Background & Summary

NODULIN HOMEOBOX (NDX) is a specific member of the homeobox family of transcription factors in flowering plants1,2, particularly in the Brassicaceae family, which includes the genetic model Arabidopsis thaliana. Besides its homeobox domain, NDX has two atypical domains called NDX-A and NDX-B, whose molecular functions are less understood. Recent molecular data indicate that NDX regulates the activity of some euchromatic genes in Arabidopsis thaliana plants. NDX was shown to interact with the E3 ubiquitin ligase module of the Polycomb Repressive Complex 1 (PRC1), RING1A and RING1B, establishing a functional link between histone H2A ubiquitination (H2Aub) and abscisic acid (ABA)-mediated repressive chromatin signalling3. Through the ABA pathway, NDX regulates seed germination and root growth. NDX was also shown to interact with the transcriptional repressor VIVIPAROUS1/ABI3-LIKE (VAL1) (through binding RING1A and RING1B), which regulates the activity of FLOWERING LOCUS C (FLC), a central integrator of the flowering transition in Arabidopsis4.

In addition to the above functions, NDX exhibits significant binding affinity to different nucleic acid substrates3,5. NDX was shown to bind to an R-loop structure at the 3′-end of FLC, which serves as a promoter for antisense (COOLAIR) transcription. COOLAIR is a set of antisense long noncoding RNAs that act as a repressor of FLC. The association of NDX and COOLAIR suggested a model in which COOLAIR transcription was repressed by NDX-mediated R-loop stabilization, which in turn altered FLC expression and flowering time.

Recent genomic data challenged the idea that NDX acts as a general R-loop regulator that controls the formation of chromosomal R-loops throughout the Arabidopsis genome. Instead, NDX appears to be linked to heterochromatin function by regulating the activity of heterochromatic siRNAs (het-siRNAs) and non-CG DNA methylation pathways at pericentromeric regions6. This observation is consistent with earlier data showing that NDX coincides with a heterochromatic patch of H3K9 dimethylation and Pol IV-dependent siRNA transcripts within the FLC terminator/COOLAIR promoter region5,7, linking NDX to heterochromatin function.

The molecular phenotype supporting the role of NDX in heterochromatin homeostasis was identified in genomic data of 10-day-old seedlings, however, similar functional studies were not performed in other stages of plant development. In particular, there is a lack of transcriptome data in Arabidopsis inflorescence, which awaits to be generated to understand the effect of NDX on the expression of flowering-related coding and noncoding RNAs. Herein, we extend our transcriptomic measurements to the flowering stage and present novel mRNA-seq and small RNA (sRNA)-seq data on inflorescence tissues of wild-type and ndx1-4 T-DNA insertion mutant (WiscDsLox344A04) plants (Fig. 1). Our analysis identified specific sets of genes differentially expressed in ndx1-4, as well as noncoding heterochromatic siRNA (het-siRNA) loci whose activity was significantly changed in the absence of NDX. Transcriptomic data obtained from inflorescence were also compared with previously published seedling data6, highlighting development-specific changes in gene expression profiles.

Fig. 1
figure 1

General workflow of mRNA-seq and sRNA-seq experiments performed in Arabidopsis thaliana. Two different tissue types were analysed: flowers and seedlings. The seedling data were published in ref. 6, which were used for comparison with the flower transcriptomic data generated in this study.

Full size image

Methods

Arabidopsis thaliana Col-0 wild-type accession and ndx1-4 mutant (WiscDsLox344A04)5 plants were directly sown on soil and grown side-by-side at 21 °C on long day conditions (LD, 16 h light, 8 h dark photoperiod) until flowering stage. After five weeks, when the central flowering stem of plants reached approximately 20–25 cm and side branches were also present, inflorescence tissues were collected. Total RNA isolation was performed by the standard phenol-chloroform extraction method as described previously8. Briefly, approximately 30 mg plant material per sample was homogenized and resuspended in 600 μl of extraction buffer (0.1 M glycine-NaOH, pH 9.0, 100 mM NaCl, 10 mM EDTA, 2% SDS). The sample was mixed with an equal volume of phenol (pH 4.3, Sigma-Aldrich, P3803). The aqueous phase was treated with 600 μl of phenol-chloroform and chloroform, precipitated with ethanol. RNA samples were eluted in nuclease-free water and used in subsequent steps. To remove genomic contaminations, Dnase I treatments were performed based on manufacturer’s instructions (Ambion AM2222, www.thermofisher.com); RNA quality was assessed by testing RNA degradation based on agarose gel electrophoresis and presence of contaminants by Nanodrop spectrophotometer measurements (260/230 and 260/280 ratios). RNA quality was further assayed by capillary electrophoresis (Agilent 2100).

For RNA-seq, cDNA libraries were prepared from two independent biological replicates according to Illumina’s TruSeq RNA Library Preparation Kit v2 protocol. Equal amounts of total RNA extracts from 5 inflorescence tissues of different plants were pooled (to create one pool) for each biological replicate (see Tables 1, 2 for description of samples). The mRNA-seq libraries were sequenced using an Illumina NextSeq 500 instrument with 1 × 75 bp reads, generating 17.3–22.4 million reads per sample (Fig. 2a). Raw sequence data quality was assessed using FastQC and summarized reports were generated with MultiQC9. Duplication detection indicated >50% of reads as unique (Fig. 2b). Mean Phred quality scores for each read position in each mRNA sample were higher than 28 (indicative of ‘very good quality’) (Fig. 2c). Per sequence mean Phred quality scores were higher than 28 (indicative of ‘very good quality’) for at least 95% of reads in each mRNA sample (Fig. 2d).

Table 1 List of NGS experiments, result tables and identifiers of inflorescence samples used in the current study.
Full size table
Table 2 List of NGS experiments, result tables and identifiers of seedling samples used in the current study.
Full size table
Fig. 2
figure 2

MultiQC analysis of mRNA-seq data from flowers. (a) General NGS statistics of mRNA-seq samples. (b) Sequence Counts plot showing the total number of reads, classified as unique and duplicate. Duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75 bp in length were truncated to 50 bp for this analysis. More about duplicate calculation: https://multiqc.info/. (c) Mean quality scores. The higher the score, the better the base call. Background color of the graph divides the y axis into very good quality calls (green zone), calls of reasonable quality (orange zone), and calls of poor quality (red zone). (d) Per sequence quality scores. The graph shows if a subset of sequences have universally low-quality values. Background color: of the graph very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red).

Full size image

Next, Salmon10 was used to map mRNA-seq reads and get transcript quantities for protein coding genes, noncoding genes and transposable elements. Reads were mapped to the Arabidopsis thaliana reference transcriptome (Araport11, coding and noncoding genes) to quantify gene expression levels as well as to transposable elements (Araport11) to quantify transposable element expression (see Table 3 for detailed description of Arabidopsis thaliana reference data used in the analyses). Transcript quantities of protein coding genes, noncoding genes, and transposable elements were corrected for potential fragment level GC bias using ‘salmon quant–gcBias’ that was shown to reduce isoform quantification errors10,11. Duplicate reads were filtered out from alignment to protein coding and noncoding genes (default behaviour of ‘salmon quant’) while duplicates were kept for transposable element alignments (‘salmon quant’ was used with ‘–keepDuplicates’ option set).

Table 3 List of Arabidopsis thaliana reference data used in this study.
Full size table

DESeq2 was employed to identify differentially expressed genes (DEGs) and transposable elements (ndx1-4 versus Col-0 wild type)12. The significance level was established based on the adjusted p-values with independent hypothesis weighting13, where p(adjusted) <0.01 was used to define DEGs and p(adjusted) <0.05 for differentially expressed transposable elements. For the purpose of data visualization, RNA-seq reads were aligned to the TAIR10 reference genome using HISAT214, which allowed for reporting spliced alignments. To create RPKM (Reads Per Kilobase per Million) normalized coverage files, we utilized deepTools bamCoverage15.

Expression changes of 31987 protein coding and noncoding genes and 34856 transposable elements were analysed. DEGs were visualized by hierarchical clustering in three different relations: (1) in inflorescence, we identified 269 (0.84%) up- and 145 (0.45%) downregulated genes in the ndx1-4 mutant vs. Col-0 control samples (Fig. 3a). Representative genes are shown in Fig. 3b–d. (2) The transcriptomes of inflorescence and seedlings6,16 were compared in Col-0 (control) samples (Fig. 4a), identifying 5555 (17.37%) up- and 5618 (17.56%) downregulated genes in flowers relative to seedlings. Representative genes are shown in Fig. 4b–d. 3) The transcriptomes of inflorescence and seedlings6,16 were compared in ndx1-4 mutant samples (Fig. 5a), identifying 5405 (16.9%) up- and 5645 (17.65%) downregulated genes in flowers vs. seedlings. In addition, 200 DEGs identified at the flowering stage between ndx1-4 and Col-0 overlapped with DEGs identified in seedlings. Representative genes are shown in Fig. 5b–d. Collectively, the above analysis identified a great number of ndx1-4-specific and development-specific changes in gene expression profiles.

Fig. 3
figure 3

Differentially expressed genes in Col-0 and ndx1-4 mutant Arabidopsis inflorescence. (a) Hierarchical clustering of log2 fold change values (ndx1-4 vs. Col-0) calculated by DESeq2 analysis. Orange shows upregulated genes, blue shows downregulated genes. Two independent biological replicates are shown. (b) Representative screenshots of upregulated genes in ndx1-4 flowers. (c) Representative screenshots of downregulated genes in ndx1-4 flowers. (d) Representative screenshots of genes showing no differential expression in ndx1-4 flowers.

Full size image
Fig. 4
figure 4

Differentially expressed genes in Col-0 seedlings and flowers. (a) Hierarchical clustering of log2 fold change values (seedling, Col-0 vs. flower, Col-0) calculated by DESeq2 analysis. Orange shows upregulated genes, blue shows downregulated genes. Two independent biological replicates are shown. (b) Representative screenshots of downregulated genes in flowers. (c) Representative screenshots of upregulated genes in flowers. (d) Representative gene showing no differential expression in Col-0 seedlings and flowers.

Full size image
Fig. 5
figure 5

Differentially expressed genes in ndx1-4 mutant seedlings and flowers. (a) Hierarchical clustering of log2 fold change values (seedling, ndx1-4 vs. flower, ndx1-4) calculated by DESeq2 analysis. Orange shows upregulated genes, blue shows downregulated genes. Two independent biological replicates are shown. (b) Representative screenshots of downregulated genes in ndx1-4 flowers. (c) Representative screenshots of upregulated genes in ndx1-4 flowers. (d) Representative gene showing no differential expression in ndx1-4 seedlings and flowers.

Full size image

Differential expression of 34856 transposable elements were analysed in inflorescence samples. Only a small number of transposable elements were differentially expressed: we identified 33 (0.09%) upregulated and 12 (0.03%) downregulated transposable elements in the ndx1-4 mutant vs. Col-0 control samples.

Comparing DEGs with TEs, 42 upregulated and 19 downregulated DEGs overlap with transposable elements, 7 upregulated and 3 downregulated DEGs overlap with differentially expressed transposable elements.

Description and accessibility of the generated datasets can be found in Tables 1, 2.

For the analysis of the noncoding transcriptome, sRNA libraries were prepared from 3-3 biological replicates according to Illumina’s NEBNext® Multiplex sRNA Library Prep protocol. For sRNA library preparations, equal amounts of total RNA extracts from 5 flowering tissues were pooled (to create one pool) for each biological replicate (see Tables 1, 2 for description of samples). Total RNA extraction was done as described above for mRNA-seq. The same total RNA prep was used for sRNA and mRNA sequencing. The sRNA-seq libraries were sequenced using an Illumina NextSeq500 instrument with 1 × 50 bp reads, generating 13.5–17.5 million reads per sample (Fig. 6a). Raw sequence data quality was assessed using FastQC and summarized reports were generated with MultiQC9. Duplication detection indicated 5–6 million unique reads per sample (Fig. 6b). Mean Phred quality scores for each read position in each sRNA sample were higher than 28 (indicative of ‘very good quality’) (Fig. 6c). Per sequence mean Phred quality scores were higher than 28 (indicative of ‘very good quality’) for at least 95% of reads in each sRNA sample (Fig. 6d).

Fig. 6
figure 6

MultiQC analysis of sRNA-seq data from flowers. (a) General NGS statistics of sRNA-seq samples. (b-d) Same as in Fig. 2.

Full size image

The sRNA-seq data underwent additional processing using the sRNAnalyzer pipeline17. The Illumina adapters were initially removed by Cutadapt18, and the reads were then size-selected to range between 19–25 nt. These size-selected reads were subsequently aligned to a published comprehensive sRNA locus database19 (public data: www.ebi.ac.uk/ena/browser/view/PRJEB22276, additional material: https://github.com/seb-mueller/Arabidopsis_smallRNA_loci) using sRNAnalyzer. To determine differential expression of sRNA loci between Col-0 and ndx1-4 samples, DESeq2 was employed (p(adjusted) <0.05), and the hits were further filtered by absolute fold change (abs(FC) >1.5). For data visualization, reads were aligned to the Arabidopsis thaliana reference sequence (TAIR10) with bowtie220. Finally, we utilized deepTools bamCoverage to generate RPKM (Reads per Kilobase per Million) normalized coverage files. Differential expression of 16517 sRNA loci were analysed. Our analysis identified 642 (3.89%) up- and 991 (6%) downregulated sRNA loci in the ndx1-4 mutant relative to Col-0 control samples. At absolute fold change (abs(FC) >1.5) cutoff, we identified 375 (2.27%) up- and 179 (1.08%) downregulated sRNA loci that were visualized by hierarchical clustering (Fig. 7a). Representative sRNA loci are shown in Fig. 7b. Description and accessibility of the generated datasets can be found in Tables 1, 2.

Fig. 7
figure 7

Differentially expressed sRNA loci in Col-0 and ndx1-4 mutant Arabidopsis inflorescence. (a) Hierarchical clustering of log2 fold change values (flower, Col-0 vs. ndx1-4) calculated by DESeq2 analysis. Orange shows upregulated sRNA loci, blue shows downregulated sRNA loci. Three independent biological replicates are shown. (b) Representative screenshots of upregulated, downregulated sRNA loci in ndx1-4 flowers. An sRNA locus with no transcriptional change is also shown (bottom panel).

Full size image

Data Records

The mRNA-seq and sRNA-seq datasets generated from Arabidopsis inflorescence tissues were deposited in Gene Expression Omnibus (GEO) under the accession number GSE22359121.

Genome browser (JBrowse) tracks containing relevant transcriptomic data are available at:

https://geneart.med.unideb.hu/pub/2023_ndx (login: ndx; password: athal23)

The mRNA and sRNA datasets generated from Arabidopsis seedlings can be accessed at GEO under the accession number GSE20184116 and in Supplementary Data 1–16 accompanying the related paper6.

Tables 1, 2 summarizes all transcriptomic experiments, NGS data, result tables, and identifiers to access relevant datasets. Table 3 lists all reference data used for analyses.

Technical Validation

The genotypes of Col-0 and ndx1-4 mutant Arabidopsis lines were confirmed by PCR using different combinations of genotyping primers designed for the NDX locus and the T-DNA (WiscDsLox344A04) insertion site (Fig. 8). The integrity, purity, and yield of extracted total RNA were determined by agarose gel electrophoresis and nanodrop spectrophotometry (Fig. 9) as well as Agilent bioanalyzer measurements (resulting in RIN values >9). Lack of mRNA expression from the mutagenized ndx1-4 locus was confirmed by RT-qPCR analysis (Fig. 10). RNA samples were extracted from the 10-day-old seedling and inflorescence tissues (Col-0 and ndx1-4 genotypes). To remove genomic contaminations, Dnase I treatments were performed based on manufacturer’s instructions (Ambion AM2222, www.thermofisher.com). These RNA samples were reverse transcribed with random hexamers using SuperScript IV reverse transcriptase (Thermo Fisher Scientific) as previously described8. For qPCR, we employed the ΔΔCt method and internal primers for normalization between samples. Primer sequences used for qPCR were as follows: NDX F AGCTGTAAAGTCAACTAACTGAGA; NDX R TCTAGATCCCATCTAACAAGAAACA; GAPDH1 F AGGAGCAAGGCAGTTAGTGGT; GAPDH1 R AGATGCGCCCATGTTCGTT. Real-time qPCR was subsequently conducted with a LightCycler 480 SYBR Green I Master mix (Roche) utilizing a QuantStudio 12 K Flex Real-Time PCR System (Thermo Fisher Scientific). NDX mRNA expression levels were normalized to GAPDH1 gene expression.

Fig. 8
figure 8

Genotyping of the ndx1-4 mutant plant line (Col-0 background). (a) Schematic representation of T-DNA insertion into the NDX locus along with the genotyping PCR primers ndx1-4_gLP AAAGCTCGTGTTGGCTAAGTG; ndx1-4_gRP AGGTTTCTGCAAACACCAGTG; WISC-TDNA AACGTCCGCAATGTGTTATTAAGTTGTC. Expected sizes of PCR amplicons in Col-0 and ndx1-4 mutant backgrounds are shown below. (b) Representative genotyping PCR in ndx1-4 mutant and Col-0 plant lines. (−): no template control.

Full size image
Fig. 9
figure 9

Total RNA isolated from Col-0 and ndx1-4 mutant Arabidopsis seedlings and inflorescence samples. Upper panel: RNA integrity analysis performed by agarose gel electrophoresis. Dominant bands represent intact rRNAs. Lower panel: Purity and yield of total RNA samples measured by Nanodrop spectrophotometry and Agilent Bioanalyzer. OD 260/280 values > 1.8 and 260/230 values > 2.2 indicate the high purity of the samples. RIN: RNA integrity number.

Full size image
Fig. 10
figure 10

RT-qPCR validation of NDX mRNA expression in Col-0 and ndx1-4 plants. (a) Genome browser screenshot showing mRNA-seq expression profiles over the NDX locus. Two independent biological replicates are shown. (b) RT-qPCR validation performed in Col-0 and ndx1-4 flowers and seedlings. NDX mRNA expression levels were normalized to GAPDH1 expression, as described in the related paper6. NDX mRNA is barely detected in the ndx1-4 mutant.

Full size image

Usage Notes

We have created a comprehensive database of coding and noncoding transcriptomes of Arabidopsis inflorescence and seedling tissues that can be used for downstream genomic analysis. The NGS tracks provided can be displayed directly in freely accessible genome browsers. The list of differentially expressed genes can be directly used for molecular pathway analysis, GO term analysis or gene set enrichment analysis. The identified differentially regulated sRNA loci can be integrated with histone modification, DNA methylation, and transcriptomic maps for in-depth epigenomic analysis. Altogether, the data source we generated in Col-0 and ndx1-4 mutant plants is expected to lead us to a deeper understanding of the molecular function of NDX.