

doi:10.1038/s41598-018-29681-3

Download PDF

Article
Open access
Published: 25 July 2018

Runx1-Stat3-Tgfb3 signaling network regulating the anterior palatal development

Safiye E. Sarper¹,
Hiroshi Kurosaka¹,
Toshihiro Inubushi¹,
Hitomi Ono Minagi²,
Koh-ichi Kuremoto ORCID: orcid.org/0000-0002-2265-4182³,
Takayoshi Sakai²,
Ichiro Taniuchi⁴ &
…
Takashi Yamashiro ORCID: orcid.org/0000-0002-4419-9643¹

Scientific Reports volume 8, Article number: 11208 (2018) Cite this article

2395 Accesses
10 Citations
1 Altmetric
Metrics details

Subjects

Abstract

Runx1 deficiency results in an anteriorly specific cleft palate at the boundary between the primary and secondary palates and in the first rugae area of the secondary palate in mice. However, the cellular and molecular pathogenesis underlying such regional specificity remain unknown. In this study, Runx1 epithelial-specific deletion led to the failed disintegration of the contacting palatal epithelium and markedly downregulated Tgfb3 expression in the primary palate and nasal septum. In culture, TGFB3 protein rescued the clefting of the mutant. Furthermore, Stat3 phosphorylation was disturbed in the corresponding cleft regions in Runx1 mutants. The Stat3 function was manifested by palatal fusion defects in culture following Stat3 inhibitor treatment with significant downregulation of Tgfb3. Tgfb3 is therefore a critical target of Runx1 signaling, and this signaling axis could be mediated by Stat3 activation. Interestingly, the expression of Socs3, an inhibitor of Stat3, was specific in the primary palate and upregulated by Runx1 deficiency. Thus, the involvement of Socs3 in Runx1-Tgfb3 signaling might explain, at least in part, the anteriorly specific downregulation of Tgfb3 expression and Stat3 activity in Runx1 mutants. This is the first study to show that the novel Runx1-Stat3-Tgfb3 axis is essential in anterior palatogenesis.

Synergistic roles of Wnt modulators R-spondin2 and R-spondin3 in craniofacial morphogenesis and dental development

Article Open access 12 March 2021

TBX1 targets the miR-200–ZEB2 axis to induce epithelial differentiation and inhibit stem cell properties

Article Open access 23 November 2022

Znf703 is a novel RA target in the neural plate border

Article Open access 04 June 2019

Introduction

Cleft palate (CP) represents one of the major congenital craniofacial birth defects^1,2. This condition demonstrates anatomical impairments with various combinations of the defects involving the soft and hard palates, the nasal septum and the alveolar ridge. Palatogenesis requires several developmental steps involving palatal shelf growth and elevation, as well as fusion of the palatal shelves. The palatal fusion begins at the midline of the future secondary palate following bilateral outgrowth of the maxillary process. Thereafter, the anterior secondary palate fuses to the primary palate and the dorsal portions of the secondary palate fuse with the nasal septum. Following contact, the intervening epithelium between the abutted shelves merges to form the epithelium seam that must be removed to provide mesenchymal continuity throughout the fused palate^3,4. Fusion is crucial for the correct formation of the palate, and its defect can lead to CP. Although recent studies using genetically modified mice and human genetics studies have identified numerous genetic and environmental etiology for cleft palate, the etiology that explains the diversity in morphology in cleft palate has remained largely unknown.

We previously demonstrated that Runx1 participates in the pathogenesis of cleft palate using Runx1-null mutants carrying a Gata1 promoter-driven Runx1 transgene (Gata1-Runx1/Runx1^−/−)⁵. Runx1 is a member of the Runx family of genes that encode transcription factors that play various important roles in embryogenesis⁶ and is a key molecule of hematopoiesis-causative genes in the development of leukemia and other hematopoietic disorders^7,8. Runx1 is also involved in cancer development^9,10. Indeed, families with children diagnosed with acute lymphoblastic leukemia reported a family history of clefts more often than control families¹¹, and adult individuals who survived cancer reported a family history of cleft palate more often than controls¹². Microdeletion encompassing RUNX1 causes Braddock–Carey syndrome, which is characterized by distinct patterns of anomalies, including thrombocytopenia and cleft palate¹³.

Although Runx1 is expressed in the fusing epithelium of the developing palatal shelf throughout the AP axis, it is of interest that Runx1 mutants develop a localized anterior palatal clefting due to failed fusion between the primary and secondary palates and at the anterior-most part of the secondary palate corresponding to the 1st rugae⁵. This finding indicates that Runx1 is involved in a different regulatory mechanism for the palatal fusion along the anterior-posterior (AP) axis. Several studies have also revealed such different regulatory mechanism of palatogenesis along the AP axis of the palate^14,15. Some transcription factors and signaling molecules, such as Msx1, Bmp4, Shh, Fgf10, Fgf7, and Shox2 are recognized as anterior-specific^14,15. Spatial distribution of such genes within the palate, together with the palatal phenotypes in their null mutant, clearly highlights the importance of regionally specific regulatory mechanism at the molecular level. However, the majority of experiments have focused on the palatal fusion of the secondary palate, and there is less understanding of the mechanisms in the anterior region between the primary and secondary palate and in the first rugae area of the second palate. Indeed, how Runx1 is involved in anterior-specific clefting has not been investigated.

In mouse skin cancer formation and maintenance, signal transducer and activator of transcription 3 (Stat3) is activated by Runx1 signaling as a tumor promoter^16,17. The JAK/STAT pathway is the principal signaling mechanism for a wide array of cytokines and growth factors^18,19. Upon activation, phosphorylated Stats dimerize and translocate to the nucleus, where they modulate the expression of target genes. It has been established that Stat3 is activated in a number of epithelial cancers¹⁹, in immune response, and also in response to various environmental signals²⁰. Heterozygous loss-of-function mutations in STAT3 lead to the primary immune deficiency Hyper-IgE syndrome and interestingly the cleft palate is observed in this syndrome²¹. However, little is known about the possible mechanisms underlying involvement of Stat3 in the pathogenesis of the cleft palate.

Runx1 deficiency results in an anteriorly specific cleft palate at the boundary between the primary and secondary palates and in the first rugae area of the secondary palate in mice⁵. However, the cellular and molecular pathogenesis underlying such regional specific cleft palate remain unknown. In this study, using epithelial-specific Runx1 deletion mice, we demonstrate that Tgfb3 is an essential target of Runx1 signaling in anterior-specific disintegration of the fusing palatal epithelium and that the site-specific downregulation of Stat3 phosphorylation plays a central role in downregulating the Tgfb3 expression and manifesting palatal clefting upon Runx1 loss. We also show that the pharmaceutical inhibition of Stat3 signaling disturbs the expression of Tgfb3 as well as of Runx1, leading to failure of palatal fusion. In addition, we show that the involvement of Socs3 in Runx1-Tgfb3 signaling explain, at least in part, the anteriorly specific downregulation of Tgfb3 expression and decreased Stat3 activity in Runx1 mutants. Together, we demonstrate that Stat3-mediating Runx1-Tgfb3 axis is a novel regulatory pathway that regulates the palatal fusion in the anterior regions.

Results

Palatal phenotypes in Runx1 mutants

We previously reported that Gata1-Runx1/Runx1^−/− mice exhibit anterior clefting between the primary and secondary palates and in the first rugae region of the secondary palate and that Runx1 is specifically expressed in the fusing epithelium, but the mechanisms underlying this phenotype remained largely unknown⁵. Since Gata1-Runx1/Runx1^−/− mice died within a few hours after birth, it was possible that the cleft palate phenotype was simply a consequence of delayed development. To extend the finding and examine how Runx1 regulates the anterior-specific palatal fusion in detail, we used epithelial-specific Runx1 deletion mice (K14-Cre/Runx1^fl/fl).

We also confirmed the efficiency of K14-Cre recombination using Rosa26R reporter mice at E15.0. β-gal staining was performed in the K14-Cre;R26R mice, and we confirmed that Cre recombination had been successfully performed in embryonic mouse in anterior palatogenesis. β-gal-positive cells were intense at the epithelium overlying the palatal process of the secondary palate and the primary palate (Fig. S1). The positive cells were evident in the contacting (B–E) and fused epithelium (F–H); however, no positive cells were detected in the mesenchyme underlying the palatal epithelium (Fig. S1).

As presumed, the present K14-Cre/Runx1^fl/fl mice demonstrated an anterior cleft that was similar to that of previous Gata1-Runx1/Runx1^−/− mice and survived after birth. An anterior cleft palate was confirmed in the mutants at P50 (Figs 1A,B and S2), clearly indicating that anterior cleft is not due to delayed development of the palate. This palatal phenotype was evident at P0 in more than 90% of the mutants (Fig. 1C,D,G). The palatal phenotype was not evident at E15.0 by direct observation (Fig. 1E,F).

Histological analyses revealed that there was a cleft between the primary and secondary palate and in the first rugae area the secondary palate in Runx1 mutants at E17.0 (Fig. 1I–L). In the more posterior regions, the fused palate in Runx1 mutants did not make contact with the nasal septum, even though the septal cartilage was almost normal in size (Fig. 1K,L). Palatal phenotypes were not evident more posteriorly than the point of the 2nd rugae (Fig. 1M,N). Although we used different genetically modified mice to study the function of Runx1 in palatogenesis in this study, the current histological findings are similar to the previous ones⁵. These findings confirmed that Runx1 is essential in anterior-specific palatogenesis.

Characterization of the fusing epithelium of Runx1 mutants

Like the medial edge epithelium (MEE) that is localized at the junction between the secondary palates, the epithelial remnants appeared at the junction between the primary and the secondary palate at the anterior part of the palate (arrowheads in Fig. 2A). In Runx1 mutant samples, immunostaining for K14 revealed that 75% of the mutants (15/20) at E15.0 had partial contact between the primary and secondary palate, and that thick K14-immunoreactive epithelial remnants (arrowhead in Fig. 2B) were detected at the interface. In contrast, 25% of the mutants (5/20) showed no contact between the nasal septum and the secondary palate and epithelial remnants were not formed at E15.0 (Fig. 2C). It has been established that, during epithelial fusion, the MEE ceases proliferation and undergoes apoptosis^22,23, and the periderm overlying the fusing epithelium is removed²⁴. Thereafter, the epithelial remnants need to degrade to achieve mesenchymal confluence²⁵.

In this study, we first performed in vivo characterization of these anterior epithelial remnants. TUNEL staining revealed evident apoptosis in controls (Fig. 2D), whereas there were far fewer TUNEL-positive cells on the unfused epithelium of the Runx1 mutants in the corresponding regions (Fig. 2E,H). In more posterior regions, the appearance of TUNEL-positive cells was not affected by Runx1 deficiency (Fig. 2F,G).

The proliferative activity in the palatal epithelium of the Runx1 mutant was also evaluated using Ki67 staining. In Runx1 mutants, the thick epithelial remnants formed at the interface without any mesenchymal confluence due to partial contact between the nasal septum and the secondary palate. Double-staining for Ki67 and K14 showed that Ki67-immunoreactive proliferating cells were retained in these epithelial remnants in Runx1 mutant, whereas Ki67-immunoreactive proliferating cells were less present at the fused epithelium in wild-types (Fig. 2I–K). Prior to fusion between the primary and the secondary palate at E14.5, Ki67-immunoreactive proliferating epithelium was sparsely present in the contacting palatal epithelium both in the control and the Runx1 mutant mice (Fig. S3A,B). Significant difference was not detected in the percentage of Ki67 positive cells between the control and the mutants (Fig. S3C).

During palatogenesis of the secondary palate, the periderm transiently forms a single flattened layer against premature adhesion of the fusing epithelium overlying the palatal shelf and is sloughed from the palatal surface in order to facilitate adherence and form a palatal seam²⁴. In wild-type mice at E15.0, immunoreactivity to Keratin 17(K17), a marker of the periderm²⁶, was sparsely detected in the epithelial remnants in the 2nd rugae area (Fig. 2L). In contrast, in Runx1 mutants, K17-immunoreactive periderm cells were retained on the surface of the nasal septum, the primary palate and the the secondary palate (Fig. 2M). In the more anterior region corresponding to the 1st rugae, the unfused palatal process of the Runx1 mutants was covered with K17-immunoreactive periderm, whereas K17-immunoreactive periderm was degraded in the control (Fig. S3D,E). Prior to fusion between the primary and the secondary palate at E14.5, K17-immunoreactive periderm covered the whole epithelial surface of the contacting palatal process both in the control and the Runx1 mutants (Fig. S3D,E) These findings indicated that the periderm was not adequately removed in the primary palate and in the anterior-most region of the secondary palate, which is the corresponding to cleft regions in Runx1 mutants.

At E17.0, although the nasal septal cartilage was normal in size in Runx1 mutants, a mesenchymal defect was not evident at the tissue overlying the vomeronasal organ (vo) (Fig. 1L). Therefore, insufficient growth of the nasal septum tissue may not have contributed to the cleft phenotypes.

BrdU staining revealed that there were no marked changes in the BrdU signals in the palatal mesenchyme due to Runx1 deficiency at E15.0 (Fig. 2N,O). We also evaluated the vertical distance between the vomeronasal organ(vo) and the lower most surface of the primary palate and found that no significant differences were detected between the control and the Runx1 mutants (Fig. S4). It is therefore likely that the tissue defect observed at E17.0 was due to the secondary effect of contact failure between the secondary palate and the nasal septum, and not to growth failure of the nasal septum.

Taken together, these findings show that Runx1 deficiency resulted in failure in the disintegration of the epithelial remnants of the anterior palate with retained proliferative activity, suppressed apoptosis, and inadequate periderm removal specifically at the junction between the primary and the secondary palates and at the anterior-most part of the secondary palate. These are novel findings indicating that Runx1 is involved in the disintegration of the fusing epithelium in morphogenesis.

Downstream target of Runx1 signaling

We further investigated the target molecules that may explain the cleft in Runx1 mutants. The previous study demonstrated that Runx1 is expressed in the fusing epithelium^5,27. A whole-mount in situ hybridization analysis at E12.0, E13.0, E14.0 and E15.0 demonstrated that Runx1 transcripts were detected at the primary palate from E13.0 and that Runx1 was not specific to the anterior regions of the palate but widely expressed in the AP axis (Fig. 3A–D). In the primary palate regions, Runx1 transcripts were abundant in the triangle regions delimited between the bilateral incisive foramen in the primary palate (arrowhead in Fig. 3D). The Runx1 expression in the primary palate and nasal septum was evident from E13.0 (arrows in Fig. 3B,C). Runx1 transcripts were also specifically evident at the fusing surface of the secondary palate (Fig. 3D).

We next evaluated the possible downstream target molecules of Runx1 signaling in anterior palatogenesis. Anterior clefting is a rare phenotype in genetically manipulated mice, and several transcription factors and signaling molecules are recognized as anterior-specific^14,15,28,29. Shox2 is a homeobox gene expressed specifically in the anterior palate, and Shox2 null mutant mice exhibit an anterior cleft palate³⁰. Msx1 is also an anterior-specific homeobox gene. Loss of Msx1 expression leads to a complete cleft palate, and overexpression of BMP4 rescues this palatal phenotype. In this network, Msx1 regulates Bmp4 expression in the anterior mesenchyme, which subsequently induces Shh expression in the palatal epithelium³¹. The present whole-mount in situ hybridization revealed that the expression pattern of Shox2, Msx2, Bmp4 or Shh did not deviate in Runx1 mutants (Fig. 3E–L), indicating that Runx1 signaling is independent of the previously identified Msx1-Bmp4 and Shox2 signaling axes in anterior palatogenesis.

Among several signaling molecules, we found that Tgfb3 was significantly decreased in Runx1 mutants (Fig. 3M–P). Coinciding with anteriorly-specific palatal clefting in Runx1 mutants, whole-mount in situ hybridization clearly demonstrated that downregulation of Tgfb3 expression was specifically observed in the primary palate regions of Runx1 mutants (arrowhead in Fig. 3N), while Tgfb3 expression did not deviate in the secondary palate (Fig. 3M,N). A qPCR analysis of microdissected tissue confirmed such significant and spatially-specific downregulation in Tgfb3 expression in the primary palate (Fig. 3S).

Whole-mount in situ hybridization also revealed that Mmp13 was remarkably downregulated in the primary palate of Runx1 mutants. Reduction was also evident at the anterior portion of the secondary palate anterior to the 2nd rugae (Fig. 3Q,R). A qPCR analysis also confirmed it (Fig. 3T).

Mmp13 is a downstream target of Tgfb3 during mammalian palatogenesis³², and spatial downregulation of Mmp13 almost coincided with the spatial downregulation of Tgfb3 at the primary palate. Whole-mount in situ hybridization analyses demonstrated that the distribution of Mmp13 expression in the wild-types palate almost coincided with that of Runx1 (Fig. 3D,Q).

Furthermore, as stated before, our Runx1 mutants exhibited impaired removal of the periderm, which is similar to the epithelial phenotypes in Tgfb3 null mutants^33,34. Taken together, these findings indicated that Runx1 deficiency results in the downregulation of Tgfb3 expression specifically in the primary palate, and this Runx1-Tgfb3 signaling axis is a novel regulatory pathway that is independent of the Shh, Shox2 and Msx1-Bmp4 pathways.

To further confirm the significance of the downregulation of Tgfb3 signaling in Runx1 mutants, we investigated whether or not treatment with TGFB3 beads can rescue the palatal clefting of Runx1 mutants. TGFB3 protein beads or BSA-containing beads as controls were placed at the primary palate. After 48 h, the TGFB3 beads did indeed rescue the cleft palate formation (Fig. 4A,B). A histological analysis confirmed that the epithelial remnants between the primary and secondary palates and at the anterior-most part of the secondary palate were almost removed in order to allow for mesenchymal continuity (Fig. 4C,D). The success rate of rescuing the cleft palate was 75% (Fig. 4E). A qPCR analysis of microdissected tissue demonstrated that the TGFB3 beads induced Mmp13 expression without upregulation of the Tgfb3 mRNA expression (Fig. 4F,G). These TGFB3 rescue studies therefore confirmed that Tgfb3 is an essential and critical target molecule in Runx1 signaling in the anterior palatal fusion.

Bidirectional Runx1-Tgfb3 signaling in the palate

We also evaluated whether or not Tgfb3 induces Runx1 expression in the reverse direction in the palatal tissues. We found that TGFB3 protein beads induced ectopic Runx1 expression in the palates in culture (Fig. 4H–K), indicating that Runx1-Tgfb3 signaling is reciprocally regulated.

Stat3 activity in the Runx1-Tgfb3 axis

Runx1 acts is a tumor promoter in mouse skin cancer formation and maintenance by promoting Stat3 activation^16,17 and Tgfb3 expression is often upregulated in cancer formation³⁵. We therefore evaluated the Stat3 activity in anterior palatal fusion in Runx1 mutants. Whole-mount in situ hybridization analyses for Stat3 mRNA demonstrated that the Stat3 expression is particularly intense in the fusing palate; however, the Stat3 mRNA expression was not anterior-specific (Fig. 5A,B). Stat3 activity was evaluated based on the state of phosphorylation using immunohistochemistry, and we performed immunohistochemical analyses for phosphorylated-Stat3 (pStat3) and Stat3.

Stat3 immunoreactivity was evident in the palatal epithelium, and some signals were detected in the mesenchyme (Fig. 5C); the distribution of Stat3 immunoreactivity did not deviate in Runx1 mutant palate (Fig. 5D). In contrast, pStat3 immunoreactivity was evident in the fusing or fused epithelium of the wild-type palates (Fig. 5E). Notably, in Runx1 mutant palate, immunoreactivity to pStat3 was significantly downregulated at the boundary between the primary and secondary palate and at the first rugae area of the palatal process, which are the corresponding cleft regions in Runx1 mutants (Fig. 5F), whereas the immunoreactivity was unchanged in the secondary palate (Fig. S5).

In this observation of the fusing epithelium, confocal microscopy confirmed that Stat3 immunoreactivity was detectable only in the cytoplasm, whereas pStat3 was detected in the perinuclear region, indicating that phosphorylated Stat proteins translocate into the nucleus (Fig. 5G,H). A western blot analysis also demonstrated that pStat3 was significantly reduced in the Runx1 mutant primary palate, while Stat3 was not affected (Fig. 5I). The scanned full blots are presented in Supplementary Fig. S6.

Socs3 mRNA in Runx1 mutants

Then, in order to understand why pStat3 immunoreactivity was disturbed specifically in the nasal septum and the primary palate regions, we investigate the possible deviation of Socs3 mRNA on Runx1 deficiency. In cytokine signaling pathways, SOCS3 suppress Stat3 phosphorylation via interference with Jak2³⁶. In keratinocytes, Runx1 binds to the SOCS3 promoters to represses their transcription and ultimately upregulates Stat3 activity by enhancing phosphorylation due to Runx1 depletion⁹. Hence, we hypothesized that Runx1 could regulate Stat3 activity specifically in the primary palate and the secondary palate at the at the first rugae regions through modulation of phosphorylation of Stat3 by downregulation of Socs3.

The present whole mount in situ hybridization demonstrated that Socs3 mRNA expression was specifically localized on the surface of the nasal septum and the primary palate at E14.0 (Fig. 5J). The Intensity and the area of Socs3 expression became further increased by Runx1 deficiency (Fig. 5K). qPCR analysis of these regions confirmed that Socs3 mRNA expression was significantly increased in the Runx1 mutant (Fig. 5L). Strikingly, the spatial distribution of Socs3 mRNA expression in Runx1 mutants almost overlapped with the regions where the Tgfb3 expression was remarkably decreased in Runx1 mutants (Fig. 5M,N). Collectively, Runx1 deficiency leads to upregulated expression of Socs3 specifically in the nasal septum and the primary palate, which might inhibit Stat3 activation in a spatially specific manner.

Impairment of palatal fusion by Stat3 inhibitors

Given that spatiotemporal downregulation of Tgfb3 expression overlaps with that of pStat3 immunoreactivity at the anterior palate, we hypothesized that Stat3 activity might directly or indirectly regulate Tgfb3 expression, and concomitant impairment of Tgfb3 induction might lead to the failure of palatal fusion. To evaluate the functional roles of Stat3 signaling, AG490, a selective Jak2/Stat3 inhibitor that prevents Stat3 phosphorylation, and S3I-201, a direct Stat3 inhibitor that blocks Stat3 dimerization and DNA-binding³⁷, was applied in explanted palate at E15.0 for 48 h^38,39.

A Western blot analysis confirmed that application of Stat3 inhibitors of Ag490 or S3I-201 almost suppressed immunoreactivity to pStat3, while Stat3 immunoreactivity was not affected (Fig. 6A). The scanned full blots are presented in Supplementary Fig. S7. In our in vitro culture system, the explanted palate fused by 100% in control mice (Fig. 6B,C). AG490 treated palate exhibited failure in fusion at both 200 and 400 µM by 100% (Fig. 6B,E,F). S3I-201 also impaired palatal fusion at 200 and 400 µM by almost 100% (Fig. 6B,G,H).

To further clarify the present hypothesis, a qPCR analysis of the microdissected primary palate revealed that the expression of Tgfb3, Mmp13 and Runx1 was reduced significantly in a dose-dependent manner when pStat3 inhibitors were applied (Fig. 6I,J,K), whereas Socs3 expression was upregulated in a dose-dependent manner (Fig. 6L). S3I-201 also downregulated Tgfb3, Mmp13 and Runx and upregulated Socs3 significantly (Fig. 6M–Q).

These findings confirmed that the modification of Stat3 activity was able to influence the expression of Tgfb3 directly or indirectly and subsequently regulate the anterior palatal fusion in culture.

Discussion

Runx1 deficiency results in anterior cleft palate between the primary and secondary palate and at the anterior-most region of the secondary palate. Using conditional Runx1 null mutant mice, we showed that Tgfb3 is a critical downstream target in this pathogenesis and that the Runx1-Tgfb3 signaling axis is reciprocal and specific in the anterior regions of palatogenesis. In this process, we demonstrated that Stat3 mediates this Runx1-Tgfb3 signaling axis and that Runx1 deficiency upregulates the expression of Socs3, an inhibitor of Stat3 signaling and specifically expressed in the primary palate regions. We further demonstrated that the pharmaceutical modification of Stat3 affects Runx1-Tgfb3 signaling and the palatal fusion in vitro.

In the present study, we found that Tgfb3 is a critical downstream target in Runx1 mutants with anterior clefting and that the expression of Shh, Shox2, Msx1, or Bmp4, which are anterior-specific genes in palatogenesis¹⁴, was not affected in these mutants. Runx1 deficiency resulted in marked downregulation of Tgfb3 in the epithelium in the primary palate and the nasal septum; however, the expression of Tgfb3 in the secondary palate was not affected. Tgfb3 has been established as a critical molecule that regulates epithelial fusion, and null mutant mice display a complete cleft palate⁴⁰. In agreement with the animal phenotypes in Tgfb3 null mutant mice, the case-parent triad study demonstrated that TGFB3 variant was a potential genetic risk factor for increasing risk of non-syndromic CP⁴¹. However, when Tgfb3³³ or its receptor^34,42 is deleted under K14 epithelial promoter, clefting appears only in the anterior regions. In accordance with these previous findings in Tgfb3 mutants, the cellular phenotypes in the present Runx1 mutants resembled those of Tgfb3 null mutants with sustained proliferation, disturbed apoptosis, and a retained periderm. Furthermore, TGFB3 rescued the cleft phenotypes among Runx1 mutants in culture. Taken together, our findings indicated that Tgfb3 is a critical downstream target of Runx1 signaling specifically in the anterior palatogenesis and that this Runx1-Tgfb3 signaling axis is a novel regulatory pathway that is independent of previously known molecular networks involved in palatogenesis.

Tgfb3 promoter does not contain Runx1 consensus sites within 1 kb of the transcription start site⁴³. Therefore, some molecules mediate the downregulation of Tgfb3 due to Runx1 deficiency. In mammary gland involution, gland epithelium disappears due to lysosomal-mediated cell death⁴⁴, as observed in the fusing palatal epithelium. Such cellular behaviors towards disintegration resemble those of the fusing epithelium of the palate⁵, and Tgfb3 expression is upregulated in the involuting epithelium⁴⁵. During involution, the induction of cell death is correlated with the phosphorylation of Stat3⁴⁴, and the removal of Stat3 resulted in the inhibition of cell death in a similar fashion to that seen in the Tgfb3 null mutant mammary glands⁴⁶, collectively indicating that the upregulation of Tgfb3 expression with activated Stat3 phosphorylation regulates the cell death in mammary gland involution. Furthermore, Runx1 maintained Stat3 activity in the epidermis and in skin cancer cells^16,17. Given these previous findings, we hypothesized that Stat3 might mediate the Runx1-Tgfb3 signaling pathway in palatal fusion.

The involvement of Stat3 in palatogenesis has not been previously investigated. We found that Runx1 deficiency induces the inhibition of phosphorylation of Stat3 specifically in the corresponding cleft regions in the Runx1 mutants, and such inhibition of Stat3 activity almost demonstrated spatiotemporal overlapping with that of Tgfb3 expression. As two different Stat3 inhibitors with different modes of actions impaired the palatal fusion in vitro with remarkable inhibition of Tgfb3 expression in the primary palate, the present findings suggested that Stat3 may be important in palatogenesis as a critical mediator of Runx1-Tgfb3 signaling. Interestingly, TGFB3 protein beads also reciprocally induced pStat3 and ectopic Runx1 mRNA expression. Although whether such regulatory control is direct or indirect remains unclear, the present findings indicated that the Runx1-Stat3-Tgfb3 regulatory pathway orchestrates reciprocal control of genes required for palatal fusion in the anterior regions.

Anterior clefting is a rare palatal phenotype in the genetically modified mice, however, spatial distribution of Runx1 mRNA do not account why the Stat3 activation and Tgfb3 mRNA expression is disturbed only in the primary palate and the nasal septum. In human cancer cells, Runx1 loss impairs tumor initiation and maintenance and the growth of oral, skin, and ovarian epithelial human cancer cells. In a previous study using mouse keratinocytes, chromatin immunoprecipitation followed by quantitative PCR (ChIP-qPCR) analysis demonstrated Runx1 binds to the promoters of Socs3, Stat3 inhibitors, to represses their transcription, and ultimately upregulates Stat3 activity by enhancing phosphorylation⁹. Conversely, Runx1 deficiency results in upregulation of Socs3 expression and Stat3 inactivation. Our whole mount in situ hybridization analyses demonstrated that Socs3 expression was evident specifically in the fusing epithelium of the nasal septum and the primary palate of wild-type and this Socs3 mRNA was further upregulated by Runx1 deficiency. Remarkably, spatial distribution of upregulated Socs3 mRNA overlapped with the regions of downregulated pStat3 immunoreactivity and Tgfb3 mRNA. Hence, involvement of Socs3 on Runx1-Tgfb3 signaling axis could, at least in part, account how Runx1 deficiency leads to spatially-specific downregulation of Stat3 phosphorylation and Tgfb3 mRNA in the primary palate and the nasal septum and at the anterior portion of the secondary palate, and subsequent anterior specific cleft palate.

A striking finding of our study is that the pharmaceutical application of two different types of Stat3 inhibitor disturbed the expression of Runx1 and inhibited Tgfb3 expression, leading to failure in palatal fusion in wild-type mice. Such downregulation of Runx1 by Stat3 inhibitors was also supported by upregulated expression of Socs3, as observed in Runx1 mutants. These findings showed that the Runx1-Tgfb3 signaling axis was affected by extrinsic modification of Stat3. It has been established that Stat3 senses an array of extracellular signals and rapidly responds to them by controlling the target gene expression⁴⁷. Acute alcohol intake suppresses the Stat3 activity through excessive Socs3 activation in human monocytes⁴⁸, and nicotine also induces anti-inflammatory action associated with Stat3 phosphorylation in peritoneal macrophages⁴⁹. Although a previous study did not examine whether or not alcohol intake and/or smoking influence the Stat3 activity in palatal fusion, Stat3 might act as a point of convergence integrating extrinsic environmental input into the genetically defined intrinsic conditions, which might provide a novel understanding of the etiology and pathology of the cleft palate. In the pathogenesis of non-syndromic cleft palate, several genetic susceptibility factors and environmental risk factors have been identified, and a clinically relevant phenotype is identified only when a threshold effect is reached after combining each genetic and environmental susceptibility factor affecting each individual^1,2. Prevention is the ultimate objective with regard to CP. The present findings have identified genetic targets that modify the environmental risk factors, and pharmaceutical modulation of Stat3 signaling may modify the Runx1-Tgfb3 signaling axis, suggesting its utility as a therapeutic procedure for preventing CP in patients with pathologic TGFB3 variant.

One limitation associated with this study is that Stat3 signaling was inhibited by pharmacological Stat3 inhibitors. Given the possibility that Stat3 inhibitors also affect other signaling besides Stat3, we used two different Stat3 inhibitors with different mechanisms of action. In future experiments, we will generate epithelial-specific Stat3 null mutants to directly confirm the function of Stat3. Previous studies using tissue-specific Stat3-deficient mice showed that Stat3 plays a crucial role in a variety of biological functions, including cell growth, anti-apoptosis, apoptosis and cell motility depending on the cell type and stimulus^9,19,47,50. However, the cleft palate phenotype has not been reported using such Stat3 mutant mice. In previous studies using epithelial-specific stat3 deletion mice, Keratin 5 (K5) promoter was used for the epithelial-specific Cre-mediated deletion of the Stat3 gene. K14-Cre is another Cre driver for generating epithelial-specific conditional null mutant mice, and interestingly, Dicer-null mutants driven by K14 and K5 do not exhibit similar appendage phenotypes. Indeed, K14-Dicer mutants exhibit more severe phenotypes at birth than K5-Dicer mutants, possibly due to the earlier onset of the K14-Cre driver⁵¹. Since palatal fusion occurs in the embryonic stages, it is likely that the K14-Cre driver is appropriate for evaluating the possible function of Stat3 in the fusing epithelium. We intend to investigate the palatal phenotypes using K14-Cre driven Stat3 conditional null mice in future experiments.

In conclusion, we found that Runx1 epithelial-specific deletion led to the failed disintegration of the contacting palatal epithelium and that Tgfb3 is a critical downstream target in the pathogenesis of anterior cleft palate in the mutants. This Runx1-Tgfb3 signaling axis is independent of previously known signaling systems and is reciprocally mediated by Stat3. In this process, expression of Socs3, an inhibitor of Stat3 signaling, was upregulated specifically in the primary palate by Runx1 deficiency, which could explain, at least in part, how Runx1 deficiency results in anteriorly specific clefting (Fig. 7A,B). Furthermore, the pharmaceutical application of Stat3 inhibitor disturbs the expression of Runx1 as well as Tgfb3 and leads to failure of palatal fusion in wild-type mice, suggesting that the Runx1-Tgfb3 signaling axis may be affected by extrinsic modification of Stat3 signaling (Fig. 7C). The involvement of Stat3 modification in Runx1-Tgfb3 signaling may offer novel insights into the physiologic and pathophysiologic regulation of the palatal fusion (Fig. 7A) and our study also clarifies potential therapeutic targets in the prevention and pharmaceutical intervention for cleft palate.

Materials and Methods

Animals

Runx1^−/− mice are lethal due to hemorrhaging at about E10.5 to E12.5, when the palatal development is not yet completed⁵. To determine the role of Runx1 in oral epithelium, we use epithelial-specific knockout mice created through the Cre/loxP system (K14-Cre/Runx1^fl/fl). To generate K14-Cre/Runx1^fl/fl mice, we first mated heterozygous K14-Cre mice⁵² and Runx1^fl/fl mice⁵³ to obtain K14-Cre/Runx1^fl/+mice. These progenies were subsequently bred with Runx1^fl/fl mice. Genotyping was performed by the conventional polymerase chain reaction (PCR) method using each primer set to detect Cre (5′ CTCTGGTGTAGCTGATGATC 3′ and 5′ TAATCGCCATCTTCCAGCAG 3′) and the loxP site of Runx1 (5′ GCGTTCCAAGTCAGTTGTAAGCC 3′ and 5′ CTGCATTTGTCCCTTGGTTGACG 3′). We used littermates that did not carry the K14-Cre/Runx1^fl/fl genotype as control animals. We also confirmed the efficiency of the K14-Cre recombination in anterior palatogenesis using Rosa26R reporter mice and X-gal staining, as shown in a previous study⁵⁴.

Assessment of palatal fusion and a histological analysis

The mouse embryonic heads were dissected in BGJb medium (Gibco). The palate was evaluated by direct observation and with a dissecting microscope. These tissue were fixed in 4% paraformaldehyde, equilibrated in graded sucrose, and embedded in Tissue-Tek (OCT compound, Sakura).

Immunohistochemistry

Immunofluorescence staining was performed on 20-µm sections using polyclonal rabbit-anti-Ki67 (1:400, ab15580, Abcam), monoclonal rabbit anti-K17 (1:200, #4543, Cell Signaling Technology), monoclonal anti-K14 (1:200, ab7880, Abcam), monoclonal rabbit anti-phospho-Stat3 (pStat3, 1:200, #9145, Cell Signaling Technology), monoclonal rabbit anti-Stat3 (1:200, #9139, Cell Signaling Technology) overnight at 4 °C. Then, Alexa488-conjugated goat-anti-rabbit IgG (1:400, A21206, Molecular Probes) or Alexa546-conjugated goat-anti-mouse IgG (1:400, A11003, Molecular Probes) was used as secondary antibody. The sections were then counterstained with DAPI (1:500, Dojindo) and mounted with fluorescent mounting medium (Dako). At least three embryos of each genotype were used for each analysis.

Laser microdissection

The mice embryonic maxilla were freshly embedded in OCT compound and frozen immediately. Tissues are serially sectioned at −20 °C on a cryostat (CM 1950, Leica) at a thickness of 25 μm. The maxilla was sectioned from anterior to posterior throughout anterior palate until the secondary palate appeared. The tissue sections were mounted and thawed on a film-coated slide. In total, there were 12–14 serial sections obtained from the anterior palate at E15.0 (section numbers varied due to the orientation of the frozen block). We stained these slides with cresyl violet dye staining. Anterior palate epithelial and mesenchymal tissue were dissected from the sections using a Leica Micro Laser System (LMD6500, Leica) and collected by tube.

RNA extraction and real-time RT-PCR analyses

We used the laser-microdissected tissues of the control and K14-Cre/Runx1^fl/fl mice to extract total RNA. IsogenII (Nippon Gene) was used to extract total RNA according to the manufacturer’s protocol. Total RNA was reverse transcribed to cDNA using an oligo (dT) with avian myeloblastosis virus reverse transcriptase (Takara). For the real-time RT-PCR analysis, the cDNA was amplified with TaqDNA Polymerase (Toyobo) using a light cycler (Roche). The qPCR was carried out with Gapdh used as a housekeeping gene and analyzed as previously described⁵⁴. Primer sequences are available in the Supplementary Fig. S8. At least three embryos of each genotype were used for each analysis.

Whole-mount in situ hybridization

Whole-mount in situ hybridization was performed using fixed E12.0, E13.0, E14.0, E14.5 and E15.0 palates. The digoxigenin-labeled RNA probes used in this study were prepared using a DIG RNA labeling kit (Roche) according to the manufacturer’s protocol using each cDNA clone as the template. The probes were synthesized from fragments of Runx1, Shox2, Msx1, Shh, Bmp4, Tgfb3, Socs3 and Stat3 (Allen Institute for Brain Science) and were amplified with T7 and SP6 adaptor primers through PCR. After hybridization, the expression patterns for each mRNA were detected and visualized according to their immunoreactivity with anti-digoxigenin alkaline phosphatase-conjugated Fab fragments (Roche), as previously reported². At least three embryos of each genotype were used for each analysis.

TUNEL staining

TUNEL assay for apoptosis was conducted according to the manufacturer’s protocol (ApopTag; Chemicon). Frozen sections (10 μm) from samples were prepared. The sections were counterstained with methyl green. At least three embryos of each genotype were used for each analysis.

In vitro culture of palatal shelves and rescue of the mutant cleft palate using TGFB3 protein

The palate was dissected and explanted from the E15.0 embryo and cultured on track-etched polycarbonate membrane filter (Nuclepore) in Trowell type organ culture with serumless, chemically defined BGJb medium (Gibco). In our dissection, the primary palate and the nasal septum were not excluded from our culture system. Affi-Gel beads (Bio-Rad) were incubated in TGFB3 (100 ng/μl, R&D Systems). Bovine serum albumin (BSA; Sigma-Aldrich) was used instead of recombinant protein for the control beads. The beads were immersed in recombinant protein or BSA at 37 °C for 60 min and placed on the primary palate of the explants using a pipette tube. After culture, the in vitro explants were fixed at each stage in 4% paraformaldehyde overnight and then processed for histological examination and qPCR analyses.

Whole-head roller culture and treatment of Stat3 inhibitor

Embryo heads from E14.0 ICR mouse embryos were collected in BGJB, and the mandibles, tongues, and brains were removed. The remaining palatal tissue, including both the primary and secondary palate and the nasal septum, were cultured for 24–48 h in a whole-embryo culture incubator (RKI Ikemoto) at 37 °C. Palatal tissues were incubated in BGJb medium with or without AG490 (200–400 µM; Sigma-Aldrich) or STAT3 Inhibitor VI, S3I-201 (200–400 µM; Sigma-Aldrich). Tissues were harvested after 24 h of culture and processed for qPCR analysis.

Western blot analysis

The dissected palatal tissues were lysed with RIPA buffer (nacalai tesque) supplemented with protease and phosphatase inhibitors (nacalai tesque). The lysates were centrifuged and the supernates were heated in denaturing Laemmli buffer (Bio-rad Laboratories). Proteins were separated by SDS-PAGE and transferred to Polyvinylidene difluoride membranes (Bio-rad Laboratories). The membranes were incubated with either anti-Stat3 (1:1000, #9139, Cell Signaling Technology), anti-pStat3 (1:1000, #9145, Cell Signaling Technology) and beta-actin (1:2000, Sigma). The bound antibodies were detected with HRP-linked antibody (1:1,000, Cell Signaling Technology) and the ECL detection kit (Bio-rad Laboratories).

Statistical analyses

Quantitative variables in two groups were compared using the Mann-Whitney U test. Differences among the three groups were determined using the analysis of variance (ANOVA) test, and significant effects indicated by the ANOVA were further analyzed with post hoc Bonferroni correction. P values < 0.05 were considered significant. Significance was determined using the statistical analysis software program JMP, version 5 (SAS Institute Inc.).

Study approval

All animal experiments were carried out in strict accordance with the recommendations in the Guide for the Care and Use Committee of the Osaka University Graduate School of Dentistry, Osaka, Japan. The protocol was approved by the Committee on the Ethics of Animal Experiments of Osaka University Graduate School of Dentistry. Mice were housed in the animal facility at the Department of Dentistry, Osaka University. Welfare guidelines and procedures were performed with the approval of the Osaka University Graduate School of Dentistry Animal Committee.

References

Murray, J. C. Gene/environment causes of cleft lip and/or palate. Clin Genet 61, 248–256 (2002).
Article PubMed CAS Google Scholar
Dixon, M. J., Marazita, M. L., Beaty, T. H. & Murray, J. C. Cleft lip and palate: understanding genetic and environmental influences. Nat Rev Genet 12, 167–178, https://doi.org/10.1038/nrg2933 (2011).
Article PubMed PubMed Central CAS Google Scholar
Ferguson, M. W. Palate development. Development 103, Suppl, 41–60 (1988).
PubMed Google Scholar
Bush, J. O. & Jiang, R. Palatogenesis: morphogenetic and molecular mechanisms of secondary palate development. Development 139, 231–243, https://doi.org/10.1242/dev.067082 (2012).
Article PubMed PubMed Central CAS Google Scholar
Charoenchaikorn, K. et al. Runx1 is involved in the fusion of the primary and the secondary palatal shelves. Dev Biol 326, 392–402, https://doi.org/10.1016/j.ydbio.2008.10.018 (2009).
Article PubMed CAS Google Scholar
Taniuchi, I., Osato, M. & Ito, Y. Runx1: no longer just for leukemia. EMBO J 31, 4098–4099, https://doi.org/10.1038/emboj.2012.282 (2012).
Article PubMed PubMed Central CAS Google Scholar
Okada, H. et al. AML1(−/−) embryos do not express certain hematopoiesis-related gene transcripts including those of the PU.1 gene. Oncogene 17, 2287–2293, https://doi.org/10.1038/sj.onc.1202151 (1998).
Article PubMed CAS Google Scholar
Okuda, T., van Deursen, J., Hiebert, S. W., Grosveld, G. & Downing, J. R. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84, 321–330 (1996).
Article PubMed CAS Google Scholar
Scheitz, C. J., Lee, T. S., McDermitt, D. J. & Tumbar, T. Defining a tissue stem cell-driven Runx1/Stat3 signalling axis in epithelial cancer. EMBO J 31, 4124–4139, https://doi.org/10.1038/emboj.2012.270 (2012).
Article PubMed PubMed Central CAS Google Scholar
Scheitz, C. J. & Tumbar, T. New insights into the role of Runx1 in epithelial stem cell biology and pathology. J Cell Biochem 114, 985–993, https://doi.org/10.1002/jcb.24453 (2013).
Article PubMed PubMed Central CAS Google Scholar
Jindal, A. & Vieira, A. R. Family history of cleft lip and palate in subjects diagnosed with leukemia. Am J Med Genet A 158A, 678–679, https://doi.org/10.1002/ajmg.a.34430 (2012).
Article PubMed Google Scholar
Taioli, E. et al. Cleft lip and palate in family members of cancer survivors. Cancer Invest 28, 958–962, https://doi.org/10.3109/07357907.2010.483510 (2010).
Article PubMed PubMed Central CAS Google Scholar
Braddock, S. R. & Carey, J. C. A new syndrome: congenital thrombocytopenia, Robin sequence, agenesis of the corpus callosum, distinctive facies and developmental delay. Clin Dysmorphol 3, 75–81 (1994).
Article PubMed CAS Google Scholar
Hilliard, S. A., Yu, L., Gu, S., Zhang, Z. & Chen, Y. P. Regional regulation of palatal growth and patterning along the anterior-posterior axis in mice. J Anat 207, 655–667, https://doi.org/10.1111/j.1469-7580.2005.00474.x (2005).
Article PubMed PubMed Central Google Scholar
Li, Q. & Ding, J. Gene expression analysis reveals that formation of the mouse anterior secondary palate involves recruitment of cells from the posterior side. Int J Dev Biol 51, 167–172, https://doi.org/10.1387/ijdb.062212ql (2007).
Article PubMed CAS Google Scholar
Hoi, C. S. et al. Runx1 directly promotes proliferation of hair follicle stem cells and epithelial tumor formation in mouse skin. Mol Cell Biol 30, 2518–2536, https://doi.org/10.1128/MCB.01308-09 (2010).
Article PubMed PubMed Central CAS Google Scholar
Osorio, K. M. et al. Runx1 modulates developmental, but not injury-driven, hair follicle stem cell activation. Development 135, 1059–1068, https://doi.org/10.1242/dev.012799 (2008).
Article PubMed CAS Google Scholar
Rawlings, J. S., Rosler, K. M. & Harrison, D. A. The JAK/STAT signaling pathway. J Cell Sci 117, 1281–1283, https://doi.org/10.1242/jcs.00963 (2004).
Article PubMed CAS Google Scholar
Reich, N. C. STATs get their move on. JAKSTAT 2, e27080, https://doi.org/10.4161/jkst.27080 (2013).
Article PubMed PubMed Central Google Scholar
Stark, G. R. & Darnell, J. E. The JAK-STAT pathway at twenty. Immunity 36, 503–514, https://doi.org/10.1016/j.immuni.2012.03.013 (2012).
Article PubMed PubMed Central CAS Google Scholar
Grimbacher, B. et al. Hyper-IgE syndrome with recurrent infections–an autosomal dominant multisystem disorder. N Engl J Med 340, 692–702, https://doi.org/10.1056/NEJM199903043400904 (1999).
Article PubMed CAS Google Scholar
Cuervo, R. & Covarrubias, L. Death is the major fate of medial edge epithelial cells and the cause of basal lamina degradation during palatogenesis. Development 131, 15–24, https://doi.org/10.1242/dev.00907 (2004).
Article PubMed CAS Google Scholar
Cui, X. M. et al. Overexpression of Smad2 in Tgf-beta3-null mutant mice rescues cleft palate. Dev Biol 278, 193–202, https://doi.org/10.1016/j.ydbio.2004.10.023 (2005).
Article PubMed CAS Google Scholar
Hu, L. et al. TGFβ3 regulates periderm removal through ΔNp63 in the developing palate. J Cell Physiol 230, 1212–1225, https://doi.org/10.1002/jcp.24856 (2015).
Article PubMed CAS Google Scholar
Gritli-Linde, A. Molecular control of secondary palate development. Dev Biol 301, 309–326, https://doi.org/10.1016/j.ydbio.2006.07.042 (2007).
Article PubMed CAS Google Scholar
McGowan, K. M. & Coulombe, P. A. Onset of keratin 17 expression coincides with the definition of major epithelial lineages during skin development. J Cell Biol 143, 469–486 (1998).
Article PubMed PubMed Central CAS Google Scholar
Yamashiro, T., Aberg, T., Levanon, D., Groner, Y. & Thesleff, I. Expression of Runx1, -2 and -3 during tooth, palate and craniofacial bone development. Mech Dev 119(Suppl 1), S107–110 (2002).
Article PubMed Google Scholar
Baek, J. A. et al. Bmpr1a signaling plays critical roles in palatal shelf growth and palatal bone formation. Dev Biol 350, 520–531, https://doi.org/10.1016/j.ydbio.2010.12.028 (2011).
Article PubMed CAS Google Scholar
Welsh, I. C. & O’Brien, T. P. Signaling integration in the rugae growth zone directs sequential SHH signaling center formation during the rostral outgrowth of the palate. Dev Biol 336, 53–67, https://doi.org/10.1016/j.ydbio.2009.09.028 (2009).
Article PubMed PubMed Central CAS Google Scholar
Yu, L. et al. Shox2-deficient mice exhibit a rare type of incomplete clefting of the secondary palate. Development 132, 4397–4406, https://doi.org/10.1242/dev.02013 (2005).
Article PubMed CAS Google Scholar
Zhang, Z. et al. Rescue of cleft palate in Msx1-deficient mice by transgenic Bmp4 reveals a network of BMP and Shh signaling in the regulation of mammalian palatogenesis. Development 129, 4135–4146 (2002).
PubMed CAS Google Scholar
Blavier, L. et al. TGF-beta3-induced palatogenesis requires matrix metalloproteinases. Mol Biol Cell 12, 1457–1466 (2001).
Article PubMed PubMed Central CAS Google Scholar
Lane, J. et al. Tak1, Smad4 and Trim33 redundantly mediate TGF-β3 signaling during palate development. Dev Biol 398, 231–241, https://doi.org/10.1016/j.ydbio.2014.12.006 (2015).
Article PubMed CAS Google Scholar
Xu, X. et al. Cell autonomous requirement for Tgfbr2 in the disappearance of medial edge epithelium during palatal fusion. Dev Biol 297, 238–248, https://doi.org/10.1016/j.ydbio.2006.05.014 (2006).
Article PubMed CAS Google Scholar
Laverty, H. G., Wakefield, L. M., Occleston, N. L., O’Kane, S. & Ferguson, M. W. TGF-beta3 and cancer: a review. Cytokine Growth Factor Rev 20, 305–317, https://doi.org/10.1016/j.cytogfr.2009.07.002 (2009).
Article PubMed CAS Google Scholar
Larsen, L. & Röpke, C. Suppressors of cytokine signalling: SOCS. APMIS 110, 833–844 (2002).
Article PubMed CAS Google Scholar
Siddiquee, K. et al. Selective chemical probe inhibitor of Stat3, identified through structure-based virtual screening, induces antitumor activity. Proc Natl Acad Sci USA 104, 7391–7396, https://doi.org/10.1073/pnas.0609757104 (2007).
Article PubMed ADS CAS Google Scholar
Coppo, P. et al. BCR-ABL activates STAT3 via JAK and MEK pathways in human cells. Br J Haematol 134, 171–179, https://doi.org/10.1111/j.1365-2141.2006.06161.x (2006).
Article PubMed CAS Google Scholar
Huang, G. et al. IL-6 mediates differentiation disorder during spermatogenesis in obesity-associated inflammation by affecting the expression of Zfp637 through the SOCS3/STAT3 pathway. Sci Rep 6, 28012, https://doi.org/10.1038/srep28012 (2016).
Article PubMed PubMed Central ADS CAS Google Scholar
Taya, Y., O’Kane, S. & Ferguson, M. W. Pathogenesis of cleft palate in TGF-beta3 knockout mice. Development 126, 3869–3879 (1999).
PubMed CAS Google Scholar
Zhu, J. et al. MTHFR, TGFB3, and TGFA polymorphisms and their association with the risk of non-syndromic cleft lip and cleft palate in China. Am J Med Genet A 152A, 291–298, https://doi.org/10.1002/ajmg.a.33113 (2010).
Article PubMed CAS Google Scholar
Dudas, M. et al. Epithelial and ectomesenchymal role of the type I TGF-beta receptor ALK5 during facial morphogenesis and palatal fusion. Dev Biol 296, 298–314, https://doi.org/10.1016/j.ydbio.2006.05.030 (2006).
Article PubMed PubMed Central CAS Google Scholar
VanOudenhove, J. J. et al. Transient RUNX1 Expression during Early Mesendodermal Differentiation of hESCs Promotes Epithelial to Mesenchymal Transition through TGFB2 Signaling. Stem Cell Reports 7, 884–896, https://doi.org/10.1016/j.stemcr.2016.09.006 (2016).
Article PubMed PubMed Central CAS Google Scholar
Li, M. et al. Mammary-derived signals activate programmed cell death during the first stage of mammary gland involution. Proc Natl Acad Sci USA 94, 3425–3430 (1997).
Article PubMed ADS CAS Google Scholar
Robinson, S. D., Silberstein, G. B., Roberts, A. B., Flanders, K. C. & Daniel, C. W. Regulated expression and growth inhibitory effects of transforming growth factor-beta isoforms in mouse mammary gland development. Development 113, 867–878 (1991).
PubMed CAS Google Scholar
Chapman, R. S. et al. Suppression of epithelial apoptosis and delayed mammary gland involution in mice with a conditional knockout of Stat3. Genes Dev 13, 2604–2616 (1999).
Article PubMed PubMed Central CAS Google Scholar
Aaronson, D. S. & Horvath, C. M. A road map for those who don’t know JAK-STAT. Science 296, 1653–1655, https://doi.org/10.1126/science.1071545 (2002).
Article PubMed ADS CAS Google Scholar
Norkina, O. et al. Acute alcohol intake induces SOCS1 and SOCS3 and inhibits cytokine-induced STAT1 and STAT3 signaling in human monocytes. Alcohol Clin Exp Res 32, 1565–1573, https://doi.org/10.1111/j.1530-0277.2008.00726.x (2008).
Article PubMed PubMed Central CAS Google Scholar
de Jonge, W. J. et al. Stimulation of the vagus nerve attenuates macrophage activation by activating the Jak2-STAT3 signaling pathway. Nat Immunol 6, 844–851, https://doi.org/10.1038/ni1229 (2005).
Article PubMed CAS Google Scholar
Yu, H., Kortylewski, M. & Pardoll, D. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol 7, 41–51, https://doi.org/10.1038/nri1995 (2007).
Article PubMed CAS Google Scholar
Lyle, S. et al. Dicer cooperates with p53 to suppress DNA damage and skin carcinogenesis in mice. PLoS One 9, e100920, https://doi.org/10.1371/journal.pone.0100920 (2014).
Article PubMed PubMed Central ADS Google Scholar
Dassule, H. R., Lewis, P., Bei, M., Maas, R. & McMahon, A. P. Sonic hedgehog regulates growth and morphogenesis of the tooth. Development 127, 4775–4785 (2000).
PubMed CAS Google Scholar
Taniuchi, I. et al. Differential requirements for Runx proteins in CD4 repression and epigenetic silencing during T lymphocyte development. Cell 111, 621–633 (2002).
Article PubMed CAS Google Scholar
Kurosaka, H. et al. Core binding factor beta functions in the maintenance of stem cells and orchestrates continuous proliferation and differentiation in mouse incisors. Stem Cells 29, 1792–1803, https://doi.org/10.1002/stem.722 (2011).
Article PubMed CAS Google Scholar

Download references

Acknowledgements

We thank Ms. Yuriko Nogami for the excellent care and maintenance of our mouse colony and her valuable assistance in the histological and molecular work. This work was supported by grants-in-aid for scientific research program from the Japan Society for the Promotion of Science (#15H02577 and #24249093, to TY).

Author information

Authors and Affiliations

Department of Orthodontics and Dentofacial Orthopedics, Osaka University Graduate School of Dentistry, Osaka, Japan
Safiye E. Sarper, Hiroshi Kurosaka, Toshihiro Inubushi & Takashi Yamashiro
Department of Oral-facial Disorders, Osaka University Graduate School of Dentistry, Osaka, Japan
Hitomi Ono Minagi & Takayoshi Sakai
Department of Advanced Prosthodontics, Graduate School of Biomedical & Health Sciences, Hiroshima University, Hiroshima, Japan
Koh-ichi Kuremoto
Laboratory for Transcriptional Regulation, RIKEN Research Center for Allergy and Immunology, Yokohama, Japan
Ichiro Taniuchi

Authors

Safiye E. Sarper
View author publications
You can also search for this author in PubMed Google Scholar
Hiroshi Kurosaka
View author publications
You can also search for this author in PubMed Google Scholar
Toshihiro Inubushi
View author publications
You can also search for this author in PubMed Google Scholar
Hitomi Ono Minagi
View author publications
You can also search for this author in PubMed Google Scholar
Koh-ichi Kuremoto
View author publications
You can also search for this author in PubMed Google Scholar
Takayoshi Sakai
View author publications
You can also search for this author in PubMed Google Scholar
Ichiro Taniuchi
View author publications
You can also search for this author in PubMed Google Scholar
Takashi Yamashiro
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

H.K. and T.Y. designed the study. S.E.S., H.K., H.O.M., T.I. and T.S. performed and/or analyzed experiments. I.T. and K.K. provided experimental reagents and participated in the discussions. S.E.S. and T.Y. wrote the manuscript with input from all authors. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Takashi Yamashiro.

Ethics declarations

Competing Interests

The authors declare no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Supplementary Figures

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Sarper, S.E., Kurosaka, H., Inubushi, T. et al. Runx1-Stat3-Tgfb3 signaling network regulating the anterior palatal development. Sci Rep 8, 11208 (2018). https://doi.org/10.1038/s41598-018-29681-3

Download citation

Received: 05 January 2018
Accepted: 15 June 2018
Published: 25 July 2018
DOI: https://doi.org/10.1038/s41598-018-29681-3

This article is cited by

Single-cell multiomics decodes regulatory programs for mouse secondary palate development
- Fangfang Yan
- Akiko Suzuki
- Zhongming Zhao
Nature Communications (2024)
AMPK-induced novel phosphorylation of RUNX1 inhibits STAT3 activation and overcome imatinib resistance in chronic myelogenous leukemia (CML) subjects
- Meher Bolisetti Gayatri
- Rama Krishna Kancha
- Aramati Bindu Madhava Reddy
Cell Death Discovery (2023)
The Association Between Runx Signaling and Craniofacial Development and Disease
- Takashi Yamashiro
- Hiroshi Kurosaka
- Toshihiro Inubush
Current Osteoporosis Reports (2022)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.