Abstract
Retrotransposons are mobile DNA sequences duplicated via transcription and reverse transcription of an RNA intermediate. Cis-regulatory elements encoded by retrotransposons can also promote the transcription of adjacent genes. Somatic LINE-1 (L1) retrotransposon insertions have been detected in mammalian neurons. It is, however, unclear whether L1 sequences are mobile in only some neuronal lineages or therein promote neurodevelopmental gene expression. Here we report programmed L1 activation by SOX6, a transcription factor critical for parvalbumin (PV) interneuron development. Mouse PV interneurons permit L1 mobilization in vitro and in vivo, harbor unmethylated L1 promoters and express full-length L1 mRNAs and proteins. Using nanopore long-read sequencing, we identify unmethylated L1s proximal to PV interneuron genes, including a novel L1 promoter-driven Caps2 transcript isoform that enhances neuron morphological complexity in vitro. These data highlight the contribution made by L1 cis-regulatory elements to PV interneuron development and transcriptome diversity, uncovered due to L1 mobility in this milieu.
Similar content being viewed by others
Main
Brain activity is governed by complex and coordinated interactions between neurons diverse in function and developmental history. Long interspersed element 1 (LINE-1 or L1) retrotransposons compose nearly 20% of the human and mouse genomes1. To retrotranspose, or duplicate, an L1 sequence initiates the transcription of a full-length (>6 kbp) messenger RNA from its canonical 5′ untranslated region (UTR) promoter. This mRNA encodes two proteins, denoted ORF1p and ORF2p, that bind the L1 mRNA and facilitate its retrotransposition by target-primed reverse transcription2,3,4,5. Heritable L1 insertions principally arise in the early embryo or primordial germ cells and can be pathogenic6,7,8,9,10. Somatic L1 retrotransposition can also occur in the brain and cause neuronal genome mosaicism, as first revealed by L1 retrotransposition reporter assays11,12,13,14 and later confirmed by single-cell genomic analyses of pan-neuronal (NeuN+) populations15,16,17,18. Whether endogenous L1 retrotransposition is more common in some neuronal lineages than in others, or impacts neurobiology, is unclear.
In addition to full-length L1 mRNA production, the L1 5′UTR can bidirectionally promote the formation of chimeric RNAs with adjacent genes, potentially leading to gene expression in novel spatiotemporal contexts17,19,20,21,22. L1 sequences are therefore, like many retrotransposons, a genomic reservoir of cis-regulatory element innovation23. DNA methylation and histone modifications repress L1 5′UTR promoter activity and vary among brain regions and neuron subtypes17,24,25,26,27,28,29,30,31. Transcription factors, including YY1 and members of the SOX family, are also known to regulate the L1 5′UTR11,12,17,25,29,32,33,34. For example, SOX2 represses L1 transcription in pluripotent and neural stem cells11,12. SOX2 downregulation during neurodifferentiation is proposed to facilitate L1 retrotransposition11,12. It is unclear whether other SOX proteins, which can be tissue and cell lineage specific35, activate or repress the L1 5′UTR in the absence of SOX2. The combined epigenomic landscape and transcription factor repertoire of each neuronal lineage could thus create niches for L1 sequences to mobilize or upregulate nearby genes.
In this Article, we reveal L1 activation in the mouse parvalbumin (PV) interneuron lineage. These inhibitory interneurons are essential for circuit plasticity, processing of sensory information and memory consolidation36,37. Crucially, PV interneuron development depends on a SOX6-directed transcriptional program38,39,40. Using a range of orthogonal in vivo and in vitro experimental approaches, we find that PV interneurons permit L1 mRNA expression and retrotransposition, stimulated by SOX6. Unmethylated L1 promoters produce chimeric protein-coding RNAs with adjacent genes that, as we highlight in the Caps2 locus, hold substantial potential to alter PV interneuron morphological complexity and function.
Results
PV interneurons support L1 retrotransposition
To resolve the spatial and cell type specificity of somatic L1 mobility in vivo, we generated a transgenic L1-EGFP mouse line (where EGFP is enhanced green fluorescent protein; Fig. 1a and Extended Data Fig. 1a) harboring a retrotransposition reporter based on L1.3, a highly mobile human L1 element41,42. L1.3 was expressed from its native promoter and incorporated T7 and 3×FLAG epitope tags on ORF1p and ORF2p, respectively (Fig. 1a). Immunofluorescence revealed EGFP+ neurons (Fig. 1b). In agreement with prior experiments11, nearly all EGFP+ cells were found in the brain, apart from occasional EGFP+ ovarian interstitial cells (Extended Data Fig. 1b–e). Tagged ORF1p and ORF2p expression was observed in EGFP+ neurons, indicating that the L1 protein machinery coincided with retrotransposition (Fig. 1c,d). Guided by their location and morphology, we hypothesized that the EGFP+ cells were predominantly PV interneurons. Immunostaining indicated that 85.4% of EGFP+ hippocampal cells were PV interneurons, on average (Fig. 1e,f). PV+/EGFP+ neurons were found throughout the hippocampal dentate gyrus (DG) and cornu ammonis regions 1–3 (CA1–3, referred to here as CA; Fig. 1g) but were infrequent in the cortex (Fig. 1h). EGFP+ cells also expressed Gad1 (Extended Data Fig. 1f), another inhibitory interneuron marker43. L1-EGFP retrotransposition was thus most common in the PV interneuron lineage.
As an orthogonal approach, we electroporated cultured primary mouse neurons with an L1-mCherry retrotransposition reporter based on L1spa, a mobile mouse L1 expressed from its native monomeric 5′UTR promoter44,45,46. While we observed PV+/mCherry+ cells (Extended Data Fig. 2a,b), the vast majority of mCherry+ cells died, an outcome we did not observe for an L1spa ORF2p reverse transcriptase (RT) mutant reporter (Extended Data Fig. 2c). A Cre-LoxP conditional version of the L1-mCherry reporter, which we called cL1spa (Fig. 1i), circumvented this apparent toxicity and retrotransposed in primary neurons (Fig. 1j–m). Nearly all present PV+ cells were also mCherry+ (Fig. 1l). Retrotransposition did not occur in the absence of Cre (Fig. 1m) or using an cL1spa ORF2p RT mutant (Fig. 1j). As a complementary approach, we used in utero electroporation to deliver to the embryonic hippocampus a codon-optimized synthetic L1spa47 bearing an EGFP reporter (Extended Data Fig. 3a). We observed occasional hippocampal EGFP+/PV+ neurons in neonates (Extended Data Fig. 3b). No EGFP+ cells were present when the reporter, with disabled ORF2p endonuclease and RT activities47, was electroporated into the contralateral hemisphere (Extended Data Fig. 3c). Disparate mouse and human L1 reporters delivered by distinct methods thus retrotransposed in the PV interneuron lineage in vivo and in vitro.
Endogenous L1 expression in PV interneurons
We next measured endogenous L1 expression in PV interneurons. First, we designed a custom single-molecule RNA fluorescence in situ hybridization (FISH) probe against the monomeric 5′UTR of the mouse L1 TF subfamily8,34,44 (Extended Data Fig. 4a). With multiplexed RNA FISH, we counted cytoplasmic L1 and PV mRNA puncta in adult β-tubulin (Tub)-immunostained neurons (Fig. 2a and Extended Data Fig. 4c,d). L1 TF transcription was significantly higher in PV+ neurons, compared to PV− neurons, in CA (P = 0.009; Fig. 2b) and DG (P = 0.009; Fig. 2c). A second L1 TF 5′UTR RNA FISH probe (Extended Data Fig. 4b) also showed L1 mRNA enrichment in hippocampal and cortical PV+ neurons (Extended Data Fig. 5). Control experiments conducted in mouse and human cells confirmed the L1 TF RNA FISH probes did not detect DNA (Extended Data Fig. 4e) and were specific to L1 TF mRNA (Extended Data Fig. 4f,g). Second, we used TaqMan quantitative polymerase chain reaction (qPCR) to measure L1 expression in hippocampal PV+ neurons and PV− populations (PV−, PV−/Tub+ and PV−/Tub−) sorted from pooled neonate littermates (Supplementary Fig. 1). Three qPCR primer–probe combinations (Extended Data Fig. 4h) detecting the L1 TF 5′UTR each indicated higher expression in PV+ neurons than in PV− cells (Fig. 2d and Extended Data Fig. 6a,b). By contrast, qPCR targeting the L1 TF ORF2 region, expected to mainly detect immobile 5′ truncated L1s incorporated in other cellular mRNAs, showed no difference between PV+ and PV− cells (Extended Data Fig. 6c). Third, 5′RACE (rapid amplification of cDNA ends) upon bulk adult hippocampus or sorted neonate PV interneurons indicated the predominant transcription start sites (TSSs) of full-length L1 mRNAs initiated within L1 TF family 5′UTR sequences (Fig. 2e). The fraction of L1 TF mRNAs >6 kbp long recovered by this assay was also higher in the sorted PV interneurons (76.0%) than in the bulk hippocampus (63.8%). Fourth, immunostaining using an antibody specific to mouse L1 ORF1p (Extended Data Fig. 7) indicated that ORF1p expression (Fig. 2f) was significantly (P = 0.0001) higher in PV+ neurons than PV− neurons, in CA (Fig. 2g) and DG (Fig. 2h). Finally, given that environmental stimuli can alter neural circuits involving PV interneurons43, we analyzed L1 activity using L1 ORF1p immunostaining and L1 TF RNA FISH in adult mice housed in standard, voluntary exercise and enriched environments, and observed no consistent differences among these experimental groups (Supplementary Figs. 2 and 3). We concluded that PV interneuron enrichment for L1 TF mRNA and protein expression was robust yet not significantly impacted by exercise or environmental enrichment.
SOX6 stimulates L1 transcription
SOX transcription factors can regulate L1 promoters11,12,33. For instance, the youngest human-specific L1 (L1Hs) subfamily contains two consensus SOX motifs (first site: +470 to +477, second site: +570 to +577) known to bind SOX proteins (Fig. 3a), including SRY, SOX2 and SOX11 (refs. 11,12,33). Given that L1Hs transcriptional repression by SOX2 is generally released upon neural stem cell differentiation11,12,35, we considered whether SOX2 is replaced by another SOX protein in binding the L1 5′UTR in the committed PV interneuron lineage. Notably, SOX6 coordinates a major transcriptional program of the embryonic and adult brain downstream of LHX6, is necessary for PV interneuron development38,39, can bind the first SOX site (Extended Data Fig. 8a)48 and, of the major hippocampal neuron types, is the only SOX protein specific to PV interneurons (Extended Data Fig. 8b). cL1spa reporter assays conducted in primary mouse neurons (Extended Data Fig. 2d), analyses of human and mouse assay for transposase-accessible chromatin with sequencing (ATAC-seq) datasets24,49 (Extended Data Fig. 8a,c), LHX6 overexpression and knockout experiments50,51 (Extended Data Fig. 8d,e) and SOX6 overexpression experiments performed in cultured mouse primary neurons (Extended Data Fig. 9) each gave results congruent with SOX6 activation of both L1 expression and the PV interneuron transcriptional program.
To dissect L1 activation by SOX6, we generated an L1-mGreenLantern (L1-mGL) promoter reporter based on the 5′UTR of LRE3, another highly mobile human L1Hs element52. When this L1-mGL reporter was cotransfected into cultured HeLa cells with a SOX6-mCherry expression plasmid, 22% more GFP+ cells were observed on average than when cells were cotransfected with an mCherry control plasmid (Fig. 3b), a significant difference (P = 0.02). Inverting either LRE3 5′UTR SOX site, or scrambling the second site, did not reduce L1-mGL activity (Fig. 3a,b). Scrambling the first SOX site, however, reduced the percentage of GFP+ cells by 18% (P = 0.004), without SOX6 overexpression, and this reduction was greater (29%, P = 0.004) when cells were cotransfected with the SOX6-mCherry plasmid (Fig. 3b). In agreement with prior reports11,12, cotransfection with a SOX2 expression plasmid fully negated SOX6 activation of the L1-mGL reporter (Fig. 3c). Next, employing an L1-EGFP retrotransposition reporter2,13,53 to assay L1.3 (refs. 41,42) mobility in cultured HeLa cells, we found that stable SOX6 overexpression significantly (46%, P = 0.049) increased the percentage of GFP+ cells. Scrambling the first SOX site consistently reduced L1.3 retrotransposition efficiency by ~50%, in HeLa cells with and without stable SOX6 overexpression (Fig. 3d) and in cultured PA-1 embryonal carcinoma cells (Fig. 3e). These results demonstrated SOX6 activation of L1 promoter and retrotransposition reporters, dependent on the first L1Hs 5′UTR SOX site and attenuated by SOX2 expression.
L1 promoter hypomethylation in PV interneurons
Despite apparent potential for SOX6-mediated L1 transcriptional activation, DNA methylation in somatic cells is expected to silence L1 promoters17,25,26,27,28,29,30. Therefore, to further probe the apparent specificity of L1 transcription to PV interneurons, we performed L1 TF 5′UTR monomer bisulfite sequencing25,46,54 on neonate hippocampal cell populations. L1 TF was significantly (P = 0.02) less methylated on average in PV+ neurons (83.9%) than in PV− neurons (91.8%) (Fig. 4a,b). Unmethylated L1 TF monomers were observed only in PV+ neurons (Fig. 4a,c). Dnmt1, Dnmt3a and Mecp2 effect methylation-associated transcriptional repression in PV interneurons30,55. These genes all expressed markedly less mRNA in neonate PV+ neurons than in PV− neurons (Fig. 4d,e and Supplementary Fig. 4a). MeCP2 protein expression was, on average, 10.5% lower in adult PV+ neurons compared to PV− neurons (P = 0.0007) (Supplementary Fig. 4b,c). L1 repression thus appeared broadly relaxed in PV interneurons.
Long-read Oxford Nanopore Technologies (ONT) sequencing allows genome-wide analysis of retrotransposon family methylation, as well as that of individual retrotransposon loci25,46,56. We ONT sequenced PV+, PV−, PV−/Tub+ and PV−/Tub− cells from neonatal hippocampus samples at ~16× average genome-wide depth, and ~29× and ~34× respectively for the PV+ and combined PV− populations (Supplementary Table 1). Genome wide, DNA methylation was consistently, if subtly, lower in PV+ neurons than in PV− cells (Fig. 4f). Among the potentially mobile retrotransposons surveyed, only the L1 TF subfamily was significantly (P = 0.0001) less methylated in PV+ cells than in the PV− populations (Fig. 4f). L1 loci supplied the vast majority (80%) of differentially methylated retrotransposons (Fig. 5a). Comparing PV+ and PV− cells, all 638 differentially methylated (P < 0.01) full-length L1 TF loci were also less methylated in the former population (Supplementary Table 2). Those genes containing at least one such L1 were significantly enriched (>20-fold, P < 0.01) for neurodifferentiation, regulation of GABAergic synaptic signaling, and cell–cell adhesion gene ontologies.
Chimeric L1 transcripts can alter neuron complexity
The TF subfamily can be further divided into three subgroups, denoted TFI, TFII and TFIII (Fig. 5d), where TFIII is the oldest and diverges in its 5′UTR when compared to TFI/II (refs. 57,58). We found by far the highest fraction (82%) of strongly demethylated L1s corresponded to the TFIII subfamily (Fig. 5b–d). Strikingly, we identified significantly (P < 0.01) hypomethylated L1 TFIII copies with intact ORFs in the introns of genes expressed in PV interneurons, such as Caps2 (calcyphosphine 2)59, Chl1, Erbb4 and Npsr1 (Fig. 5c,e, Extended Data Figs. 8b and 10 and Supplementary Table 2). In the case of Caps2, which expresses a calcium-binding protein in the same family as PV59, the L1 5′UTR was completely unmethylated in numerous PV+ neurons (Fig. 5e). Analysis of ENCODE PacBio long-read hippocampus transcriptome sequencing60 revealed a transcript initiated within and antisense58 to the L1 5′UTR and spliced downstream into a Caps2 exon on the same strand. We termed this chimeric transcript Caps2.L1. By 5′RACE and reverse-transcription PCR (RT-PCR), we reliably detected Caps2.L1 in adult and neonate hippocampus tissue, and in PV+ cells, but not in PV− cells (Fig. 5e). The predicted ORF for Caps2.L1 was in frame with that of the annotated canonical Caps2 transcript, called here Caps2.1, and incorporated a novel N-terminal sequence (Fig. 5e).
When introduced as an expression vector (Fig. 6a) into mouse N2a neuroblastoma cells, a tractable model of neurodifferentiation, Caps2.L1 significantly increased neuron branching and neurotrophin-3 (Ntf3) release, compared to Caps2.1 and controls (Fig. 6a–d). These results suggested that Caps2.L1 enhanced neuron morphological complexity and function. As the annotated Caps2 promoter was fully methylated in PV+ neurons (Fig. 5e), we concluded Caps2.L1 is probably the canonical Caps2 transcript isoform in mouse PV+ neurons, previously overlooked due to its initiation in the L1 TFIII sequence. Finally, including the Caps2 example, we identified 43 young mouse L1s whose 5′UTR promoted expression of a spliced transcript annotated by GenBank or detected by the abovementioned ENCODE PacBio transcriptome dataset (Supplementary Table 3). These results suggested unmethylated L1s can promote transcription of genes required for mouse PV interneuron development and function.
Discussion
This study reveals L1 activity in the mouse PV interneuron lineage, most likely governed by SOX6 (Fig. 7). PV interneurons are ‘node’ cells that connect neural circuits associated with memory consolidation and other core cognitive processes36,37. The potential for L1 retrotransposition as a consequence of PV interneuron genes incorporating unmethylated mobile L1s is notable given the proposed roles for stochastic L1-mediated genome mosaicism in the brain11. Our results do not, however, preclude other neuronal lineages or brain regions from expressing L1 mRNAs and proteins, or supporting L1 retrotransposition. Engineered L1 reporter experiments have thus far generated data congruent with endogenous L1 mobility in the early embryo7,8,10, neurons11,12,15,16,17,18 and cancer2,27. While we and others have mapped endogenous L1 retrotransposition events in human15,16,17 and macaque18 neurons, the composition of the L1 TF 3′UTR appears to severely impede such analyses in mouse8,54. A cL1spa mouse model could in the future be used to evaluate mouse L1 mobilization in the PV interneuron lineage in vivo.
As highlighted here, retrotransposons can be integrated into transcriptional programs guiding cell fate1,19,20,21,22,23. Hypomethylated L1s could also influence the regulatory architecture of adjacent genes by attracting SOX proteins and their cofactors33. DNA methyltransferase activity appears to be moderately attenuated in PV interneurons. However, to explain L1 hypomethylation in this context, we favor a model where some L1 loci escape embryonic methylation and are transcribed17,25. Histone modifications associated with active transcription, perhaps enhanced by SOX6, then counteract their methylation in PV interneurons61,62. These heritable ‘escapee’ L1s, along with their transcriptional, regulatory and mobilization potential, are subject to evolutionary selection. Somatic retrotransposition could hence signify niches of L1 cis-regulatory innovation, as found here in the PV interneuron lineage.
Methods
Cultured cell L1 retrotransposition reporter assay
L1 retrotransposition efficiency was measured via an EGFP L1 reporter system in cultured HeLa and PA-1 cells, as described previously13,17,53. These assays employed the pCEP4_L1_eGFPI plasmid17 and tested the mobility of wild-type and RT mutant2 (D702A) L1.3 (refs. 41,42) sequences expressed from the native L1 promoter, as well as wild-type L1.3 sequences with their 5′UTR SOX binding sites scrambled or inverted33. Each SOX site mutation was introduced by fusion PCR to build an L1 fragment flanked by NotI (5′) and AgeI (3′) sites from two amplicons with overlapping primers that included the desired mutation. The complete amplicon was cloned within these sites in the original backbone, and its sequence was verified by capillary sequencing. In this L1 reporter17, the entire L1 3′UTR, with the thymine base deleted from within its native polyadenylation signal, preceded an EGFP reporter cassette activated only upon retrotransposition. EGFP expression was driven by a CBh (in HeLa) or cytomegalovirus (CMV) promoter (in PA-1). GFP+ cells were counted via flow cytometry. The L1 plasmid backbone incorporated a puromycin resistance gene. Three biological replicate assays were performed, each consisting of three wells per condition (technical replicates), on different days.
HeLa-JVM cells2 (obtained from the laboratory of John V. Moran) were cultured at 37 °C and 5% CO2 in HeLa complete medium (Dulbecco’s modified Eagle medium (DMEM); Life Technologies, cat. no. 11960044) supplemented with 10% fetal bovine serum (FBS; Life Technologies, cat. no. 10099141), 1% GlutaMAX (Life Technologies, cat. no. 35050061) and 1% penicillin–streptomycin (Life Technologies, cat. no. 15140122). Cells were passaged at 70–80% confluency using 0.25% trypsin–EDTA (Life Technologies, cat. no. 25200072). Briefly, 5 × 104 HeLa cells were seeded per well of a six-well plate. Eighteen hours later, cells were transfected with 1 µg L1 plasmid per well using 3 µl FuGENE HD transfection reagent (Promega, cat. no. E2311) and 97 µl Opti-MEM (Life Technologies, cat. no. 31985047) per well according to the manufacturer’s protocol. Twenty-four hours post-transfection, the medium was replaced with HeLa complete medium. No puromycin selection was performed. The medium was replaced every other day, and cells were collected 6 days post-transfection by trypsinization, resuspended in sterile phosphate-buffered saline (PBS) and analyzed on a BD FACSymphony A5 SE Cell Analyzer (BD Biosciences) using FlowJo (version 10.8.1, BD Biosciences) to determine the percentage of GFP+ cells. Untransfected HeLa cells were used to set the GFP− signal level in flow cytometry.
To assess L1 retrotransposition coincident with stable SOX6 overexpression, human SOX6 complementary DNA (NM_001145819.2) driven by a CBh promoter and mCherry driven by an elongation factor 1α short (EFS) promoter were inserted using BsrGI and Acc65I restriction enzymes (NEB, cat. nos. R3575S and R0599S, respectively) into the XLone-GFP plasmid (Addgene, cat. no. 96930). HeLa cells were cotransfected with this SOX6 expression plasmid and a hyperactive Piggybac transposase (HyPBase, a kind gift from the laboratory of Jose M. Polo) at a 3:1 ratio. The Piggybac plasmid harbored a blasticidin resistance gene, allowing transfected cells to be selected using 20 µg ml−1 of blasticidin for 2 weeks post-transfection to establish a stable SOX6-overexpressing HeLa cell line.
PA-1 cells were purchased from the American Type Culture Collection, cultured at 37 °C and 5% CO2, and maintained in Minimum Essential Medium (MEM) with GlutaMAX supplement (Life Technologies), 10% heat-inactivated FBS, 1× nonessential amino acids (Life Technologies) and 100 U ml−1 penicillin–streptomycin solution (Life Technologies). A total of 2 × 105 PA-1 cells were seeded per well of a six-well plate and transfected as per the HeLa cell experiments above. The medium was replaced daily with PA-1 complete medium supplemented with 0.5 µg ml−1 puromycin the day after transfection, 1 µg ml−1 puromycin each day afterwards and 500 nM trichostatin A (Sigma, cat. no. T8552) 12 h before flow cytometry on day 6 after transfection. Flow cytometry employed a BD Accuri C6 Flow Cytometer (BD Biosciences). No untransfected PA-1 cells survived treatment with puromycin, ensuring that untransfected cells did not contribute to GFP− cells on the day of analysis. Untransfected PA-1 cells not treated with puromycin were used to set the GFP− signal level in flow cytometry. As a quality check, plasmid transfection efficiencies were calculated by cotransfecting with pCEP-EGFP.
cL1spa retrotransposition in primary neuronal cultures
We designed a Cre-LoxP conditional L1 retrotransposition reporter, cL1spa, based on a variant of the mobile L1 TF element L1spa (refs. 44,63). Here, L1spa was contained in a pCEP4 backbone, with ORF1p corrected at two amino acid positions to match the L1 TF subfamily consensus sequence, and had an mCherry indicator cassette driven by an EF-1ɑ promoter embedded in its 3′UTR45,46. The G-rich region of the 3′UTR (nucleotides 7,260–7,416) was moved downstream of the reporter cassette, cloned between two BamHI sites before the SV40 polyadenylation signal45. To prohibit full-length L1spa mRNA production in the absence of Cre recombinase, between the L1spa 5′UTR promoter and ORF1 we inserted a LSL cassette containing two LoxP sequences (ATAACTTCGTATAGCATACATTATACGAAGTTAT) flanking a 786 bp sequence containing three SV40 polyadenylation signals and followed by a Kozak consensus sequence (Vector Builder). We synthesized a fragment containing the 5′UTR, LoxP-Stop-LoxP and ORF1 (GenScript) sequences, flanked by Not1 and PacI restriction sites, and cloned it into the L1spa backbone. We used this construct to electroporate primary neuronal cells using a Neon NxT Electroporation System (Thermo Fisher Scientific) and the Neon Transfection System 10 µl Kit (Thermo Fisher Scientific, cat. no. MPK1025,) at 1,500 V, 10 ms and three pulses. A total of 2.5 µg of plasmid was used per electroporation, with two electroporations plated per 12-well plate well.
Primary neuronal cultures were prepared from embryonic day (E)18 mice by dissecting the cortices and placing them in a papain solution (Worthington Biochemical, cat. no. LS003126) dissolved in a basic culture medium (Neurobasal medium (Gibco, cat. no. 21103-049), GlutaMAX (Gibco, cat. no. 35050061) and penicillin–streptomycin (5,000 U ml−1; Gibco, cat. no. 15070063)). Cortices were incubated for 20 min at 37 °C with pipette mixing every 5 min. Cells were then filtered through a 70 µm cell strainer into an inactivation solution containing albumin-ovomucoid inhibitor (Worthington, cat. no. LK003182), DNAseI (1 mg ml−1; Sigma, cat. no. DN-25) and basic culture medium with 5% FBS. Cells were centrifuged at 400g for 2 min at room temperature and then resuspended in 5% FBS culture medium and counted. A total of 250,000 cells were washed with PBS twice and used for one electroporation. Cells were then plated on coverslips coated with poly-d-lysine (1 mg ml−1; Sigma, P64407). Four days post-electroporation, cells were transduced with a lentiviral construct expressing Cre-T2A-TagBFP driven by an EFS moderate EF-1α core promoter (Vector Builder). Four days post-transduction, cells were processed for either immunostaining or DNA extraction. For immunostaining, culture medium was removed, and cells were immediately fixed in 4% paraformaldehyde (PFA) (20 min, 4 °C) and then washed with PBS. Cells were permeabilized for 5 min with PBT (PBS with 0.5% Triton) and then incubated with blocking buffer (10% normal donkey serum (Jackson ImmunoResearch, cat. no. AB2337258) in PBT) for 1 h at room temperature. Cells were incubated overnight with the following primary antibodies: goat anti-tdTomato (Sicgen, cat. no. AB8181, 1:2,000), mouse anti-Tub (Sigma, cat. no. T4026, 1:1,000) and either rabbit anti-Cre (Cell Signaling, cat. no. 15036, 1:500) or rabbit anti-PV (Swant, PV27, 1:500). Cells were washed with PBS for 15 min, three times at room temperature and then incubated with secondary antibodies: Cy3 donkey anti-goat (Jackson ImmunoResearch, cat. no. 715-165-150, 1:500), Alexa Fluor 488 donkey anti-mouse (Jackson ImmunoResearch, cat. no. 715-546-150, 1:1,000) and Alexa Fluor 647 donkey anti-rabbit (Jackson ImmunoResearch, cat. no. 711-606-152, 1:1,000). Hoechst 33258 (Sigma, cat. no. B2883) was added to the secondary antibody mix to stain nuclei. Cells were washed with PBS for 15 min, three times at room temperature, then air dried and mounted using an aqueous fluorescence mounting medium (Agilent Dako, cat. no. S302380-2). Cells were visualized and imaged using an Olympus UPLXAPO 20×/0.8 numerical aperture (NA) air objective on a spinning-disk confocal microscope (SpinSR10; Olympus) built around an Olympus IX3 body and equipped with two ORCA-Fusion BT sCMOS cameras (Hamamatsu Photonics K.K.) and controlled by Olympus cellSens software.
Genomic DNA was phenol–chloroform extracted. Oligonucleotide PCR primers spanning the mCherry cassette exon–exon junction (Supplementary Table 4) were purchased from Integrated DNA Technologies. PCR reactions were prepared using the MyTaq DNA polymerase kit (Bioline, cat. no. BIO-21111). Reactions contained a 5× MyTaq Buffer, 10 pmol of each primer, 1 µl DNA input template (20 ng) and 0.2 µl Taq polymerase in 25 μl final volume. Cycling conditions were as follows: 95 °C for 2 min, followed by 30 cycles of 95 °C, 15 s; 58 °C, 15 s; 72 °C, 50 s and extension 72 °C, 5 min. PCR products were separated on 1.5% agarose gel.
Cultured cell L1 promoter reporter assay
The effects of SOX site mutations on L1 promoter activity were assessed in cultured HeLa-JVM cells using the LRE3 (ref. 52) 5′UTR to drive expression of a mGreenLantern64 (mGL) green fluorescent protein. The native LRE3 5′UTR and SOX site mutants were ordered as synthetic double-stranded DNA gene blocks from Integrated DNA Technologies and incorporated EcoRI and BamHI restriction sites at their 5′ and 3′ ends, respectively. These sites were used to clone the LRE3 5′UTR into an expression vector, resulting in an L1 promoter reporter. SOX protein overexpression was evaluated using the L1 promoter reporter in HeLa cells in two experiments. In the first experiment, cells were seeded at 1 × 105 cells per well in a six-well plate. Sixteen hours after seeding, cells were cotransfected with 3 µl FuGENE HD, 97 µl Opti-MEM and a 1:1 ratio of the L1 promoter reporter and a plasmid encoding the human SOX6 (NM_001145819.2) cDNA, driven by a CBh promoter and including an mCherry cDNA under the control of an EFS promoter to assess transfection efficiency (Vector Builder). This plasmid, without SOX6, was used as a control. The transfection medium was replaced after 24 h with DMEM-complete medium and the cells were incubated for 24 h, after which the percentage of GFP+ cells was determined by flow cytometry. In the second experiment, WT and stably SOX6-overexpressing cells were seeded at 1 × 105 cells per well in a six-well plate. Sixeen hours after seeding, both cell lines were cotransfected with 3 µl FuGENE HD, 97 µl Opti-MEM and a 1:1 ratio of the L1 promoter reporter and a plasmid encoding SOX2 cDNA (NM_003106.4) under a CBh promoter (Vector Builder). This plasmid also included an EFS promoter driving the expression of mCherry to monitor transfection efficiency. The same plasmid without SOX2 was used as a control. Twenty-four hours later, the transfection medium was replaced with DMEM-complete medium and cells were incubated for 48 h, after which the percentage of GFP+ cells was analyzed by flow cytometry (BD FACSymphony A5 SE Cell Analyzer, BD Biosciences) as above.
SOX6 expression assay in primary neuronal cultures
Primary neuronal cultures were transduced at day 5 post plating with 1 µl per well of 12-well plate using either adeno-associated virus of serotype 2 (AAV2) encoding the mouse SOX6 (NM_011445.4) cDNA or mCherry control at a concentration of >2 × 1011 genome copies (GC) per milliliter. SOX6 expression was driven by a CBh promoter, and the construct included an mCherry cassette under the control of an EFS promoter to assess transduction efficiency (Vector Builder). Twenty-four hours after transduction, RNA was extracted using TRIzol reagent (Invitrogen, cat. no. 15596026) following the manufacturer’s protocol. SYBR Green qPCR was prepared using the Power SYBR Green RNA-to-CT 1 step kit (Applied Biosystems, cat. no. 4391112) and specific SOX6 primers (mSOX6_F and mSOX6_R) to assess SOX6 overexpression. Reactions contained a 2× Power SYBR Green RT-PCR Mix, 10 pmol of each primer, 1 µl RNA input template and 1× RT enzyme mix in a 10 μl final volume. Cycling conditions were as follows: 48 °C for 30 min, 95 °C for 10 min, followed by 40 cycles of 95 °C, 15 s; 60 °C, 1 min. To assess potential DNA contamination, an L1 TF qPCR using primers L1Md_5UTR_F and L1Md_5UTR_R was performed with and without RT. A three or more cycle difference between experiments run with and without RT, and detection after cycle 30 in the latter, was considered as non-DNA-contaminated RNA. A TaqMan assay was also performed using Applied Biosystems custom L1 and 5S ribosomal RNA (rRNA) TaqMan MGB probes, as listed in Supplementary Table 4. TaqMan qPCR reactions contained: 4× TaqPath 1-Step RT-qPCR multiplex reaction master mix (ThermoFisher, cat. no. A28521), 4 pmol of each primer, 1 pmol probe and 1 µl RNA (100–150 ng) input template in a 10 µl final volume. Cycling conditions were as follows: 37 °C for 2 min; 50 °C for 15 min; 95 °C for 2 min, followed by 40 cycles of 95 °C, 3 s; 60 °C, 30 s. TaqMan assays for L1 probe conjugated with VIC (2’-chloro-7’-phenyl-1,4-dichloro-6-carboxyfluorescein) were multiplexed with an assay for 5S rRNA control, conjugated to 6FAM (6-Carboxyfluorescein) fluorophores. Primer/probe sequences and the associated detection channels are listed in Supplementary Table 4. Seventy-two hours after transduction, the culture medium was removed, and cells were fixed in 4% PFA (20 min, 4 °C) and washed with PBS. Immunohistochemistry was then performed as for mouse primary neuronal cultures. For ORF1p immunostaining analysis, Z-stack images were acquired using the SoRa super-resolution disk and 3.2× magnification. Image processing and analysis post-acquisition for the morphology analysis were performed using Fiji for Windows (ImageJ 1.52d). ORF1p intensity analysis in mCherry+ cells was performed using Imaris 9.5.1 (Bitplane, Oxford Instruments). Integrated mean intensity was calculated as equal to area times mean intensity value and normalized to the mCherry control for the respective experiment.
L1-EGFP transgenic mice
To trace retrotransposition of an engineered L1 reporter in vivo, we generated a new transgenic L1-EGFP mouse line harboring L1.3, with epitope tags on ORF1p and ORF2p and an EGFP indicator cassette2,13 embedded in its 3′UTR. To assemble the L1 transgene, we cloned the NotI-BstZ17I fragment from pJM101/L1.3-ORF1-T7-ORF2-3×FLAG (containing T7 gene 10 epitope tag on the C-terminus of ORF1 and a 3×FLAG tag on the C-terminus of ORF2) into p99-GFP-LRE3, yielding p99-GFP-L1.3-ORF1-T7-ORF2-3×FLAG. In p99-GFP-L1.3-ORF1-T7-ORF2-3×FLAG, transgene transcription was driven by the native L1.3 promoter, with an SV40 polyadenylation signal (pA) located downstream of the EGFP retrotransposition indicator cassette. The EGFP cassette was equipped with a CMV promoter and a herpes simplex virus type 1 (HSV) thymidine kinase (TK) polyadenylation signal, facilitating EGFP expression upon genomic integration via retrotransposition. In preparation for pronuclear injection, EGFP-L1.3-ORF1-T7-ORF2-3×FLAG was released by digestion with Not1 and MluI restriction enzymes, separated from the vector backbone on a 0.7% agarose gel, purified by phenol–chloroform extraction and eluted in microinjection buffer (7.5 mM Tris–HCl and 0.15 mM EDTA pH 7.4). Transgenic L1-EGFP mice were produced by the Transgenic Animal Service of Queensland, University of Queensland, using a standard pronuclear injection protocol. Briefly, zygotes were collected from superovulated C57BL/6 females. The microinjection buffer containing EGFP-L1.3-ORF1-T7-ORF2-3×FLAG was then transferred to the zygote pronuclei. Successfully injected zygotes were transplanted into the oviducts of pseudopregnant females. Primers flanking the EGFP cassette were used to screen potential founders by PCR (Supplementary Table 4). Identified founder L1-EGFP animals were bred on a C57BL/6 background. All procedures were followed as approved by the University of Queensland Animal Ethics Committee (TRI/UQ-MRI/381/14/NHMRC/DFG and MRI-UQ/QBI/415/17).
Histology
Adult C57BL/6 and transgenic L1-EGFP mice (12 weeks) were anesthetized using isoflurane and perfused intracardially with PBS and 4% PFA. CD1 pups, having been electroporated in utero with mouse L1-EGFP plasmids, were killed at postnatal day 10 by cervical dislocation. CBA×C57BL/6 mice (12 weeks), intended for RNA FISH, were injected intraperitoneally with sodium pentobarbital (50 mg kg−1), followed by cervical dislocation to ensure killing. All brains were dissected and fixed in PFA for 24 h. For cryopreservation, fixed brains were immersed first in 15% sucrose and then 30% sucrose to submersion, and embedded in optimal cutting temperature compound and stored at −80 °C. C57BL/6 and transgenic L1-EGFP brains were sectioned on a cryostat (Leica, settings object temperature (OT) −20 °C, chamber temperature (CT) −20 °C) at 40 µm thickness. Free-floating sections were collected in PBS and stored at 4 °C. CBA×C57BL/6 brains were sectioned on a cryostat (Leica, settings OT −22 °C, CT −22 °C) at 30 µm thickness. Free-floating sections were collected in cryoprotectant (25% glycerol and 35% ethylene glycol, in PBS) and immediately stored at −20 °C.
Tissue processing and immunofluorescent staining with primary and secondary antibodies were carried out as described previously65. Primary antibodies and dilutions were as follows: rabbit anti-GFP, 1:500 (Thermo Fisher A11122); chicken anti-GFP, 1:500 (Millipore AB16901); mouse anti-T7, 1:500 (Millipore, cat. no. 69522); rabbit anti-T7, 1:500 (Millipore, AB3790); goat anti-tdTomato, 1:1,000 (Sicgen, cat. no. AB8181); mouse anti-NeuN, 1:250 (Millipore, cat. no. MAB377); guinea pig anti-NeuN, 1:250 (Millipore, cat. no. ABN90), rabbit anti-Gad65/67 (Gad1), 1:500 (Sigma, cat. no. G5163); mouse anti-PV, 1:2,000 (Sigma, cat. no. P3088); rabbit anti-β tubulin III (Tub), 1:500 (Sigma, cat. no. T2200); rabbit anti-MeCP2, 1:500 (Abcam, cat. no. ab2828), rabbit anti-ORF1p (Abcam, cat. no. ab216324). Secondary antibodies and dilutions were as follows: donkey anti-guinea pig Dylight 405, 1:200 (Jackson Immunoresearch, cat. no. 706475148); donkey anti-mouse Dylight 405, 1:200 (Jackson Immunoresearch, cat. no. 715475150); donkey anti-chicken Alexa Fluor 488, 1:500 (Jackson Immunoresearch, cat. no. 703546155); donkey anti-rat Alexa Fluor 488, 1:500 (Jackson Immunoresearch, cat. no. 712546150); donkey anti-rabbit Alexa Fluor 488, 1:500 (Thermo Fisher, cat. no. A21206); donkey anti-goat Alexa Fluor 594, 1:500 (Jackson Immunoresearch, cat. no. 705586147); donkey anti-rabbit Cy3, 1:200 (Jackson Immunoresearch, cat. no. 711165152); donkey anti-mouse Cy3, 1:500 (Jackson Immunoresearch, cat. no. 715165150); donkey anti-guinea pig Alexa Fluor 647, 1:500 (Millipore, cat. no. AP193SA6); donkey anti-mouse Alexa Fluor, 1:500 (Jackson Immunoresearch, cat. no. 715606150). For nuclei labeling, BisBenzimide H33258 (Sigma, cat. no. B2883) was used. For blocking serum, normal donkey serum (Jackson Immunoresearch, cat. no. 017000121) was used.
Imaging of brain sections
EGFP+ cells were imaged on a Zeiss LSM510 confocal microscope. Acquisition of high magnification, Z-stack images was performed with Zen 2009 software. Images of EGFP, NeuN and PV immunostaining for quantification were taken from hippocampal and adjacent cortical areas using a Zeiss AxioObserver Z1 microscope and Zen 2009 software, equipped with an ApoTome system and a 10× objective. Visualization and imaging of EGFP, NeuN and PV in in utero electroporated mice was performed using a Zeiss Plan-Apochromat 20×/0.8 NA air objective and a Plan-Apochromat 40×/1.4 NA oil-immersion objective on a confocal/two-photon laser-scanning microscope (LSM 710, Carl Zeiss Australia) built around an Axio Observer Z1 body and equipped with two internal gallium arsenide phosphide (GaAsP) photomultiplier tubes (PMTs) and three normal PMTs for epi- (descanned) detection and two external GaAsP PMTs for nondescanned detection in two-photon imaging, and controlled by Zeiss Zen Black software.
RNA FISH for sections of hippocampus and adjacent cortical areas, as well as MeCP2, NeuN and PV immunostainings were imaged on a spinning-disk confocal system (Marianas; 3I, Inc.) consisting of a Axio Observer Z1 (Carl Zeiss) equipped with a CSU-W1 spinning-disk head (Yokogawa Corporation of America), ORCA-Flash4.0 v2 sCMOS camera (Hamamatsu Photonics), using a 63×/1.4 NA C-Apo objective and a 20×/0.8 NA Plan-Apochromat objective, respectively. All Z-stack spinning-disk confocal image acquisition was performed using SlideBook 6.0 (3I, Inc.).
PV stereology was performed on an upright Axio Imager Z2 fluorescent microscope (Carl Zeiss) equipped with a motorized stage and Stereo Investigator software (MBF Bioscience). Contours were drawn on the basis of 4′,6-diamidino-2-phenylindole (DAPI) staining using a 5×/0.16 NA objective. Counting was performed on a 10×/0.3 NA objective. All image processing and analysis post acquisition was performed using Fiji for Windows (ImageJ 1.52d). ORF1p was imaged using an Olympus UPLXAPO 20×/0.8 NA air objective on a spinning-disk confocal microscope (SpinSR10; Olympus).
Single-molecule RNA FISH
Two custom RNAscope probes were designed against the RepBase L1 TFI subfamily consensus sequence (Extended Data Fig. 4). L1 probe A (design #NPR-0003768, Advanced Cell Diagnostics, cat. no. ADV827911C3) targeted the L1 TFI 5′UTR monomeric and nonmonomeric region (consensus positions 827–1,688). L1 probe B (design #NPR-000412, Advanced Cell Diagnostics, cat. no. ADV831481C3) targeted the L1 TFI 5′UTR monomeric region (consensus positions 142–1,423). Weak possible off-target loci for probe A and B comprised the pseudogene Gm-17177, two noncoding RNAs (LOC115486508 for probe A and LOC115490394 for probe B) and a minor isoform of the Ppcdc gene (only for probe A), none of which was expressed beyond very low levels or with specificity to PV+ neurons. Using the L1 TF RNAscope probes, we performed FISH on fixed, frozen brain tissue according to the manufacturer’s specifications (RNAscope Fluorescent Multiplex Reagent Kit part 2, Advanced Cell Diagnostics, cat. no. 320850) and with the following modifications: 30 μm coronal sections instead of 15 μm, and boiling in target retrieval solution for 10 min instead of 5 min. To identify neurons, we performed immunohistochemistry using a rabbit anti-Tub antibody (Sigma, cat. no. T2200) and donkey anti-rabbit Cy3 secondary antibody (Jackson Immunoresearch, cat. no. 711165152) following a previously described protocol65. To identify PV+ neurons we employed a validated mouse PV RNAscope probe (Mm-Pvalb-C2, Advanced Cell Diagnostics, cat. no. ADV421931C2). Probes for the ubiquitously expressed mouse peptidylprolyl isomerase B (Ppib) gene and Escherichia coli gene dapB were used as positive and negative controls, respectively, for each FISH experiment.
Cell quantifications
We analyzed four hippocampal sections per animal for each L1 TF 5′UTR probe (Extended Data Fig. 4) using Imaris 9.5.1 (Bitplane, Oxford Instruments). To render three-dimensional (3D) visualizations for a given neuron, we used Tub and DAPI staining to outline its soma and nucleus along Z-stack planes where the cell was detected. We set voxels outside the cell, and inside the nucleus, to a channel intensity value of zero to only retain cytoplasmic L1 mRNA signal and avoid nuclear L1 DNA. We then used the Imaris Spots module to detect L1 mRNA puncta and calculated the number of L1 spots within the cytoplasm in PV+/Tub+ versus PV−/Tub+ neurons.
We quantified MeCP2 protein expression using Imaris 9.5.1 (Bitplane, Oxford Instruments), and we analyzed two hippocampal sections per animal. For each cell, we drew the contours of NeuN immunostaining along the relevant Z-stack planes and rendered a cell 3D visualization. We then calculated the mean MeCP2 channel intensity in PV+/NeuN+ and PV−/NeuN+ neurons. For PV stereology, we stained and analyzed every 12th hippocampal section per animal. Cell density was calculated using the total number of PV+ cells and the total subregion area from approximately six sections per animal.
To quantify EGFP+ cells we stained and analyzed every 12th hippocampal section (again, ~6 sections per animal). To visualize colocalization, we used Adobe Photoshop CC 2017. We counted EGFP+, EGFP+/NeuN+ and EGFP+/PV+ cells across the hippocampus and adjacent cortex. The average number of double-labeled cells per 100 mm2 was determined for each animal. All statistical analyses were performed using Prism (v9.5.1).
To quantify L1 ORF1p expression, we analyzed two hippocampal sections per animal. We used Imaris 9.5.1 (Bitplane, Oxford Instruments) Surface function to create DG and CA regions of interest and mask selection function to apply the surface to NeuN, ORF1p and PV channels. We then used the spots function (automated cell detection for minimum diameter of 13 µm) to identify and quantify NeuN+ neurons in each area. We calculated the mean ORF1p and PV channel intensities within each NeuN+ neuron. We defined ORF1p+ and PV+ neurons as those with a mean intensity above a background spot mean intensity.
L1 TF 5′RACE
Total RNA was extracted from pooled C57BL/6 bulk adult (12 weeks) hippocampus tissue and sorted PV+ neurons obtained from pooled neonate (postnatal day 1 or 2) hippocampus tissue using TRIzol. 5′RACE was performed using the 5′RACE module of the Takara SMARTer 5′/3′ RACE Kit (cat. no. 634858) according to the manufacturer’s protocol. Ten nanograms of total RNA was used as input for each reaction, and two reactions from independent experiments were performed. 5′RACE cDNA was PCR amplified using an L1-specific primer (Supplementary Table 4) and the 5′RACE universal primer provided in the Takara kit. Thirty-five PCR cycles were performed as follows: 94 °C for 30 s, 67 °C for 30 s, 72 °C for 3 min. PCR products were visualized on a 1% agarose gel. The resultant smear was excised, and PCR fragments were purified using conventional phenol–chloroform DNA extraction. Iso-Seq template preparation using the Iso-Seq Express kit followed by PacBio SMRT Cell sequencing on a PacBio Sequel II platform was performed by the Australian Genome Research Facility. Four samples (two replicates each of bulk and PV+ hippocampus cells) were multiplexed on a single SMRT cell. Reads were aligned to the mouse reference genome (mm10) using minimap2 version 2.20 (ref. 66) (parameters -t 96 -N 1000 -p 0.95 -ax splice:hq -uf) and sorted with samtools version 1.12 (ref. 67). Uniquely mapped reads, that is, those that aligned to one genomic position only at their best alignment score and as a primary alignment, were retained if an L1-specific primer and a 5ʹRACE universal primer were located at each of their termini. Reads were then assigned to the full-length L1 TFI elements they overlapped, with alignments required to terminate within the L1 body. The start positions of these alignments within the 5′UTR or upstream of the L1 were then recorded as putative TSSs supported by at least one read. Replicates gave very similar results and were pooled for display purposes.
Nanopore methylation analysis
Genomic DNA was phenol–chloroform extracted from PV+ and PV− (Supplementary Fig. 1) populations purified from ten neonate (P0) littermate hippocampus sample pools. Additional DNA was obtained from the PV+, PV−, PV−/Tub+ and PV−/Tub− populations of another neonate pool. DNA samples were sheared to ~10 kb average size, prepared as barcoded libraries using a Ligation Sequencing Kit (ONT, SQK-LSK109), and sequenced on an ONT PromethION platform (Garvan Sequencing Platform). Bases were called in SLOW5 format68 with Buttery-eel69 using Guppy 4.0.11 (ONT) and reads aligned to the mm10 reference genome using minimap2 version 2.20 (ref. 66) and samtools version 1.12 (ref. 67). Reads were indexed and per-CpG methylation calls generated using nanopolish version 0.13.2 (ref. 70). Methylation likelihood data were sorted by position and indexed using tabix version 1.12 (ref. 71). Methylation statistics for the genome divided into 10 kbp bins, and reference retrotransposons defined by RepeatMasker coordinates (http://www.repeatmasker.org/), were generated using MethylArtist version 1.0.4 (ref. 72), using commands db-nanopolish, segmeth (parameters:–excl_ambig and–primary_only) and segplot with default parameters. Only full-length (>6 kbp) L1s were included, with methylation measured on 5′UTR CpGs. Methylation profiles for individual loci were generated using the MethylArtist command locus, with a 28 bp sliding window, and composite profiles with the MethylArtist command composite, with parameters used elsewhere25. To identify individual differentially methylated retrotransposons (Supplementary Table 2), we required elements to have at least four reads and 20 methylation calls in each sample being compared. Comparisons were carried out via Fisher’s exact test using methylated and nonmethylated call counts, with significance defined as a Bonferroni-corrected P value of less than 0.01. Gene Ontology enrichment analysis was performed on genes containing at least one differentially methylated L1 TF sequence with PANTHER, using Fisher’s exact test and Bonferroni correction.
Caps2.L1 expression assays in N2a cells
Differentiating mouse N2a (neuro-2a) neuroblastoma cells (American Type Culture Collection, cat. no. CCL-131) were used to assess the impact of Caps2.L1 expression on neuronal phenotype. To generate a Caps2.L1 expression plasmid, we GenScript gene synthesized the Caps2.L1 chimeric transcript, as detected by ENCODE long-read PacBio sequencing of bulk hippocampus tissue (ENCLB505CBY) and cloned it to be under the control of a CAG promoter (Vector Builder). To create a same-size control plasmid, we destroyed the KpnI restriction site in Caps2.L1, resulting in Δ3072 truncation of the Caps2.L1 ORF. As an additional control, we generated a plasmid expressing the annotated canonical Caps2.1 transcript (RefSeq: NM_178278.4), also driven by a CAG promoter (Vector Builder). Each plasmid included an EFS promoter driving mCherry to identify cells receiving the constructs. An empty plasmid, containing only EFS driving mCherry expression was used as an additional control. Cells were cultured at 37 °C in 5% CO2 in high-glucose (4.5 g l−1) DMEM, supplemented with 10% FBS and 100 U ml−1 penicillin–streptomycin solution (Life Technologies). A total of 1.2 × 105 cells per well were plated on coverslips coated with 0.1% gelatine in 12-well plates and transfected with 500 ng of plasmid DNA per well using Lipofectamine 2000 (Invitrogen, cat. no. 11668019) following the manufacturer’s instructions. Twenty-four hours post-transfection, the medium was replaced with a differentiation medium containing high-glucose DMEM with 0.5% FBS and 5 µM retinoic acid.
After 5 days of differentiation, the culture medium was removed, and cells were fixed in 4% PFA (20 min, 4 °C) and washed with PBS. Immunohistochemistry was then performed as for mouse primary neuronal cultures. For morphology analysis, Z-stack images were acquired using the SoRa super-resolution disk and 3.2× magnification. Image processing and analysis post-acquisition for the morphology analysis were performed using Fiji for Windows (ImageJ 1.52d). Ntf3 analysis was performed using Imaris 9.5.1 (Bitplane, Oxford Instruments). To quantify Ntf3 release, circular outlines (30 µm diameter) were manually added to 3D visualizations of neuronal soma (for mCherry-positive neurons) along the Z-stack planes where the cell was detected. Voxels outside the outline were set to a channel intensity value of zero to retain only the Ntf3 signal of a given cell. We then manually placed and quantified the number of spots seen as Ntf3 signal dots outside cell soma. For Ntf3 analysis inside the soma, we used the automatic Imaris surface function to render the surface of mCherry-positive cells and exported mean intensities and area. Integrated mean intensity was calculated as equal to area times mean pixel value.
Statistics and reproducibility
Statistical methods, error bars (standard deviation, s.d.), P values and replicate or sample sizes (n or N) are indicated in figure legends. Statistical tests were implemented with GraphPad Prism (version 9.5.1) with the exception of Supplementary Tables 2 and 3, where Fisher’s exact test was implemented with SciPy (version 1.4.1). Data distributions were assumed to be normal, but this was not formally tested and individual data points are displayed where relevant on graphs. No statistical method was used to predetermine sample size. Experiments were designed to obtain at least biological triplicate data. No data were excluded from the analysis. Stratified randomization was used on the basis of age to allocate mice to experimental groups. Cell culture experiments were not randomized. Blinding to group allocation was used for image analyses involving different treatment groups. No blinding to sample identity during sample collection was used. Immunostainings of brain sections (Figs. 1b–e and 2f, Extended Data Figs. 1b–f and 3a–c and Supplementary Fig. 4c), cell culture assays (Fig. 1k–m and Extended Data Figs. 2b–d, 4f,g, 7 and 9a,d,e) and RNAscope experiments (Fig. 2a and Extended Data Fig. 4c–e) were repeated independently at least twice. L1 promoter and retrotransposition assays (Fig. 3b–e) as well as the Caps2 expression plasmid transfections (Fig. 6a–d) were performed on three different days (independent biological replicates) with two to three wells per assay (technical replicates). PCR experiments (Fig. 5e and Extended Data Fig. 1a) were performed at least twice with on-target amplicons confirmed by capillary sequencing.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
ONT sequencing data (.fastq and.fast5) generated from sorted hippocampal cell populations are available from the European Nucleotide Archive (ENA) under accession number PRJEB47835, as are PacBio L1 5′RACE data generated from bulk mouse hippocampus and sorted PV interneurons. The SOX6 consensus motif was downloaded from JASPAR (https://jaspar.elixir.no/), identifier MA0515.1. The L1 TFI consensus sequence was obtained from RepBase (https://www.girinst.org/repbase/) version 18.03. Ontologies of genes containing intronic L1s were assessed with PANTHER (https://www.pantherdb.org/). Published PacBio long-read transcriptome sequencing data of adult mouse hippocampus tissue was obtained from ENCODE (https://www.encodeproject.org/), library identifier ENCLB505CBY. Retrotransposon genomic coordinates were downloaded from the UCSC Genome Browser RepeatMasker track (https://genome.ucsc.edu/cgi-bin/hgTables). ENCODE SOX6 and YY1 chromatin immunoprecipitation followed by sequencing (ChIP-seq) binding profiles over the L1Hs 5′UTR were generated by MapRRCon (http://maprrcon.org/). Human hippocampus single-cell ATAC-seq data were obtained from the Sequence Read Archive (SRA) under identifiers SRR11442501 and SRR11442502. Mouse cortex ATAC-seq and RNA sequencing (RNA-seq) data generated from excitatory pyramidal neuron, PV interneuron and VIP interneuron nuclei were obtained from the SRA (ATAC-seq: identifiers SRR1647880-SRR1647885, RNA-seq: identifiers SRR1647854-SRR1647859). Bulk hippocampus RNA-seq obtained from wild-type and conditional Ctcf-knockout animals were downloaded from the SRA (identifier SRP078142), as were RNA-seq data from neurons differentiated in vitro from human induced pluripotent stem cells, with and without LHX6 overexpression (SRA identifier SRP147748). L1.3 retrotransposition reporter and LRE3 promoter reporter constructs carrying mutant SOX binding sites, as well as cL1spa reporter constructs, are available from the last author on request. Source data are provided with this paper.
Code availability
Nanopore methylation analyses were performed with MethylArtist (https://github.com/adamewing/methylartist). Bisulfite sequencing results were visualized with QUMA (http://quma.cdb.riken.jp/). RNA-seq and ATAC-seq datasets were analyzed by pipelines joining together in serial published bioinformatic tools (see Methods). A custom Python script (https://gist.github.com/adamewing/331e1780975969afcebc2996ddb8c7a2) was written to analyze single-cell ATAC-seq profiles of the L1Hs promoter.
References
Kazazian, H. H. Jr & Moran, J. V. Mobile DNA in health and disease. N. Engl. J. Med. 377, 361–370 (2017).
Moran, J. V. et al. High frequency retrotransposition in cultured mammalian cells. Cell 87, 917–927 (1996).
Wei, W. et al. Human L1 retrotransposition: cis preference versus trans complementation. Mol. Cell. Biol. 21, 1429–1439 (2001).
Feng, Q., Moran, J. V., Kazazian, H. H. Jr & Boeke, J. D. Human L1 retrotransposon encodes a conserved endonuclease required for retrotransposition. Cell 87, 905–916 (1996).
Luan, D. D., Korman, M. H., Jakubczak, J. L. & Eickbush, T. H. Reverse transcription of R2Bm RNA is primed by a nick at the chromosomal target site: a mechanism for non-LTR retrotransposition. Cell 72, 595–605 (1993).
Kazazian, H. H. Jr et al. Haemophilia A resulting from de novo insertion of L1 sequences represents a novel mechanism for mutation in man. Nature 332, 164–166 (1988).
van den Hurk, J. A. J. M. et al. L1 retrotransposition can occur early in human embryonic development. Hum. Mol. Genet. 16, 1587–1592 (2007).
Richardson, S. R. et al. Heritable L1 retrotransposition in the mouse primordial germline and early embryo. Genome Res. 27, 1395–1405 (2017).
An, W. et al. Active retrotransposition by a synthetic L1 element in mice. Proc. Natl Acad. Sci. USA 103, 18662–18667 (2006).
Feusier, J. et al. Pedigree-based estimation of human mobile element retrotransposition rates. Genome Res. 29, 1567–1577 (2019).
Muotri, A. R. et al. Somatic mosaicism in neuronal precursor cells mediated by L1 retrotransposition. Nature 435, 903–910 (2005).
Coufal, N. G. et al. L1 retrotransposition in human neural progenitor cells. Nature 460, 1127–1131 (2009).
Ostertag, E. M., Prak, E. T., DeBerardinis, R. J., Moran, J. V. & Kazazian, H. H. Jr Determination of L1 retrotransposition kinetics in cultured cells. Nucleic Acids Res. 28, 1418–1423 (2000).
Flasch, D. A. et al. Genome-wide de novo L1 retrotransposition connects endonuclease activity with replication. Cell 177, 837–851 (2019).
Erwin, J. A. et al. L1-associated genomic regions are deleted in somatic cells of the healthy human brain. Nat. Neurosci. 19, 1583–1591 (2016).
Evrony, G. D. et al. Cell lineage analysis in human brain using endogenous retroelements. Neuron 85, 49–59 (2015).
Sanchez-Luque, F. J. et al. LINE-1 evasion of epigenetic repression in humans. Mol. Cell 75, 590–604 (2019).
Billon, V. et al. Somatic retrotransposition in the developing rhesus macaque brain. Genome Res. 32, 1298–1314 (2022).
Denli, A. M. et al. Primate-specific ORF0 contributes to retrotransposon-mediated diversity. Cell 163, 583–593 (2015).
Faulkner, G. J. et al. The regulated retrotransposon transcriptome of mammalian cells. Nat. Genet. 41, 563–571 (2009).
Garza, R. et al. LINE-1 retrotransposons drive human neuronal transcriptome complexity and functional diversification. Sci. Adv. 9, eadh9543 (2023).
Jönsson, M. E. et al. Activation of neuronal genes via LINE-1 elements upon global DNA demethylation in human neural progenitors. Nat. Commun. 10, 3182 (2019).
Senft, A. D. & Macfarlan, T. S. Transposable elements shape the evolution of mammalian development. Nat. Rev. Genet. 22, 691–711 (2021).
Mo, A. et al. Epigenomic signatures of neuronal diversity in the mammalian brain. Neuron 86, 1369–1384 (2015).
Gerdes, P. et al. Locus-resolution analysis of L1 regulation and retrotransposition potential in mouse embryonic development. Genome Res. 33, 1465–1481 (2023).
Salvador-Palomeque, C. et al. Dynamic methylation of an L1 transduction family during reprogramming and neurodifferentiation. Mol. Cell. Biol. 39, e00499–18 (2019).
Scott, E. C. et al. A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer. Genome Res. 26, 745–755 (2016).
Thayer, R. E., Singer, M. F. & Fanning, T. G. Undermethylation of specific LINE-1 sequences in human cells producing a LINE-1-encoded protein. Gene 133, 273–277 (1993).
Lanciano, S. et al. Locus-level L1 DNA methylation profiling reveals the epigenetic and transcriptional interplay between L1s and their integration sites. Cell Genom. 4, 100498 (2024).
Muotri, A. R. et al. L1 retrotransposition in neurons is modulated by MeCP2. Nature 468, 443–446 (2010).
Seczynska, M., Bloor, S., Cuesta, S. M. & Lehner, P. J. Genome surveillance by HUSH-mediated silencing of intronless mobile elements. Nature 601, 440–445 (2022).
Athanikar, J. N., Badge, R. M. & Moran, J. V. A YY1-binding site is required for accurate human LINE-1 transcription initiation. Nucleic Acids Res. 32, 3846–3855 (2004).
Tchénio, T., Casella, J. F. & Heidmann, T. Members of the SRY family regulate the human LINE retrotransposons. Nucleic Acids Res. 28, 411–415 (2000).
DeBerardinis, R. J. & Kazazian, H. H. Jr Analysis of the promoter from an expanding mouse retrotransposon subfamily. Genomics 56, 317–323 (1999).
Sarkar, A. & Hochedlinger, K. The Sox family of transcription factors: versatile regulators of stem and progenitor cell fate. Cell Stem Cell 12, 15–30 (2013).
Ognjanovski, N. et al. Parvalbumin-expressing interneurons coordinate hippocampal network dynamics required for memory consolidation. Nat. Commun. 8, 15039 (2017).
Fuchs, E. C. et al. Recruitment of parvalbumin-positive interneurons determines hippocampal function and associated behavior. Neuron 53, 591–604 (2007).
Batista-Brito, R. et al. The cell-intrinsic requirement of Sox6 for cortical interneuron development. Neuron 63, 466–481 (2009).
Munguba, H. et al. Postnatal Sox6 regulates synaptic function of cortical parvalbumin-expressing neurons. J. Neurosci. 41, 8876–8886 (2021).
Azim, E., Jabaudon, D., Fame, R. M. & Macklis, J. D. SOX6 controls dorsal progenitor identity and interneuron diversity during neocortical development. Nat. Neurosci. 12, 1238–1247 (2009).
Sassaman, D. M. et al. Many human L1 elements are capable of retrotransposition. Nat. Genet. 16, 37–43 (1997).
Dombroski, B. A., Scott, A. F. & Kazazian, H. H. Jr Two additional potential retrotransposons isolated from a human L1 subfamily that contains an active retrotransposable element. Proc. Natl Acad. Sci. USA 90, 6513–6517 (1993).
Donato, F., Rompani, S. B. & Caroni, P. Parvalbumin-expressing basket-cell network plasticity induced by experience regulates adult learning. Nature 504, 272–276 (2013).
Naas, T. P. et al. An actively retrotransposing, novel subfamily of mouse L1 elements. EMBO J. 17, 590–597 (1998).
Richardson, S. R. et al. Revisiting the impact of synthetic ORF sequences on engineered LINE-1 retrotransposition. Preprint at bioRxiv https://doi.org/10.1101/2022.08.29.505632. (2022).
Gerdes, P. et al. Retrotransposon instability dominates the acquired mutation landscape of mouse induced pluripotent stem cells. Nat. Commun. 13, 7470 (2022).
Han, J. S. & Boeke, J. D. A highly active synthetic mammalian retrotransposon. Nature 429, 314–318 (2004).
Sun, X. et al. Transcription factor profiling reveals molecular choreography and key regulators of human retrotransposon expression. Proc. Natl Acad. Sci. USA 115, E5526–E5535 (2018).
Corces, M. R. et al. Single-cell epigenomic analyses implicate candidate causal variants at inherited risk loci for Alzheimer’s and Parkinson’s diseases. Nat. Genet. 52, 1158–1168 (2020).
Yuan, F. et al. Induction of human somatostatin and parvalbumin neurons by expressing a single transcription factor LIM homeobox 6. eLife 7, e37382 (2018).
Sams, D. S. et al. Neuronal CTCF is necessary for basal and experience-dependent gene regulation, memory formation, and genomic structure of BDNF and Arc. Cell Rep. 17, 2418–2430 (2016).
Brouha, B. et al. Evidence consistent with human L1 retrotransposition in maternal meiosis I. Am. J. Hum. Genet. 71, 327–336 (2002).
Kopera, H. C. et al. LINE-1 cultured cell retrotransposition assay. Methods Mol. Biol. 1400, 139–156 (2016).
Schauer, S. N. et al. L1 retrotransposition is a common feature of mammalian hepatocarcinogenesis. Genome Res. 28, 639–653 (2018).
Feng, J. et al. Dnmt1 and Dnmt3a maintain DNA methylation and regulate synaptic function in adult forebrain neurons. Nat. Neurosci. 13, 423–430 (2010).
Ewing, A. D. et al. Nanopore sequencing enables comprehensive transposable element epigenomic profiling. Mol. Cell 80, 915–928.e5 (2020).
Sookdeo, A., Hepp, C. M., McClure, M. A. & Boissinot, S. Revisiting the evolution of mouse LINE-1 in the genomic era. Mob. DNA 4, 3 (2013).
Kong, L. et al. Subfamily-specific differential contribution of individual monomers and the tether sequence to mouse L1 promoter activity. Mob. DNA 13, 13 (2022).
Girard, F., Venail, J., Schwaller, B. & Celio, M. R. The EF-hand Ca2+-binding protein super-family: a genome-wide analysis of gene expression patterns in the adult mouse brain. Neuroscience 294, 116–155 (2015).
ENCODE Project Consortium An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57–74 (2012).
Bourc’his, D. & Bestor, T. H. Meiotic catastrophe and retrotransposon reactivation in male germ cells lacking Dnmt3L. Nature 431, 96–99 (2004).
Ooi, S. K. T. et al. DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature 448, 714–717 (2007).
An, W. et al. Conditional activation of a single-copy L1 transgene in mice by Cre. Genesis 46, 373–383 (2008).
Campbell, B. C. et al. mGreenLantern: a bright monomeric fluorescent protein with rapid expression and cell filling properties for neuronal imaging. Proc. Natl Acad. Sci. USA 117, 30710–30721 (2020).
Blaess, S. et al. Temporal–spatial changes in Sonic Hedgehog expression and signaling reveal different potentials of ventral mesencephalic progenitors to populate distinct ventral midbrain nuclei. Neural Dev. 6, 29 (2011).
Li, H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics 34, 3094–3100 (2018).
Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).
Gamaarachchi, H. et al. Fast nanopore sequencing data analysis with SLOW5. Nat. Biotechnol. 40, 1026–1029 (2022).
Samarakoon, H., Ferguson, J. M., Gamaarachchi, H. & Deveson, I. W. Accelerated nanopore basecalling with SLOW5 data format. Bioinformatics 39, btad352 (2023).
Simpson, J. T. et al. Detecting DNA cytosine methylation using nanopore sequencing. Nat. Methods 14, 407–410 (2017).
Li, H. Tabix: fast retrieval of sequence features from generic TAB-delimited files. Bioinformatics 27, 718–719 (2011).
Cheetham, S. W., Kindlova, M. & Ewing, A. D. Methylartist: tools for visualising modified bases from nanopore sequence data. Bioinformatics 38, 3109–3112 (2022).
Acknowledgements
We thank J. D. Boeke, J. L. Garcia-Perez, H. H. Kazazian and J. V. Moran for sharing L1SM, LRE3, L1spa and L1.3 plasmids. We thank W. An, P. Sah, R. Lister, R. Sullivan, S. van de Wakker, A. Gaudin, S. W. Cheetham and members of the Faulkner laboratory for helpful discussions. We acknowledge the QBI and TRI Flow Cytometry suites for technical advice, the Garvan Sequencing Platform and the Australian Genome Research Facility for long-read sequencing, the UQ School of Biomedical Sciences Viral Vector Core for Cre lentivirus synthesis and the QBI Advanced Microscopy Facility for technical assistance and equipment, supported by ARC LIEF grant LE130100078. This work was supported by NHMRC-ARC Dementia Research Development Fellowship GNT1108258 and DFG fellowship BO4460/1-1 (G.O.B.), Australian Government Research Training Program (RTP) Scholarships (J.M.B., M.E.F. and J.d.l.R.B.), NHMRC Investigator Grants GNT1176574 (N.J.), GNT1173476 (S.R.R.) and GNT1173711 (G.J.F.), ARC Discovery Project DP200102919 (S.R.R. and G.J.F.), NHMRC Project Grants GNT1106206 (G.J.F., A.J.H. and L.M.P.) and GNT1126393 (G.J.F.), a CSL Centenary Fellowship (G.J.F.), Andalusian Government EMERGIA20_00225 and Spanish National Research Agency RYC2021_031920-I grants (F.J.S.-L.) and the Mater Foundation. The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.
Author information
Authors and Affiliations
Contributions
G.O.B. and G.J.F. designed the project and wrote the manuscript. G.O.B., J.M.B., M.E.F., F.J.S.-L., J.d.l.R.B., J.R., M.A.R., L.R.F., C.G., P.G., L.-G.B, P.A., D.J.D.C.G., L.C., C.C.B., V.B., S.M., M.-J.H.C.K., C.J.L. and K.S. performed experiments. G.O.B., J.M.B., M.E.F., N.J., P.K., A.D.E., D.J.J., S.R.R., A.J.H. and G.J.F. analyzed the data. G.O.B., L.M.P., S.R.R., A.J.H. and G.J.F. provided resources.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Neuroscience thanks Josh Dubnau, Jennifer Erwin and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Extended data
Extended Data Fig. 1 Assessment of L1 retrotransposition in brain and non-brain tissues of L1-EGFP animals.
a, EGFP cassette genotyping PCR results for the offspring of founder animal #1.2. Circles and squares represent female and male mice, respectively. The 1.7kbp PCR product (red arrow) corresponds to the integrated intron-containing EGFP indicator cassette. Gel labels are as follows: mw, molecular weight (ladder); 1-5, transgenic offspring littermates; +, EGFP positive control plasmid DNA; -, H20. Offspring 2, 4 and 5 carried the L1-EGFP transgene. b, Ovary and testis c, heart d, muscle and e, liver tissues of adult L1-EGFP mice were immunostained for EGFP and L1 proteins (T7-tagged ORF1p and 3×FLAG-tagged ORF2p). EGFP+ cells were observed in the interstitial cells of the ovaries but not in other tissues. DNA was stained with Hoechst dye (blue). f, Representative maximum intensity projection confocal image of a coronal hippocampus section from a transgenic L1-EGFP animal showing immunostaining for EGFP (green) and the interneuron marker Gad1 (red). Yellow arrowheads indicate EGFP+/Gad1+ neurons in DG. The image is presented as merged and single channels for EGFP and Gad1. Scale bar: 100 µm.
Extended Data Fig. 2 Retrotransposition of an engineered mouse L1 delivered to cultured neurons.
a, Primary neurons were electroporated with an L1spa reporter construct driven by its native promoter and carrying an mCherry indicator cassette. The mCherry is antisense to the L1, incorporates a ɣ-globin intron in the same orientation as the L1, and is terminated by a polyadenylation signal (filled black lollipop). Retrotransposition removes the ɣ-globin intron, enabling mCherry expression. Experimental timeline is shown below the schematic. Circles represent days in culture, E: electroporation, R: analysis. b, Example of a degenerating neuron expressing mCherry (red) and parvalbumin (PV, green). c, Representative confocal images of H2A.X (magenta) immunostaining of neurons (Tub, green) shows DNA breaks in mCherry neurons after L1spa electroporation. Immunostaining of L1spa RT− mutant (retrotransposition negative control) and no electroporation controls are shown in the panels below. d, Representative confocal images of cL1spa reporter electroporation showing mCherry (red) and SOX6 (magenta) colocalization in primary neurons upon Cre addition. Note: scale bars in (b-d) indicate 10 µm.
Extended Data Fig. 3 Retrotransposition of an engineered mouse L1 delivered in utero.
a, Schematic representation of L1-EGFP reporter in utero electroporation (IUE). A coronal view of electrode positioning is shown at left. Embryos were co-injected with pmCherry (where a CMV promoter controls mCherry expression) and a second plasmid, carrying a mouse L1 tagged with an EGFP indicator cassette (pUBC-L1SM-UBC-EGFP), into the left hemisphere. As a negative control, embryos were co-injected with pmCherry and a disabled L1 reporter plasmid (pMut2-UBC-L1SM-UBC-EGFP) into the right hemisphere. The red inset, shown at right, displays a coronal section of an electroporated mouse brain with pmCherry visible in the targeted hippocampal region. Scale bar indicates 100 µm. IUE was performed on embryonic day (E)14.5. Embryos were born and then sacrificed at postnatal day (P)10. Note: UBC-L1SM-UBC-EGFP consists of a heterologous UBC promoter driving expression of a synthetic mouse L1 TF (L1SM) containing a native L1 monomeric 5′UTR promoter, codon-optimized ORF1 and ORF2 sequences, the 5′ part of the L1 3′UTR, and an intron-interrupted EGFP indicator cassette with its own UBC promoter and polyadenylation signal (pA). In this system, a cell becomes EGFP positive only when the L1-EGFP mRNA is transcribed, spliced, reverse transcribed and integrated into the genome, allowing a functional EGFP to be expressed from its UBC promoter. Mut2-UBC-L1SM-UBC-EGFP is the same as UBC-L1SM-UBC-EGFP, except it carries mutations known to disable ORF2p reverse transcriptase and endonuclease activities. b, Example maximum intensity projection confocal image of a hippocampus section from an embryo electroporated with UBC-L1SM-UBC-EGFP. A PV+ (magenta), mCherry+ (red), NeuN+ (blue), EGFP+ cell is indicated with a yellow arrowhead. c, No EGFP+ cells were found for the retrotransposition-incompetent Mut2-UBC-L1SM-UBC-EGFP plasmid. An empty arrowhead points to a PV+, NeuN+, mCherry−, EGFP− cell. Note: scale bars in (a) and (b) indicate 10 µm.
Extended Data Fig. 4 Single-molecule L1 TF RNA FISH experimental design.
a, L1 TF RNAscope probe A consisted of 20 ‘ZZ’ oligo pairs targeting the L1 TF 5ʹUTR monomeric and non-monomeric region (consensus positions 827 to 1688). b, L1 TF probe B was composed of 17 ZZ oligo pairs and targeted the L1 TF 5ʹUTR monomeric region (positions 142 to 1423). c, Imaris analysis performed on Z-stack images of L1 TF and PV RNA FISH coronal hippocampus sections immunostained for Tub. Imaris workflow: 1: neuron identification, based on cytoplasmic Tub (red) fluorescence, and cell volume drawing, 2: nucleus definition by DAPI (blue) staining followed by drawing of nuclear volume, 3: delineation of cell and nucleus surfaces, 4: cell surface masking to eliminate voxels outside the cell, 5: nucleus surface masking to exclude voxels inside the nucleus, and 6: L1 TF mRNA (green) fluorescence signal within the defined cytoplasmic volume. d, Maximum intensity projection confocal images of hippocampal sections showing L1 TF probe A (green) and PV (magenta) RNA FISH, and Tub (red) immunohistochemistry. Dashed lines demark nuclear and cellular boundaries defined for PV and L1 mRNA quantification. Selected PV− and PV+ neurons are shown top and bottom, respectively. e, Confocal images of hippocampal sections treated with either DNase or RNase and subsequently processed for RNAscope using the L1 TF probe A (green). f, Confocal images of N2a cells transfected with either mouse L1 construct (pL1SM-mCherry) or control (pmCherry) showing specificity of L1 TF RNA FISH probe A (green) signal in cells expressing the L1 construct. g, As for (f), except performed on HEK293T cells and showing specificity of L1 TF RNA FISH probe B (green) in cells expressing the L1 construct. h, Schematic showing L1 TF sequences assayed by RNA FISH and TaqMan qPCR. Scale bar for (d-g): 10 μm.
Extended Data Fig. 5 Additional L1 TF RNA FISH data for hippocampus and cortex.
a-c, Number of L1 TF RNA FISH (probe B) spots in PV+/Tub+ neurons (orange plot) and PV−/Tub+ neurons (blue plot) in CA (a), DG (b) and CX (c). **P = 0.003, *P = 0.03 and *P = 0.01 for (a), (b) and (c), respectively. Two-tailed t test comparing animal means, n(cells)=2-10, N(mice)=3-4. Solid line: median. Dashed lines: quartiles.
Extended Data Fig. 6 Elevated L1 transcription in PV interneurons.
a, Multiplexed TaqMan qPCR measuring mRNA abundance of the L1 TF non-monomeric 5ʹUTR sequence (FAM channel) relative to Gapdh (VIC channel) in sorted PV+, PV−, PV−/Tub+ and PV−/Tub−cells. Cells were sorted from pooled neonate litter hippocampi. N = 4 litters. b, As for (a), except relative to URR1 repetitive DNA (HEX channel). *P = 0.015. c, As for (a), except measuring L1 TF ORF2 (FAM channel) relative to Gapdh (VIC channel). Data are represented as mean ± SD. Significance values were calculated via one-way ANOVA with Tukey’s post-hoc test.
Extended Data Fig. 7 L1 ORF1p antibody specificity.
Confocal images of HeLa cells transfected with either a HA-tagged ORF1p (L1spa) expression vector or with transfection reagents alone (mock), showing specificity of the ORF1p antibody (green) in human cells expressing mouse ORF1p. Scale bar 10 μm.
Extended Data Fig. 8 L1 activation by the LHX6/SOX6 transcriptional program.
a, The L1Hs 5ʹUTR, with YY1- (orange) and SOX-binding (purple) sites marked, is shown above MapRRCon48 profiles of ENCODE K562 SOX6 and YY1 ChIP-seq binding and chromatin accessibility profiles in human hippocampal tissue as measured by scATAC-seq49. Cells were grouped based on selected accessible genes to define neural cell populations (PV: parvalbumin inhibitory interneuron, EXC: excitatory neurons, VIP: vasoactive intestinal polypeptide-expressing inhibitory interneurons, GFAP: glia). b, Lhx6, Sox2, Sox5, Sox6, Sox11 and Caps2 expression in excitatory (EXC) pyramidal neuron, PV interneuron and VIP interneuron cortex populations defined by Mo et al.24, measured by RNA-seq tags per million (TPM). N = 2. c, Proportion of ATAC-seq reads aligned to peaks associated with full-length L1 TF copies in neuronal populations defined by Mo et al. N = 2. d, L1Hs subfamily expression measured by RNA-seq TPM in neurons derived via in vitro differentiation of induced pluripotent stem cells50, with (LHX6↑) and without (control) LHX6 overexpression. *P = 0.03, two-tailed t test, N = 3. e, L1 TF family expression measured by RNA-seq TPM in bulk hippocampus51 of animals with (Ctcf cKO) and without (control) conditional knockout of Ctcf and associated induction of Lhx6 expression. *P = 0.01, two-tailed t test, N = 3. Note: histogram data in (d,e) are represented as mean ± SD.
Extended Data Fig. 9 SOX6 overexpression is associated with increased L1 transcription and ORF1p expression in primary neuronal cultures.
a, Confocal images of mouse primary neuronal cultures showing SOX6 (red) expression in Tub+ (green) neurons. b, Primary neuronal cultures after 5 days in vitro were transiently transduced with AAV2 vectors carrying either mCherry or a mouse SOX6 construct (mSOX6-T2A-mCherry) under the control of a CBh promoter. qPCR analysis at 12 and 24 h post-transduction revealed a significant increase in SOX6 mRNA expression in mSOX6-T2A-mCherry transduced cultures compared to mCherry controls. *P < 0.03, two-way ANOVA with Tukey’s multiple comparison test, N = 4. c, TaqMan qPCR measuring abundance of the L1 TF mRNA monomeric 5ʹUTR (VIC channel) relative to 5 S rRNA (FAM channel) in mCherry versus mSOX6-T2A-mCherry 24 h post-transduction. *P = 0.012, paired two-tailed t test, N = 4. d, Images showing L1 ORF1p (magenta), mCherry (red) and Tub (green) immunostaining in neurons 72 h post-transduction with AAV2-mCherry. e, As per (d), except for mSOX6-T2A-mCherry. f, Analysis of L1 ORF1p intensity in mCherry+ neurons shows significantly more ORF1p expression in mSOX6-T2A-mCherry transduced neurons than in mCherry controls. *P = 0.015, two-tailed t test, N = 3 transductions, n = 10-12 cells quantified per experiment. Note: data in (b), (c) and (f) are from independent experiments, with replicates color coded and represented as mean ± SD. Scale bar: 10 μm.
Extended Data Fig. 10 Hypomethylated L1s in PV interneuron genes, as identified by ONT sequencing.
a, Methylation profile of a full-length L1 TFIII element with intact ORFs, intronic to Chl1. The first panel shows the L1 orientated in sense to the last intron of Chl1. The second panel displays aligned ONT reads, with unmethylated CpGs colored in orange (PV+) and purple (PV−), blue (PV−/Tub+) and green (PV−/Tub−), and methylated CpGs colored black. The third panel indicates the relationship between CpG positions in genome space and CpG space, including those corresponding to the L1 TFIII 5ʹUTR (shaded light green). The fourth panel indicates the fraction of methylated CpGs for each cell type across CpG space. b, As for (a), except displaying an L1 TFIII antisense and intronic to Erbb4.
Supplementary information
Supplementary Information
Supplementary Methods, References, Figs. 1–4 and Table 4.
Supplementary Table
Supplementary Tables 1–3.
Supplementary Data
Source data for Supplementary Figs. 1–4.
Source data
Source Data Fig. 1
Statistical source data.
Source Data Fig. 1
Uncropped gel image.
Source Data Fig. 2
Statistical source data.
Source Data Fig. 3
Statistical source data.
Source Data Fig. 4
Statistical source data.
Source Data Fig. 5
Statistical source data.
Source Data Fig. 5
Uncropped gel image.
Source Data Fig. 6
Statistical source data.
Source Data Extended Data Fig. 1
Uncropped gel image.
Source Data Extended Data Fig. 5
Statistical source data.
Source Data Extended Data Fig. 6
Statistical source data.
Source Data Extended Data Fig. 8
Statistical source data.
Source Data Extended Data Fig. 9
Statistical source data.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Bodea, G.O., Botto, J.M., Ferreiro, M.E. et al. LINE-1 retrotransposons contribute to mouse PV interneuron development. Nat Neurosci 27, 1274–1284 (2024). https://doi.org/10.1038/s41593-024-01650-2
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/s41593-024-01650-2