ADAR1 mutation causes ZBP1-dependent immunopathology

Hubbard, Nicholas W.; Ames, Joshua M.; Maurano, Megan; Chu, Lan H.; Somfleth, Kim Y.; Gokhale, Nandan S.; Werner, Margo; Snyder, Jessica M.; Lichauco, Katrina; Savan, Ram; Stetson, Daniel B.; Oberst, Andrew

doi:10.1038/s41586-022-04896-7

Download PDF

Article
Published: 20 July 2022

ADAR1 mutation causes ZBP1-dependent immunopathology

Nature volume 607, pages 769–775 (2022)Cite this article

20k Accesses
78 Citations
168 Altmetric
Metrics details

Subjects

Abstract

The RNA-editing enzyme ADAR1 is essential for the suppression of innate immune activation and pathology caused by aberrant recognition of self-RNA, a role it carries out by disrupting the duplex structure of endogenous double-stranded RNA species^1,2. A point mutation in the sequence encoding the Z-DNA-binding domain (ZBD) of ADAR1 is associated with severe autoinflammatory disease^3,4,5. ZBP1 is the only other ZBD-containing mammalian protein⁶, and its activation can trigger both cell death and transcriptional responses through the kinases RIPK1 and RIPK3, and the protease caspase 8 (refs. ^7,8,9). Here we show that the pathology caused by alteration of the ZBD of ADAR1 is driven by activation of ZBP1. We found that ablation of ZBP1 fully rescued the overt pathology caused by ADAR1 alteration, without fully reversing the underlying inflammatory program caused by this alteration. Whereas loss of RIPK3 partially phenocopied the protective effects of ZBP1 ablation, combined deletion of caspase 8 and RIPK3, or of caspase 8 and MLKL, unexpectedly exacerbated the pathogenic effects of ADAR1 alteration. These findings indicate that ADAR1 is a negative regulator of sterile ZBP1 activation, and that ZBP1-dependent signalling underlies the autoinflammatory pathology caused by alteration of ADAR1.

Brain endothelial GSDMD activation mediates inflammatory BBB breakdown

Article 17 April 2024

APOE4/4 is linked to damaging lipid droplets in Alzheimer’s disease microglia

Article Open access 13 March 2024

Identification of senescent, TREM2-expressing microglia in aging and Alzheimer’s disease model mouse brain

Article 18 April 2024

Main

ADAR1 modifies endogenous RNAs to prevent activation of the innate immune RNA sensors MDA5, OAS–RNAse L and PKR (refs. ^1,2,10,11). The interferon-inducible p150 isoform of ADAR1 includes an amino-terminal ZBD, and a naturally occurring point mutation in the sequence encoding this region causes a proline-to-alanine substitution at position 193 in human ADAR1 (ref. ⁴; Fig. 1a). This mutation is present at a remarkably high rate (about 1 in 360 in individuals of northern European descent), and if paired with a loss-of-function mutation on the second allele of ADAR1, it causes the severe autoinflammatory disease Aicardi–Goutières syndrome¹² (AGS). Recently, a mouse model of this mutation was reported that recapitulates the genetic underpinnings and aspects of the pathology of AGS; mice carrying the mutation causing the P195A substitution (homologous to human P193A) on one or both alleles of Adar (which encodes ADAR1) are phenotypically normal, but mice with this mutation combined with deletion of the p150 isoform in the second allele of Adar (Adar^{P195A/p150null}) exhibit liver, kidney and spleen pathology, are runted, and have a median survival of 25 days (ref. ⁵).

**Fig. 1: Immunopathology in ADAR1-mutant mice is driven by ZBP1.**

ZBP1 loss rescues ADAR1 mutation

The Adar^{P195A/p150null} model is driven by a point mutation in the sequence encoding the ZBD of ADAR1 (Fig. 1a). As ZBP1 contains the only other mammalian ZBD, we wondered whether these two proteins might functionally interact. Consistent with this possibility, our observations showed that ADAR1 co-immunoprecipitated with ZBP1, but that this interaction was abrogated when point mutations were introduced to the sequence encoding the ZBD of ZBP1 that prevented RNA binding (Extended Data Fig. 1a,b). We also observed that the interaction between ZBP1 and ADAR1 was strengthened by ultraviolet crosslinking, which covalently links protein to nucleic acid (Extended Data Fig. 1c). As these data suggested that ADAR1 and ZBP1 bind a common ligand through their ZBDs, we wondered whether the pathology caused by alteration of the ZBD of ADAR1 in the Adar^{P195A/p150null} mouse model was driven by aberrant ZBP1 activation. To test this idea, we crossed Adar^{P195A/p150null} mice to mice that lack ZBP1, using a widely used Zbp1-knockout mouse strain¹³, referred to here as Zbp1-a (Fig. 1b). We observed that Adar^{P195A/p150null}::Zbp1-a^−/− mice were born at expected frequencies and appeared phenotypically normal (Fig. 1c,d and Extended Data Fig. 2a,b). Following birth, Adar^{P195A/p150null}::Zbp1-a^−/− mice gained weight slightly more slowly than Adar^P195A/WT littermates (Fig. 1e,f), but otherwise exhibited normal phenotype, fertility and survival. The kidney and liver pathology previously reported in Adar^{P195A/p150null} mice⁵ was also largely normalized by ablation of Zbp1-a (Extended Data Fig. 2c).

As we were generating these data, it was reported that the Zbp1-a^−/− mouse line was not fully congenic to the C57BL/6 genetic background¹⁴, a finding confirmed by our own single nucleotide polymorphism analysis (Extended Data Fig. 3a,b). We therefore generated a second cross of Adar^{P195A/p150null} mice to a separately derived, fully congenic Zbp1^−/− strain¹⁵ referred to here as Zbp1-g (Extended Data Fig. 3c). Adar^{P195A/p150null}::Zbp1-g^−/− mice also appeared phenotypically normal (Extended Data Fig. 3d). Notably, we also observed an extension of survival in Adar^{P195A/p150null}::Zbp1-g^+/− mice, an effect not observed in Adar^{P195A/p150null}::Zbp1-a^+/− mice (Extended Data Fig. 2a). Together, these data confirm that loss of ZBP1 reverses the immunopathology observed in Adar^{P195A/p150null} mice.

Complete ablation of the p150 isoform of ADAR1 causes uniform lethality during embryonic development, but crossing these mice to mice that lack the double-stranded-RNA sensor MDA5 (encoded by Ifih1) allows Adar^{p150null/p150null} mice to survive to birth¹. As MDA5 is a potent inducer of type I interferon (IFN), and because ZBP1 expression is stimulated by IFN (Extended Data Fig. 4a), we reasoned that loss of MDA5 might rescue Adar-p150 knockout in mice by preventing ZBP1 upregulation. However, in mouse embryonic fibroblasts (MEFs), we observed that although loss of MDA5 completely abrogated IFN production induced by ADAR1 depletion, ZBP1 upregulation was only modestly attenuated (Extended Data Fig. 4b). This suggested that loss of ADAR1 could lead to ZBP1 upregulation and activation even in the absence of MDA5. Consistent with this finding, our observations showed that the survival of Adar^{p150null/p150null}::Ifih1^−/− mice was modestly but significantly extended by concurrent deletion of ZBP1 (Extended Data Fig. 4c). However, deletion of ZBP1 alone did not allow Adar^{p150null/p150null} mice to survive to birth (Extended Data Fig. 4d). Together, these data indicate that the developmental lethality induced by deletion of ADAR1-p150 is mediated by simultaneous activation of ZBP1, MDA5 and other pathways.

An inflammatory signature remains in rescued mice

Adar^{P195A/p150null} mice exhibit aberrant activation of MDA5, which drives IFN-dependent inflammation. We reasoned that this IFN-dependent signature would still be present in Adar^{P195A/p150null}::Zbp1-g^−/− mice, despite their normal phenotype. Consistent with this possibility, RNA-sequencing analysis of spleens from 23-day-old pups revealed that many aspects of the aberrant inflammatory and interferon-stimulated gene (ISG) signature present in Adar^{P195A/p150null} mice were also present in Adar^{P195A/p150null}::Zbp1^−/− mice, despite them having no alterations in splenic cellularity (Fig. 2a–c, Extended Data Fig. 5a,b and Extended Data Fig. 6). Gene ontology analysis confirmed that the antiviral gene signature induced by alteration of ADAR1 was conserved in Adar^{P195A/p150null}::Zbp1-g^−/− mice (Extended Data Fig. 5c). This analysis also identified gene signatures present in Adar^{P195A/p150null} mice but absent in Adar^{P195A/p150null}::Zbp1-g^−/− mice (Extended Data Fig. 5d). These genes may indicate targets of ZBP1 signalling or may represent pathways upregulated as a result of the immunopathology present in Adar^{P195A/p150null} mice. In carrying out these analyses, we noted that although cells from Adar^{P195A/p150null}::Zbp1^−/− mice maintain many aspects of the ISG signature observed in Adar^{P195A/p150null} mice, its magnitude is reduced (Fig. 2c and Extended Data Fig. 5a). This was confirmed by direct comparison of MEFs isolated from Adar^{P195A/p150null} or Adar^{P195A/p150null}::Zbp1^−/− mice (Fig. 2d), and suggested that ZBP1 may have a role in augmenting ISG upregulation, a function previously ascribed to ZBP1 in other contexts¹⁶.

**Fig. 2: The inflammatory program initiated by alteration of ADAR1 remains intact following knockout of *Zbp1*.**

We next sought to understand the pathways downstream of ZBP1 that are activated by alteration of ADAR1. We observed that culturing MEFs from Adar^{P195A/p150null} mice led to the ZBP1-dependent loss of RIPK3 expression (Extended Data Fig. 7a), suggesting that the ZBP1–RIPK3 pathway is constitutively active in these cells. Consistent with this, our observations showed that despite the reduced level of RIPK3 expression in these cells, treating them with the caspase inhibitor zVAD caused ZBP1-dependent RIPK3 phosphorylation and cell death (Fig. 2e,f and Extended Data Fig. 7a,b). Together, these results indicated that Adar^{P195A/p150null} cells are sensitized to ZBP1-dependent necroptosis.

Cell death signalling in ADAR1 mutant mice

Given this finding, we next sought to address the role of the necroptotic pathway in the pathology of Adar^{P195A/p150null} mice. To do this, we crossed Adar^{P195A/p150null} mice to mice that lack different components of the necroptotic pathway. Ablation of the necroptotic effector MLKL did not alter the phenotype of Adar^{P195A/p150null} mice (Fig. 3a and Extended Data Fig. 8a), nor did crossing them to mice in which the kinase activity of RIPK1 is absent (Fig. 3b and Extended Data Fig. 8b), indicating that prevention of canonical necroptosis alone was not sufficient to explain the effect of Zbp1 knockout in these mice.

**Fig. 3: ZBP1-induced necroptosis does not underlie immunopathology induced by alteration of ADAR1.**

By contrast, ablation of RIPK3 led to a significant extension of survival in Adar^{P195A/p150null} mice (Fig. 3c). However, this extension of survival was partial, with approximately one-third of Adar^{P195A/p150null}::Ripk3^−/− mice succumbing to death within 40 days of birth, followed by slower attrition of mice over the next 200 days. Adar^{P195A/p150null}::Ripk3^−/− were severely runted, in contrast to the overtly normal phenotype observed in Adar^{P195A/p150null}::Zbp1^−/− mice (Fig. 3d). These findings indicate that ZBP1 can drive pathology in Adar^{P195A/p150null} through signalling that is independent of RIPK3. After influenza infection, ZBP1 was reported to induce RIPK3-dependent induction of both caspase-8-dependent apoptosis and MLKL-dependent necroptosis¹⁷. Nonetheless, our finding that in Adar^{P195A/p150null} mice ablation of RIPK3 failed to fully recapitulate the reversal of pathology observed following ablation of ZBP1 implies RIPK3-independent functions of ZBP1 when activated downstream of ADAR1 deficiency.

ZBP1 contains three confirmed RIP homotypic interaction motifs, which bind to similar domains present in RIPK1 and RIPK3 (ref. ¹⁸). We reasoned that, in the absence of RIPK3, ZBP1 may interact with RIPK1 to scaffold and activate caspase-8-dependent apoptosis. To study this, we turned to a reductive system in which ZBP1 could be directly activated. By replacing the ZBD of ZBP1 with tandem inducible dimerization domains derived from the protein FK506, we created a form of ZBP1 that could be activated using the cell-permeable small molecule B/B (Extended Data Fig. 9a). In wild-type (WT) lung epithelial type 1 (LET1) cells, SV40-transformed endothelial cells (SVECs) or MEFs, this construct (termed 2×FV-ZBP1) triggered cell death that was blocked only with combined inhibition of RIPK3 and the caspases, consistent with induction of both apoptosis and necroptosis downstream of ZBP1 activation (Extended Data Fig. 9b–d). Furthermore, B/B activation of ZBP1 resulted in phosphorylation of RIPK3 and MLKL, and when ZBP1 was directly activated in Mlkl^−/− MEFs, it induced robust cell death that was dependent on caspase 8 and involved cleavage of caspase 3, consistent with apoptosis (Fig. 3e and Extended Data Fig. 10a,b). ZBP1 activation in Ripk3^−/− MEFs also induced caspase-8-dependent cell death and caspase 3 cleavage, albeit with slower kinetics than those observed in Mlkl^−/− cells (Fig. 3e,f). Notably, ZBP1 activation did not trigger detectable cell death in MEFs lacking both MLKL and caspase 8, or both RIPK3 and caspase 8 (Fig. 3e,f). This finding indicates that although RIPK3 can contribute to ZBP1-dependent apoptosis, ZBP1 can still drive caspase-8-dependent cell death responses in the absence of RIPK3.

Caspase 8 suppresses lethal inflammation

We reasoned that cell death dependent on ZBP1, RIPK1 and caspase 8 could underlie the pathology observed in Adar^{P195A/p150null}::Mlkl^−/− and Adar^{P195A/p150null}::Ripk3^−/− mice. Deletion of caspase 8 causes embryonic lethality due to unrestrained necroptosis¹⁸, but this phenotype is reversed by co-ablation of RIPK3 or MLKL (refs. ^19,20,21). We therefore generated Adar^{P195A/p150null}::Mlkl^−/−::Casp8^−/− and Adar^{P195A/p150null}::Ripk3^−/−::Casp8^−/− mice to test whether ablation of caspase 8 in addition to necroptotic signalling would recapitulate the phenotypic rescue observed following ablation of ZBP1. Unexpectedly, Adar^{P195A/p150null}::Ripk3^−/−::Casp8^−/− mice exhibited reduced weight and survival compared to Adar^{P195A/p150null}::Ripk3^−/−::Casp8^+/− littermates (Fig. 4a,b and Extended Data Fig. 10c), whereas Adar^{P195A/p150null}::Mlkl^−/−::Casp8^−/− mice were born at expected frequencies but uniformly failed to survive to weaning (Fig 4c). Histological analysis of these mice at birth revealed broadly normal development of the liver and kidney (Extended Data Fig. 11a–c), but a significant increase in IBA1-positive activated microglia in the brains of Adar^{P195A/p150null}::Mlkl^−/−::Casp8^−/− neonates, consistent with unrestrained inflammatory signalling at this site (Extended Data Fig. 11d,e). These findings imply that caspase 8 suppresses ZBP1 activation in Adar^{P195A/p150null} mice, and that ablation of caspase 8 may allow unrestrained ZBP1 transcriptional signalling that is independent of canonical apoptosis or necroptosis. Consistent with this possibility, co-immunoprecipitation experiments revealed recruitment of RIPK1, or of both RIPK1 and RIPK3, following 2×FV-ZBP1 activation in Ripk3^−/−::Casp8^−/− or Mlkl^−/−::Casp8^−/− MEFs, respectively, despite the lack of cell death responses observed in these conditions (Fig 3e,f and Extended Data Fig. 12a,b). We also observed that in Adar^{P195A/p150null}::Mlkl^−/− MEFs, zVAD treatment stabilized the interaction between ZBP1 and RIPK3, again in the absence of cell death responses (Extended Data Fig. 12c). These findings indicate that when necroptotic effectors are absent, loss or inhibition of caspase 8 promotes interactions between ZBP1 and the RIP kinases.

**Fig. 4: Caspase 8 suppresses lethal inflammatory signalling in ADAR1-mutant mice.**

We next assessed whether loss of caspase 8 potentiated transcriptional signalling induced by ADAR1 insufficiency. We observed that whereas depletion of ADAR1 mediated by short interfering RNA in Mlkl^−/− cells induced the expected upregulation of ISGs, ADAR1 depletion in Mlkl^−/−::Casp8^−/− MEFs induced a distinct transcriptional response dominated by NF-κB targets (Fig. 4d and Extended Data Fig. 13a,b). As RIPK1 is a key signalling adapter upstream of NF-κB activation²², this finding implied that ZBP1–RIPK1 signalling may underlie these transcriptional effects. Consistent with this, our observations showed that 2×FV-ZBP1 activation in Mlkl^−/− MEF s induced RIPK1-dependent upregulation of the NF-κB targets CCL2 and CCL7, but not of the canonical ISG IFIT1 (Extended Data Fig. 13c). Together, these data indicate that following alteration or depletion of ADAR1, caspase 8 acts to suppress a ZBP1- and RIPK1-dependent program of inflammatory transcription. The modest extension of survival observed in Adar^{P195A/p150null}::Ripk3^−/−::Casp8^−/− mice relative to Adar^{P195A/p150null}::Mlkl^−/−::Casp8^−/− mice suggests that RIPK3 can potentiate, but is not required for, ZBP1- and RIPK1-dependent inflammatory signalling.

This study does not address the identity of the ligand(s) responsible for activating ZBP1 in Adar^{P195A/p150null} mice. As the P195A alteration in ADAR1 lies in its ZBD, we can speculate that ADAR1(P195A) may be attenuated in its ability to bind ZBD ligands. Interestingly, aligning the ZBD sequences of ADAR1 and ZBP1, along with those present in the fish PKR homologue PKZ (ref. ²³) and the vaccinia virus effector E3L (ref. ²⁴), reveals that ZBP1 naturally contains an alanine at position 64, the site homologous to P195 of ADAR1 (Extended Data Fig. 14a). As substitution of alanine for proline at this site in ADAR1 limits its function, we speculate that the presence of an alanine at the homologous site within ZBP1 may reflect a naturally lower affinity for ligand by ZBP1 relative to other ZBDs. This may represent a means to limit aberrant ZBP1 activation at steady state. We sought to test this idea by creating a mouse line with a 'revertant' ZBP1, in which A64 is mutated to proline. However, ZBP1(A64P) mice did not reveal evidence of increased ZBP1 activation, either when crossed to the Adar^{P195A/p150null} model or in response to influenza infection, but rather seemed attenuated in their signalling in both settings (Extended Data Fig. 14b,c). Although ZBP1(A64P) protein was properly expressed (Extended Data Fig. 14d), this attenuation may reflect a disruption of protein structure induced by this alteration, and implies that further alterations or larger domain swaps would be needed to effectively test this hypothesis. Future studies will clarify the identity of ZBP1 ligands that emerge following alteration of ADAR1.

AGS refers to a family of IFN-driven congenital pathologies driven by alterations in proteins involved in nucleotide sensing and regulation¹². As ZBP1 is strongly induced by IFN, and has been described to bind DNA as well as RNA¹⁶, we wondered whether ZBP1 and RIPK3 signalling might have a role in AGS-like pathology driven by endogenous DNA ligands. To test this, we assessed mice lacking TREX1, a DNA exonuclease whose ablation causes aberrant activation of the cGAS–STING pathway^25,26. However, we did not observe significant amelioration of pathology or extension of survival in Trex1^−/− mice when RIPK3 was ablated, unlike the partial rescue observed in Adar^{P195A/p150null} mice following knockout of Ripk3 (Figs. 4e and 3c). This suggests that engagement of the ZBP1–RIP kinase pathway is a feature of dysregulated endogenous RNA, but not DNA, sensing.

The unexpected susceptibility of Ripk3^−/−::Casp8^−/− and Mlkl^−/−::Casp8^−/− mice to alteration of ADAR1 indicates that although these mice develop normally, they are poised for hyperactive inflammatory signalling in response to ZBP1 activation. Indeed, previous studies have found that Mlkl^−/−::Fadd^−/− mice (comparable to Mlkl^−/−::Casp8^−/−) are highly susceptible to influenza infection⁸, a setting in which ZBP1 is strongly activated. Although this was interpreted as indicating a requirement for functional cell death pathways for antiviral defence, our data raise the possibility that these mice succumb to uninhibited inflammatory signalling triggered by ZBP1. Notably, we did not observe engagement of pyroptotic cell death following ZBP1 activation in cells lacking caspase 8 in combination with RIPK3 or MLKL, although our data do not rule out contribution of pyroptotic signalling to the immunopathology we observe.

Our findings identify ZBP1 as a key effector of autoinflammatory pathology induced by alteration of the Z-DNA-binding domain of ADAR1. Our data also highlight the pleiotropic nature of ZBP1 signalling: whereas ZBP1 ablation fully rescued the pathology of the Adar^{P195A/p150null} model, individual deletion of the necroptotic signalling molecules MLKL or RIPK3 did not, and ablation of caspase 8 unleashed a lethal inflammatory program, apparently in the absence of ZBP1-dependent programmed cell death. These findings are consistent with the dual functions of caspase 8 as both an inducer of cell death and a suppressor of ZBP1-dependent necroptosis and inflammation. Indeed, both the presence and the absence of caspase 8 may drive pathology in ADAR1-mutant mice. Our in vitro data indicate that ZBP1 activation in the absence of RIPK3 can induce caspase-8-dependent cell death, and this pathway may contribute to the pathology of Adar^{P195A/p150null}::Ripk3^−/− mice; conversely, further ablation of caspase 8 in these mice exacerbates the observed pathology by instead unleashing unrestrained inflammatory signalling. Ultimately, apoptosis, necroptosis and inflammatory transcription may all contribute to the pathology of Adar^{P195A/p150null} mice, and which of these pathways is engaged following alteration of ADAR1 probably varies between tissues and cell types depending on the abundance of the pathway components as well as of regulatory proteins such as cFLIP and the IAPs. This pleiotropy also suggests that even the combined targeting of apoptosis and necroptosis using small-molecule inhibitors is unlikely to reverse AGS pathology driven by alteration of ADAR1.

Methods

Mice

Mouse strains with modifications to Zbp1-a (ref. ¹³), Zbp1-g (ref. ¹⁵), Adar^{P195A/p150null} (ref. ⁵), Mlkl (ref. ²⁷), Ripk1^kd (ref. ²⁸), Ripk1^mutRHIM (ref. ²⁹), Ripk3 (ref. ³⁰) and Casp8 (refs. ^19,31), Trex1 (ref. ²⁶) and Ifih1 (MDA5) (ref. ¹) have been described previously. Zbp1^A64P mice were generated as previously described³², using the single-guide RNA (gRNA) target sequence CCGCCTATGCTCCATGTTGCAGG and the repair-template sequence5′-AAAACCCTCAATCAAGTCCTTTACCGCCTGAAGAAGGAGGACAGAGTGTCCTCCCCA GAGCCTCCAACATGGAGCATAGGCGGGGCTGCTTCTGGAGATGGGGCTCCTGCAATCCCTGAGAACTCCAGT-3′. In brief, C57BL6/J oocytes were microinjected with Cas9 complexed with a single gRNA and single-stranded-DNA donor template as described, and then implanted into pseudopregnant female mice. Founder pups were screened using the Surveyor assay, and resulting mice were bred to homozygosity and genotyped using a Taqman probe system to detect the Zbp1^A64P G>C nucleotide change using the primer sequences 5′-CCTCAATCAAGTCCTTTACC-3′ (sense) and 5′-GACAGATTACCAAGGCTAGG-3′ (antisense), 5′-CAGAGCCTGCAACATGGAG-3′ (WT probe) and 5′-CAGAGCCTCCAACATGGAG-3′ (mutant probe). All mice were housed in pathogen-free facilities at the University of Washington under 12-h light–dark cycles with access to food and water ad libitum. Temperatures were set to 74 ± 2 °F with humidity of 30–70%. All animals used were cared for and used in experiments approved by the University of Washington Institutional Animal Care and Use Committee (under protocols 4298-01 and 4190-01) in a facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care in accordance with the Guide for the Care and Use of Laboratory Animals and applicable laws and regulations. In breeding experiments, no specific criteria were used to determine final sample size. These experiments were not randomized or blinded.

Analysis through single nucleotide polymorphism typing of Zbp1-a and Zbp1-g mouse strains was carried out by Taconic Biosciences using the Mouse Genome Scan Panel.

Cell lines

MEFs were generated from pups at embryonic day 15 and immortalized by retroviral transduction of the SV40 large T antigen. HEK293T cells, LET1 cells and MEFs were maintained in standard conditions: Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum, glutamine, penicillin and streptomycin. Following isolation and immortalization, MEF lines were tested for cell death competence by stimulation with TNF/zVAD (RIPK3/RIPK1-dependent cell death) or infection with influenza A virus (ZBP1/RIPK3-dependent cell death).

Plasmids, lentiviral vectors and short interfering RNA

2×FV-ZBP1 was generated by replacing the first 146 amino acids of mouse ZBP1 (corresponding to the ZBD) with tandem copies of FKBP(F36V), from Clontech. The resulting fusion gene was cloned into the Tet-based inducible expression pSLIK vector³³, and this construct was used to create lentiviral particles for transduction of target lines using standard protocols. Expression and activation of this construct were achieved by inducing 2×FV-ZBP1 expression with 1 μg ml⁻¹ doxycycline for 12 h, and then treating with 100 mM B/B homodimerizer (Clontech). The full ADAR1-p150 isoform was cloned from mouse cDNA directly into a pRRL lentiviral backbone and subsequently sequenced to confirm identity. WT and mutant Zαβ (mZαβ) ZBP1 were subcloned from constructs previously obtained from the laboratory of Jason Upton into the pRRL backbone, at which point a 3×Flag tag was added to the carboxy terminus.

CRISPR–Cas9-mediated deletion was achieved using a lenti-CRISPR construct created by D. Stetson⁵, into which guide sequences listed below were inserted. These were used to create VSV-G-pseudotyped lentivirus particles, which were used to transduce target cells. Following 10–14 days of antibiotic selection, deletion of target proteins was confirmed by western blot. The sequences of the guide RNA (gRNA) target sites are as follows: non-targeting control gRNA: scramble gRNA: 5′-GACGGAGGCTAAGCGTCGCAA-3′, Zbp1 gRNA: 5′-GAGCCTGCAACATGGAGCAT-3′, Ifih1 (MDA5) gRNA: 5′-GTGTGGGTTTGACATAGCGCG-3′.

Short interfering RNA (siRNA) experiments were carried out by transfecting cells with SMARTpool siRNA cocktails (Dharmacon Horizon Discovery) targeting ADAR1 (siGenome mouse Adar, Entrez Gene 56417), RIPK1 (siGenome mouse Ripk1, Entrez Gene 19766) or a non-targeting scramble control (siGenome Non-targeting siRNA Pool 1). Transfection of siRNA was carried out using the dharmaFECT 1 transfection reagent (catalogue number T-2001-03, Horizon Discovery) according to the manufacturer’s protocols.

Antibodies and inhibitors

Where indicated, the following drugs were used at the listed concentrations: 50 μM zVAD (SM Biochemicals); 100 nM GSK843 (GlaxoSmithKline).

The following antibodies were used for western blots and immunoprecipitations: ADAR1 (15.8.6, SantaCruz), ZBP1 (Zippy-1, AdipoGen), actin (13E5, Cell Signaling Technology), MDA5 (D74E4, Cell Signaling Technologies), pRIPK3 (GEN135-35-9, Genentech), RIPK3 (1G6.1.4, Genentech or 2283, ProSci), pMLKL (D6E3G, Cell Signaling Technologies), MLKL (MABC604, Millipore), caspase 3 (9662, Cell Signaling Technologies), cleaved caspase 3 (9661, Cell Signaling Technologies), RIPK1 (38/RIP, BD Biosciences), anti-Flag (M2, Sigma) and anti-FKBP12 (PA1-026A, Thermo Fisher). IBA1 (catalogue number 019-19741, Wako-Chem) and cleaved caspase 3 (clone D3E9, Cell Signaling Technologies) were used in immunohistochemical analysis.

The following antibodies were used for flow cytometry analysis of splenocytes: FITC anti-CD19 (clone 1D3, BD Biosciences), PerCP–Cy5.5 anti-CD3e (clone 145-2C11, BD Biosciences), PE–Cy7 anti-Ly6C (clone HK1.4, Biolegend), APC anti-F4/80 (clone BM8, eBioscience), AF700 anti-Ly6G (clone 1A8, Biolegend), APC–Cy7 anti-NK1.1 (clone PK136, BD Biosciences), BV510 anti-CD8a (clone 53-6.7, BD Biosciences), BV605 anti-CD4 (clone RM4-5, BD Biosciences), BV650 anti-CD11b (clone M1/70, Biolegend) and BUV395 anti-CD45.2 (clone 104, BD Biosciences).

Western blot, immunoprecipitation and infrared crosslinkingand immunoprecipitation

WT HEK293T cells or HEK293T cells expressing Flag–ZBP1 or Flag–ZBP1 mZαβ were cultured in 6-well plates and were transfected with pRRL vector expressing ADAR1-p150 or empty pRRL vector using ×2 transfection reagent (Mirus). At about 24 h post-transfection, cells were washed in PBS and crosslinked with 254 nm ultraviolet C light (0.3 J cm⁻²) or left uncrosslinked, and lysed in 200 μl immunoprecipitation lysis buffer (25 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.5 mM EDTA, 5 mM MgCl₂ + 1× protease inhibitor). Lysates were clarified by centrifugation at 5,000g for 10 min at 4 °C, and quantified by Bradford assay. A fraction of each sample was stored for input controls. A 200 μg quantity of each lysate was incubated with Protein G Dynabeads (Thermo Fisher) pre-conjugated with 4 μg anti-Flag M2 antibody (Sigma) in a final volume of 500 μl immunoprecipitation lysis buffer for 2 h at 4 °C with rotation. The beads were then washed four times with 1 ml immunoprecipitation lysis buffer before boiling them in 2× Laemmli buffer (Bio-Rad) + 5% beta-mercaptoethanol to elute protein complexes. Eluates and input controls were resolved on a 4–15% TGX gel (Bio-Rad) for SDS–polyacrylamide gel electrophoresis, and transferred to polyvinylidene difluoride membranes. Immunoblotting was carried out using horseradish-peroxidase-conjugated anti-Flag and anti-β-actin antibodies, and with anti-ADAR1 primary antibody and horseradish-peroxidase-conjugated anti-mouse secondary antibody (Jackson Immunolabs).

For RIPK3 and RIPK1 immunoprecipitations, Cells were lysed in ice-cold lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% v/v Triton X-100, 10% v/v glycerol and 0.01% w/v SDS) supplemented with 1× complete Protease Inhibitor (Roche) for 30 min, followed by centrifugation at 1,000g for 10 min. Antibodies to ZBP1 or FKBP12 (Invitrogen, PA1-026A) were immobilized to Dynabeads Protein G (Invitrogen) as per the manufacturer’s instructions, and then incubated with total cell lysates overnight at 4 °C. Immunoprecipitates were eluted in Laemmli sample buffer (63 mM Tris-HCl, pH 8.0, 10% v/v glycerol, 2% w/v SDS, 0.01% w/v bromophenol blue, 2.5% v/v 2-mercaptoethanol) at 95 °C for 10 min.

We carried out infrared crosslinking and immunoprecipitation (irCLIP) as described previously³⁴ with slight modifications. WT HEK293T cells or HEK293T cells stably expressing Flag–ZBP1 or Flag–ZBP1 mZαβ were cultured in 6-well plates. Cells were washed with PBS, crosslinked with 254 nm ultraviolet C light (0.3 J cm⁻²) and lysed in 200 μl irCLIP lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 1× protease inhibitor). After sonication in ice slurry, lysates were clarified by centrifugation at 5,000g for 10 min at 4 °C, and quantified by Bradford assay (Bio-Rad). A fraction of each sample was stored for input controls. A 200 μg quantity of each lysate was incubated with Protein G Dynabeads (Thermo Fisher) pre-conjugated with 4 μg anti-Flag M2 antibody (Sigma) in a final volume of 500 μl irCLIP lysis buffer for 2 h at 4 °C with rotation. The beads were then sequentially washed with the following ice-cold buffers: once with 1 ml irCLIP lysis buffer, once with 1 ml high-stringency buffer (20 mM Tris pH 7.5, 120 mM NaCl, 25 mM KCl, 5 mM EDTA, 1% Triton X-100, 1% NaDOC, 0.1% SDS), once with 1 ml high-salt buffer (20 mM Tris pH 7.5, 500 mM NaCl, 5 mM EDTA, 1% Triton X-100, 1% NaDOC), once with 1 ml low-salt buffer (20 mM Tris pH 7.5, 5 mM NaCl, 5 mM EDTA, 1% Triton X-100) and twice with 0.5 ml NT2 buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mM MgCl₂, 0.05% NP-40). Beads were then resuspended in 30 μl NT2 buffer containing 25 ng ml⁻¹ RNase A (Thermo Fisher) and 15% PEG400 (Sigma) for on-bead RNase digestion at 30 °C for 15 min with shaking (1,200 r.p.m.) in a Thermomixer. RNase digestion was quenched by the addition of 0.5 ml high-stringency buffer. Beads were washed twice with 0.3 ml PNK wash buffer (50 mM Tris pH 7.0, 10 mM MgCl₂), and then resuspended in 30 μl PNK dephosphorylation mix (1× PNK buffer (Promega), 0.5 μl RNaseIN (Promega), 1 μl T4 PNK (Promega), 4 μl PEG400). Dephosphorylation reactions were conducted at 37 °C for 60 min with shaking (1,200 r.p.m.) in a Thermomixer. Dephosphorylation mix was removed and beads were washed with 0.25 ml PNK wash buffer. For ligation of oligonucleotide conjugated with infrared dye to protein-crosslinked RNA, beads were resuspended in 30 μl RNA ligation mix (1× RNA ligase I buffer (NEB), 1 μl RNA ligase I (NEB), 1 μl infrared-dye-labelled oligonucleotide³⁴, 5 μl PEG400 and 0.5 μl RNaseIN) and incubated for 16 h at 16 °C with shaking in a Thermomixer (1,200 r.p.m.). The ligation mix was then removed, and the beads were washed twice with 0.25 ml PNK wash buffer, before elution of RNA–protein complexes in 20 μl 1× LDS Buffer (Thermo Fisher) + 10% beta-mercaptoethanol at 80 °C for 10 min. A 5 μl volume of eluates, as well as input controls, was then resolved by SDS–polyacrylamide gel electrophoresis on 4–12% Bis-Tris NuPAGE gels (Thermo Fisher), and transferred to nitrocellulose membranes. Fluorescent RNA–protein complexes in the eluates were visualized on a LiCOR Odyssey FC imager.

Flow cytometry

Splenocytes were blocked with Fc block (BD Biosciences) in PBS + 2% heat-inactivated fetal bovine serum for 10 min at 4 °C before cell surface staining by subsequent addition of a pre-mixed antibody cocktail. Cells were incubated with fluorescently labelled antibodies, each at a dilution of 1:200 for 30 min at 4 °C, washed and fixed with 2% paraformaldehyde in PBS for 10 min. Data were acquired on a BD FACSymphony A3 Cell Analyzer and using the BD Diva acquisition software (version 9.0) analysed using FlowJo (Tree Star, version 10.8.1).

Cell death analysis

Cell death was measured using an IncuCyte imaging system, as described previously³⁵. In brief, cells were imaged in the presence of the cell-impermeable DNA intercalator Sytox Green (Thermo Fisher, R37168), and Sytox-positive cells were quantified at each time point using custom processing definitions, available on request. In parallel, separate cells plated in identical numbers were treated with the cell-permeable dye Syto Green (Thermo Fisher, S34854) and quantified using the same approach, and percentage cell death was calculated as Sytox⁺/Syto⁺ at each time point. For siRNA-knockdown cell death assays, to avoid excessive non-specific toxicity, cells were transfected with siRNA for 8 h, at which point cells (adherent) were washed and dye/inhibitors were added at final concentrations immediately before IncuCyte imaging.

Pathology

Pathology analysis for the Adar^{P195A/p150null}::Zbp1 experiments (Supplementary Fig. 2) was carried out by the same personnel and using a similar scoring system recently described for analysis of Adar^{P195A/p150null} mice⁵. In brief, littermate mice 21 days of age were euthanized through CO₂ asphyxiation and livers and kidneys were collected and washed in PBS and fixed in 10% neutral-buffered formalin. Tissues were embedded in paraffin and cut into sections of about 4 mm in thickness for haematoxylin and eosin staining. Liver and kidney sections were also stained with periodic acid–Schiff (PAS) stain. Slides were evaluated by a board-certified veterinary pathologist, who was blinded to genotype and experimental setup. For kidney, expansion of the glomerular mesangial matrix was scored from 0–4, with 0, normal; 1, minimal; 2, mild; 3, moderate; 4, severe. For the liver, microvesicular and lesser macrovesicular cytoplasmic vacuolation were scored from 0–5, with 0, normal; 1, minimal changes affecting only a small region (<5%) of the liver; 2, mild changes throughout the liver but without enlargement of hepatocytes, coalescing lesions or necrosis; 3, mild to moderate cytoplasmic vacuolation throughout the liver with enlargement of hepatocytes but no necrosis or loss of parenchyma; 4, moderate, coalescing throughout the liver with multifocal mild regions of loss of parenchyma or necrosis; 5, severe with moderate multifocal regions of cavitation and necrosis.

Tissues for the Adar^{P195A/p150null}::Mlkl^−/−::Casp8^−/− experiments (Supplementary Fig. 11) were collected from pups euthanized by decapitation on the day of birth, and spleen, kidney, liver, heart, head with brain, and gastrointestinal tract were routinely embedded in paraffin and stained with haematoxylin and eosin. PAS stains were also obtained for liver and kidney. These slides were reviewed blindly, with the exception of gastrointestinal tissues, for which the pathologist was not blinded to genotype.

Representative images were captured from scanned slides or from glass slides taken using NIS-Elements BR 3.2 64-bit and image plates were created in Adobe Photoshop. Image white balance, lighting and contrast were adjusted using autocorrections applied to the entire image. Original magnification is stated in the figure captions.

Analysis of IBA1 and cleaved caspase 3 for Mlkl::Casp8::Adar^{p150null/P195A} pups was carried out through the University of Washington Histology and Imaging Core utilizing the Leica Bond Rx Automated Immunostainer (Leica Microsystems). Slides were deparaffinized with Leica Dewax solution at 72 °C for 30 s. Antigen retrieval was carried out on all slides with EDTA, pH 9, at 100 °C for 20 min. All subsequent steps were carried out at room temperature. Initial blocking consisted of 10% normal goat serum (Jackson ImmunoResearch, catalogue number 005-000-121) in Tris-buffered saline for 20 min and further blocking with Leica Bond peroxide block for 5 min. Slides were incubated with IBA1 (1:1,000) or CC3 (1:250) primary antibodies in Leica primary antibody diluent. Slides were scanned in brightfield mode with a 20× objective using a NanoZoomer Digital Pathology System. Quantification of CC3 and IBA1 was carried out using the Visiopharm Image Analysis module.

Quantitative PCR analysis

RNA was isolated from primary MEFs or LET1 cells using Trizol extraction and first-strand cDNA synthesis was carried out with SuperScript III Reverse Transcriptase (Invitrogen, catalogue number 18080044). Quantitative PCR was carried out using a ViiA 7 Real Time PCR System (Thermo Fischer Scientific) using SYBR reagents (Thermo Fisher). The following primers were used for quantitative PCR: Zbp1, sense (S): 5′-AAGAGTCCCCTGCGATTATTTG-3′, antisense (AS): 5′-TCTGGATGGCGTTTGAATTGG-3′; Ripk1, S: 5′-GAAGACAGACCTAGACAGCGG-3′, AS: 5′-CCAGTAGCTTCACCACTCGAC-3′; Ccl2, S: 5′-TGGCTCAGCCAGATGCAGT-3′, AS: 5′-TTGGGATCATCTTGCTGGTG-3′; Ccl7, S: 5′-CCACATGCTGCTATGTCAAGA-3′, AS: 5′-ACACCGACTACTGGTGATCCT-3′; Ifit1, S: 5′-GCCATTCAACTGTCTCCTG-3′, AS: 5′-GCTCTGTCTGTGTCATATACC-3′; Ifnb, S: 5′-CTGGAGCAGCTGAATGGAAAG-3′, AS: 5′-CTTCTCCGTCATCTCCATAGGG-3′; Gapdh, S: 5′-GGCAAATTCAACGGCACAGT-3′, AS: 5′-AGATGGTGATGGGCTTCCC-3′.

RNA-sequencing and NanoString analysis

RNA was isolated from day-23 spleens (for RNA-seq) or treated cells (for NanoString experiments) using Trizol. An on-column DNAse treatment was included for RNA-seq experiments. Total RNA was added directly to lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara), and reverse transcription was carried out followed by PCR amplification to generate full-length amplified cDNA. Sequencing libraries were constructed using the NexteraXT DNA sample preparation kit (Illumina) to generate Illumina-compatible barcoded libraries. Libraries were pooled and quantified using a Qubit Fluorometer (Life Technologies). Dual-index, single-read sequencing of pooled libraries was carried out on a HiSeq2500 sequencer (Illumina) with 58-base reads, using HiSeq v4 Cluster and SBS kits (Illumina) with a target depth of 10 million reads per sample.

For NanoString, 254 transcripts were quantified from total RNA using the mouse nCounter Inflammation V2 panel (NanoString). The nSolver Analysis Software 4.0 with the nCounter Advanced Analyses package (version 2.0.134) was used to normalize the data and perform differential gene expression analysis to generate log₂[fold change] values and P values. Data visualizations were carried out in R (version 4.1.1). Differentially expressed genes were visualized as heatmaps and volcano plots using the packages pheatmap (version 1.0.12) and ggplot2 (version 3.3.5).

For RNA-seq analysis of day-23 spleens, reads were aligned using kallisto³⁶ to the mouse reference genome (GRCm39) using default parameters. Quality control was carried out on raw reads using fastqc, and raw reads were then combined with aligned reads using multiqc (ref. ³⁷), with no samples removed from the final dataset owing to quality control checks. Analysis of aligned reads was carried out with R using DESeq2 (ref. ³⁸) using standard parameters to generate differential gene expressions for each of the conditions against the WT, and significant differential expression was defined by adjusted P value < 0.01 and absolute log₂[fold change] > 1. The differential expression data were annotated using the bioMaRt package^39,40. Fold changes against WT mice for ADAR1-deficient (Adar^{P195A/p150null}) mice, with and without Zbp1-aknockout, were compared, defining genes with a >50% regression to a fold change of 0 after Zbp1-a knockout as high-recovery genes and all others as low-recovery genes. Gene ontology analysis was carried out using the clusterProfiler package⁴¹ using standard parameters comparing both high- and low-recovery genes against background separately.

Statistical analysis

Comparison of survival curves was carried out using a log-rank (Mantel–Cox) test. P values less than 0.0001 were a result of the statistical analysis package performed by GraphPad Prism and are represented as P < 0.0001. Data shown in graphs are mean or mean ± s.d. If the data fulfilled the criteria for Gaussian distribution tested by column statistics, an unpaired parametric t-test with Welch’s correction was carried out for statistical analysis. All statistical tests listed in the figure legends were two-sided and were carried out using Graphpad Prism, or Microsoft Excel (chi-square power values for Mendelian distributions). P values are presented in the figures or figure legends, generally, we used the following conventions: NS (P > 0.05), *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. All in vitro experiments, unless otherwise stated, were independently replicated a minimum of two times, and details on replication of displayed data are stated in the figure legends.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this paper.

Data availability

RNA-seq and NanoString data are available through the Gene Expression Omnibus of the National Institutes of Health, accession numbers GSE200854 (RNA-seq) and GSE200985 and GSE200986 (NanoString). Source data are provided with this paper.

Code availability

The R analysis was carried out using publicly available code, described in the Methods section; custom R scripts are available at https://github.com/OberstLab/Hubbard-et-al-2022-Nature.

References

Pestal, K. et al. Isoforms of RNA-editing enzyme ADAR1 independently control nucleic acid sensor MDA5-driven autoimmunity and multi-organ development. Immunity 43, 933–944 (2015).
Article CAS Google Scholar
Ahmad, S. et al. Breaching self-tolerance to Alu duplex RNA underlies MDA5-mediated inflammation. Cell 172, 797–810 (2018).
Article CAS Google Scholar
Herbert, A. et al. A Z-DNA binding domain present in the human editing enzyme, double-stranded RNA adenosine deaminase. Proc. Natl Acad. Sci. USA 94, 8421–8426 (1997).
Article ADS CAS Google Scholar
Rice, G. I. et al. Mutations in ADAR1 cause Aicardi-Goutières syndrome associated with a type I interferon signature. Nat. Genet. 44, 1243–1248 (2012).
Article CAS Google Scholar
Maurano, M. et al. Protein kinase R and the integrated stress response drive immunopathology caused by mutations in the RNA deaminase ADAR1. Immunity 54, 1948–1960 (2021).
Article CAS Google Scholar
Schwartz, T., Behlke, J., Lowenhaupt, K., Heinemann, U. & Rich, A. Structure of the DLM-1–Z-DNA complex reveals a conserved family of Z-DNA-binding proteins. Nat. Struct. Mol. Biol. 8, 761–765 (2001).
Article CAS Google Scholar
Rebsamen, M. et al. DAI/ZBP1 recruits RIP1 and RIP3 through RIP homotypic interaction motifs to activate NF-κB. EMBO Rep. 10, 916–922 (2009).
Article CAS Google Scholar
Thapa, R. J. et al. DAI senses influenza A virus genomic RNA and activates RIPK3-dependent cell death. Cell Host Microbe 20, 674–681 (2016).
Article CAS Google Scholar
Upton, J. W., Kaiser, W. J. & Mocarski, E. S. DAI/ZBP1/DLM-1 complexes with RIP3 to mediate virus-induced programmed necrosis that is targeted by murine cytomegalovirus vIRA. Cell Host Microbe 11, 290–297 (2012).
Article CAS Google Scholar
Chung, H. et al. Human ADAR1 prevents endogenous RNA from triggering translational shutdown. Cell 172, 811–824 (2018).
Article CAS Google Scholar
Li, Y. et al. Ribonuclease L mediates the cell-lethal phenotype of double-stranded RNA editing enzyme ADAR1 deficiency in a human cell line. Elife 6, e25687 (2017).
Article Google Scholar
Crow, Y. J. et al. Characterization of human disease phenotypes associated with mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR, and IFIH1. Am. J. Med. Genet. A 167, 296–312 (2015).
Article CAS Google Scholar
Ishii, K. J. et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature 451, 725–729 (2008).
Article ADS CAS Google Scholar
Koehler, H. S., Feng, Y., Mandal, P. & Mocarski, E. S. Recognizing limits of Z‐nucleic acid binding protein (ZBP1/DAI/DLM1) function. FEBS J. 287, 4362–4369 (2020).
Article CAS Google Scholar
Newton, K. et al. RIPK1 inhibits ZBP1-driven necroptosis during development. Nature 540, 129–133 (2016).
Article ADS CAS Google Scholar
Takaoka, A. et al. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature 448, 501–505 (2007).
Article ADS CAS Google Scholar
Nogusa, S. et al. RIPK3 activates parallel pathways of MLKL-driven necroptosis and FADD-mediated apoptosis to protect against influenza A virus. Cell Host Microbe 20, 13–24 (2016).
Article CAS Google Scholar
Varfolomeev, E. E. et al. Targeted disruption of the mouse caspase 8 gene ablates cell death induction by the TNF receptors, Fas/Apo1, and DR3 and is lethal prenatally. Immunity 9, 267–276 (1998).
Article CAS Google Scholar
Oberst, A. et al. Catalytic activity of the caspase-8–FLIP_L complex inhibits RIPK3-dependent necrosis. Nature 471, 363–367 (2011).
Article ADS CAS Google Scholar
Kaiser, W. J. et al. RIP3 mediates the embryonic lethality of caspase-8-deficient mice. Nature 471, 368–372 (2011).
Article ADS CAS Google Scholar
Alvarez-Diaz, S. et al. The pseudokinase MLKL and the kinase RIPK3 have distinct roles in autoimmune disease caused by loss of death-receptor-induced apoptosis. Immunity 45, 513–526 (2016).
Article CAS Google Scholar
Najjar, M. et al. RIPK1 and RIPK3 kinases promote cell-death-independent inflammation by Toll-like receptor 4. Immunity 45, 46–59 (2016).
Article CAS Google Scholar
Rothenburg, S. et al. A PKR-like eukaryotic initiation factor 2α kinase from zebrafish contains Z-DNA binding domains instead of dsRNA binding domains. Proc. Natl Acad. Sci. USA 102, 1602–1607 (2005).
Article ADS CAS Google Scholar
Koehler, H. et al. Vaccinia virus E3 prevents sensing of Z-RNA to block ZBP1-dependent necroptosis. Cell Host Microbe 29, 1266–1276 (2021).
Article CAS Google Scholar
Gray, E. E., Treuting, P. M., Woodward, J. J. & Stetson, D. B. Cutting edge: cGAS is required for lethal autoimmune disease in the Trex1-deficient mouse model of Aicardi–Goutières syndrome. J. Immunol. 195, 1939–1943 (2015).
Article CAS Google Scholar
Gall, A. et al. Autoimmunity initiates in nonhematopoietic cells and progresses via lymphocytes in an interferon-dependent autoimmune disease. Immunity 36, 120–131 (2012).
Article CAS Google Scholar
Murphy, J. M. et al. The pseudokinase MLKL mediates necroptosis via a molecular switch mechanism. Immunity 39, 443–453 (2013).
Article CAS Google Scholar
Kasparcova, V. et al. Cutting edge: RIP1 kinase activity is dispensable for normal development but is a key regulator of inflammation in SHARPIN-deficient mice. Immunol. 192, 5476–5480 (2014).
Article Google Scholar
Lin, J. et al. RIPK1 counteracts ZBP1-mediated necroptosis to inhibit inflammation. Nature 540, 124–128 (2016).
Article ADS CAS Google Scholar
Newton, K., Sun, X. & Dixit, V. M. Kinase RIP3 is dispensable for normal NF-kappa Bs, signaling by the B-cell and T-cell receptors, tumor necrosis factor receptor 1, and Toll-like receptors 2 and 4. Mol. Cell. Biol. 24, 1464–1469 (2004).
Article CAS Google Scholar
Salmena, L. et al. Essential role for caspase 8 in T-cell homeostasis and T-cell-mediated immunity. Gene Dev. 17, 883–895 (2003).
Article CAS Google Scholar
Henao-Mejia, J. et al. Generation of genetically modified mice using the CRISPR–Cas9 genome-editing system. Cold Spring Harb. Protoc. https://doi.org/10.1101/pdb.prot090704 (2016).
Shin, K.-J. et al. A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Proc. Natl Acad. Sci. USA 103, 13759–13764 (2006).
Article ADS CAS Google Scholar
Zarnegar, B. J. et al. irCLIP platform for efficient characterization of protein–RNA interactions. Nat. Methods 13, 489–492 (2016).
Article CAS Google Scholar
Orozco, S. et al. RIPK1 both positively and negatively regulates RIPK3 oligomerization and necroptosis. Cell Death Differ. 21, 1511–1521 (2014).
Article CAS Google Scholar
Bray, N. L., Pimentel, H., Melsted, P. & Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 34, 525–527 (2016).
Article CAS Google Scholar
Ewels, P., Magnusson, M., Lundin, S. & Käller, M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32, 3047–3048 (2016).
Article CAS Google Scholar
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Article Google Scholar
Durinck, S. et al. BioMart and Bioconductor: a powerful link between biological databases and microarray data analysis. Bioinformatics 21, 3439–3440 (2005).
Article CAS Google Scholar
Durinck, S., Spellman, P. T., Birney, E. & Huber, W. Mapping identifiers for the integration of genomic datasets with the R/Bioconductor package biomaRt. Nat. Protoc. 4, 1184–1191 (2009).
Article CAS Google Scholar
Yu, G., Wang, L.-G., Han, Y. & He, Q.-Y. clusterProfiler: an R Package for comparing biological themes among gene clusters. OMICS J. Integr. Biol. 16, 284–287 (2012).
Article CAS Google Scholar

Download references

Acknowledgements

This work is supported by the grants R01 AI153246 (to A.O. and D.B.S.), R01 CA228098 (to A.O.), R01 AI084914 (to D.B.S.), R01 AI143227 and R01 AI147177 (to R.S.), a Titus Fellowship (to N.W.H.), T32 T32AR7108-41 (to J.M.A.), and a Helen Hay Whitney Foundation Postdoctoral Fellowship (to N.S.G.). Extended Data Fig. 9a was created with BioRender.com. We thank P. Jain, I. Silva and R. Lee for technical assistance.

Author information

These authors contributed equally: Joshua M. Ames, Megan Maurano

Authors and Affiliations

Department of Immunology, University of Washington, Seattle, WA, USA
Nicholas W. Hubbard, Joshua M. Ames, Megan Maurano, Lan H. Chu, Kim Y. Somfleth, Nandan S. Gokhale, Margo Werner, Katrina Lichauco, Ram Savan, Daniel B. Stetson & Andrew Oberst
Department of Comparative Medicine, University of Washington, Seattle, WA, USA
Jessica M. Snyder

Authors

Nicholas W. Hubbard
View author publications
You can also search for this author in PubMed Google Scholar
Joshua M. Ames
View author publications
You can also search for this author in PubMed Google Scholar
Megan Maurano
View author publications
You can also search for this author in PubMed Google Scholar
Lan H. Chu
View author publications
You can also search for this author in PubMed Google Scholar
Kim Y. Somfleth
View author publications
You can also search for this author in PubMed Google Scholar
Nandan S. Gokhale
View author publications
You can also search for this author in PubMed Google Scholar
Margo Werner
View author publications
You can also search for this author in PubMed Google Scholar
Jessica M. Snyder
View author publications
You can also search for this author in PubMed Google Scholar
Katrina Lichauco
View author publications
You can also search for this author in PubMed Google Scholar
Ram Savan
View author publications
You can also search for this author in PubMed Google Scholar
Daniel B. Stetson
View author publications
You can also search for this author in PubMed Google Scholar
Andrew Oberst
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization: N.W.H., M.M., D.B.S., A.O.; methodology: N.W.H., M.M., R.S., L.H.C., N.S.G., D.B.S., A.O.; analysis: N.W.H. (all), J.M.A. (NanoString data), K.Y.S. (RNA-seq data analysis), J.M.S. (histopathological analysis and scoring), A.O.; investigation: N.W.H. (all), J.M.A. (NanoString, tissue culture and cell death assays), N.S.G. (Supplementary Fig. 1 co-immunoprecipitation experiments), L.H.C. (tissue culture, western blot and co-immunoprecipitation), K.L. (flow cytometry), M.W. (Ripk3/Trex1A.O.; writing original draft: N.W.H., A.O.; writing, review and editing: all authors.

Corresponding author

Correspondence to Andrew Oberst.

Ethics declarations

Competing interests

D.B.S. is a co-founder and shareholder of Danger Bio, LLC, and a scientific advisor for Related Sciences LLC. A.O. is a co-founder and shareholder of Walking Fish Therapeutics.

Peer review

Peer review information

Nature thanks Andreas Linkermann and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data figures and tables

Extended Data Fig. 1 Interaction of ZBP1 with RNA and ADAR1.

A. Co-precipitation ADAR1 with WT or mutant Zαβ (mZαβ) Flag-tagged ZBP1 (FLAG-ZBP1) after FLAG immunoprecipitation. Β. Immunoprecipitation and IR-CLIP analysis for RNA binding by of WT or mZαβ FLAG-ZBP1. C. Co-precipitation of ADAR1 and FLAG-tagged ZBP1 after UV-crosslinking. These experiments were performed in HEK293T cells.

Extended Data Fig. 2 Immunopathology in ADAR-mutant mice is ZBP1 dependent.

Survival proportions observed upon cross of Adar^p150null/WT::Zbp1-a^+/− mice to Adar^P195A/P195A::Zbp1-^+/−, **** p < 0.0001 (Mantel-Cox Log-Rank test) (A) or Adar^p150null/WT::Zbp1-a^−/− mice to Adar^P195A/P195A::Zbp1-a^−/−, not significant (Mantel-Cox Log-Rank test) (B). (C) Histopathological analysis of liver and kidney from affected, rescued and unaffected mice (genotypes indicated.) For liver samples, regions of cytoplasmic vacuolation indicated with asterisk. Original magnification 20x, HE staining. For kidney, glomeruli are indicated with arrows, from original magnification 40x HE staining.

Source data

Extended Data Fig. 3 Cross of Adar^{P195A/p150null} mice to a separately derived, fully congenic Zbp1^−/−-g strain.

A–B. SNP typing analysis of ZBP1-g (A) and ZBP1-a (B) mice. C–D. Zbp1^−/−-g::Adar^{P195A/p150null} survival proportions(C) and observed weight (D) at 21 days (weaning). Combined male & female, Zbp1^+/+::Adar^P195A/WT (n = 17), Zbp1^+/−::Adar^P195A/WT (n = 21), Zbp1^−/−::Adar^P195A/WT (n = 10), Zbp1^+/+::Adar^{P195A/p150null} (n = 9), Zbp1^+/−::Adar^P195A/WT (n = 25), Zbp1^−/−::Adar^P195A/WT (n = 7).

Source data

Extended Data Fig. 4 ZBP1 is IFN dependent and partially dependent on MDA5.

A. Twelve-hour stimulation of LET1 and SVEC cells with varying concentrations of IFN-β followed by Western Blot analysis for ZBP1 protein. B. Quantitative PCR analysis for Zbp1 and Ifnb after ADAR1 depletion in wild-type (scramble gRNA) or MDA5 knockout LET1. Gene was normalized against Gapdh. Significance determined by individual student t-tests. Each group (Zbp and Ifnb) contains 3 biologic replicates, each comprising the average of 4 technical replicates). This experiment is representative of two independent repeats. Whisker bars are presented as mean +/− SD. C. Survival of Zbp1^−/−::MDA5^−/−::ADAR^{p150null/p150null} mice. Zbp1-a^+/+::Ifih1^−/−::Adar^p150null/+ n = 6, Zbp1-a^+/+::Ifih1^−/−::Adar^{p150null/p150null} n = 4, Zbp1-a^−/−::Ifih1^−/−::Adar^p150null/+ n = 5, Zbp1-a^−/−::Ifih1^−/−::Adar^{p150null/p150null} n = 3. Statistical significance determined by Mantel-Cox (Log-Rank) test. D. Survival proportions of Zbp1^−/−-a::Adar^p150/WT intercross. Chi square power analysis performed, indicating significance at p = 1.82x10⁻⁵.

Source data

Extended Data Fig. 5 Identification of ZBP1 dependent and independent aspects of the ADAR1 inflammatory signature.

A–B: Cleveland plots indicating changes in the ADAR1 dependent gene signature observed in the spleens of 23 day old mice, indicating most- (A) and least- (B) changed genes upon ZBP1 ablation in Adar^{P195A/p150null} mice. Gene selection is the top 30 largest contributors to the ZBP1 dependent (A) and independent (B) signature from ADAR^{P195A/p150null} mice, in comparison to WT mice. Gene Ontology analysis was performed on the signatures from A and B. C–D: GO-terms analysis for ZBP1-independent signature (C), and the ZBP1 dependent signature analysis (D).

Extended Data Fig. 6 Flow cytometry analysis of splenic cellular subsets.

B cell, T cell, monocyte, macrophage percentages from day 23 spleens of Zbp1::Adar^p150/P195A mice.

Extended Data Fig. 7 ZVAD treatment induces phosphorylation of RIPK3 in ADAR mutant MEFs in a ZBP1 dependent fashion.

A. Analysis of phospho-RIPK3 in ADAR1 mutant MEFs after 4 h ZVAD treatment. B. Confirmation of ZBP1 gRNA knockout in ADAR1 mutant MEFs.

Extended Data Fig. 8 MLKL or RIPK1^{kinase dead} mutations do not rescue ADAR^{P195A/p150null} mutation.

Three-week-old weights (weaning) of male or female Adar^{P195A/p150null} mice crossed to animals lacking, A: MLKL. Mlkl^+/−::Adar^P195A/WT (m/f n = 9/7), Mlkl^+/−::Adar^{P195A/p150null} (m/f n = 8/2), Mlkl^−/−::Adar^P195A/WT (m/f n = 8/5), Mlkl^−/−::Adar^{P195A/p150null} (m/f n = 6/3). or B: carrying a point mutation abrogating the kinase activity of RIPK1 (Ripk1^kd). Ripk1^kd/+::Adar^P195A/WT (m/f n = 3/11), Ripk1^kd/+::Adar^{P195A/p150null} (m/f n = 7/5), Ripk1^kd/kd::Adar^P195A/WT (m/f n = 11/8), Ripk1^kd/kd::Adar^{P195A/p150null} (m/f n = 5/5). Statistical differences determined by individual student t-tests (two tailed). All genotypes are littermates from mixed litters.

Source data

Extended Data Fig. 9 Oligomerization of ZBP1 triggers necroptotic cell death.

A. Schematic indicating the replacement of ZBP1’s Z-DNA binding domain with a tandem FKBP domain. B–D: Cell death following addition of B/B homodimerizer with indicated combinations of ZVAD and GSK843 in LET1s (each group, n = 4 biologic replicates) (B), SVECs (each group n = 4 biologic replicates) (C) or MEFs (each group n = 3 biologic replicates) (D). Statistical significance was determined by unpaired t tests (two-tailed). Experiments B and C are representative of two independent experiments, and D is representative of 3 independent experiments. All whisker bars are presented as mean +/− SD.

Source data

Extended Data Fig. 10 Molecular analysis of cell death induced by ZBP1-2xFV homodimerization.

A. Phospho-MLKL analysis of ZBP1-2xFV MEFs (wild-type, Ripk3^−/−, MLKL^−/−) after 1 h stimulation with B/B homodimerizer. B. Cleaved-caspase 3 analysis of ZBP1-2xFV MEFs (wild-type, Ripk3^−/−, MLKL^−/−) after 3 h stimulation with B/B homodimerizer. C. Representative image depicting Caspase-8 deficiency exacerbation of disease phenotype in ADAR^{P195A/p150null}::RIPK3^−/− mice. Image of 20-day old littermates from the cross depicted in Fig. 4b.

Extended Data Fig. 11 Pathologic analysis of Mlkl−/−::Casp8^−/−::^{Adarp150null/P195A} mice. A–B.

Immunohistochemical staining (A) and quantification (B) in liver for cleaved-caspase 3. (n = 3 d.0 pups, each group) Original magnification 10x. C. Additional histological images of other tissue sites (kidney, liver and small intestine). Kidney (20x) and liver (10x) PAS staining, small intestine HE staining (original magnification as stated). D–E. Immunohistochemical staining, with 2.5x and 10x images (D) and quantification (E) in brain for Iba1 (n = 3 d.0 pups, each group). B & E use tissues from matched animals.

Source data

Extended Data Fig. 12 Immunoprecipitation of RIPK3 and RIPK1 by ZBP1 is enhanced by Casp8 deficiency.

A. Pulldown of ZBP1-2xFV (FKBP) and co-precipitation of RIPK1 in Ripk3^−/−::Casp8^−/− MEFs. B. Pulldown of ZBP1-2xFV (FKBP) and co-precipitation of RIPK1 and RIPK3 in Mkl^−/−::Casp8^−/− MEFs. C. Pulldown of ZBP1 and co-precipitation of RIPK3 and in Mlkl^−/−::Adar^{p150null/P195A} MEFs.

Extended Data Fig. 13 ZBP1 activation results in RIPK1 dependent, RIPK3 independent gene transcription which is enhanced by knockout of Casp8.

A–B Differential transcript analysis of Mlkl^−/−::Casp8^+/+ and Mlkl^−/−::Casp8^−/− MEFs (n = 3) following ADAR depletion, by (A) Heatmap analysis and (B) individual quantification of the top 5 differentially expressed genes. Statistical significance determined by individual unpaired t tests (two-tailed). Where not indicated: **** p < 0.0001. C. QPCR analysis of top 5 differentially expressed genes identified (B) in MEFs expressing ZBP1-2xFV after B/B activation after depletion of RIPK1. n = 6 biologic replicates for each treatment group, each representing the average of three technical replicates. Data is compiled from two independent experiments. Statistical significance determined by individual unpaired t tests (two-tailed). Where indicated: **** p < 0.0001. Whisker bars represent the mean +/− SD.

Source data

Extended Data Fig. 14 ZBP1^A64P mutation attenuates ZBP1 activity in ADAR deficiency model and during influenza infection.

A. Previously-reported structures of the ZBDs of ZBP1 (left) and ADAR1 (right), with A64 and P195A (respectively) highlighted in green. PDB accession #s: 1J75 and 3F21. B. Survival proportions of Adar1^{P195A/p150null}::ZBP1^A64P mice (n = 9 animals) compared with previous survival statistics of Adar^{P195A/p150null}::ZBP1-a^+/− animals. C. Cell death analysis following influenza (X31, MOI 2) infection of primary MEFs derived from Wild Type (B6/J), Zbp1^−/− or ZBP1^A64P/A64P mice. Each group, n = 2 biologic replicates. Whisker bars represent the mean +/− SD. Experiment was independently replicated using MEFs derived from a different embryo. D. Expression of ZBP1 in wild-type, Zbp1^−/−, and Zbp1^A64P/A64P MEFs following 24 stimulation with 1000 IU/mL murine IFN-β.

Source data

Supplementary information

Supplementary Figures

This file contains Supplementary Figs. 1 and 2, which include the uncropped images of the western blots used in the study and a schematic of the flow gating strategy.

Reporting Summary

Peer Review File

Source data

Source Data Fig. 1

Source Data Fig. 2

Source Data Fig. 3

Source Data Fig. 4

Source Data Extended Data Fig. 2

Source Data Extended Data Fig. 3

Source Data Extended Data Fig. 4

Source Data Extended Data Fig. 8

Source Data Extended Data Fig. 9

Source Data Extended Data Fig. 11

Source Data Extended Data Fig. 13

Source Data Extended Data Fig. 14

Rights and permissions

Springer Nature or its licensor holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.

Reprints and permissions

About this article

Cite this article

Hubbard, N.W., Ames, J.M., Maurano, M. et al. ADAR1 mutation causes ZBP1-dependent immunopathology. Nature 607, 769–775 (2022). https://doi.org/10.1038/s41586-022-04896-7

Download citation

Received: 23 September 2021
Accepted: 23 May 2022
Published: 20 July 2022
Issue Date: 28 July 2022
DOI: https://doi.org/10.1038/s41586-022-04896-7

This article is cited by

Osteoking promotes bone formation and bone defect repair through ZBP1–STAT1–PKR–MLKL-mediated necroptosis
- Suya Zhang
- Yudong Liu
- Na Lin
Chinese Medicine (2024)
Regulation of inflammatory diseases via the control of mRNA decay
- Masanori Yoshinaga
- Osamu Takeuchi
Inflammation and Regeneration (2024)
Apoptosis dysfunction: unravelling the interplay between ZBP1 activation and viral invasion in innate immune responses
- Jianhao Zhan
- Jisheng Wang
- Hongmei Wang
Cell Communication and Signaling (2024)
RNA editing enzymes: structure, biological functions and applications
- Dejiu Zhang
- Lei Zhu
- Peifeng Li
Cell & Bioscience (2024)
Novel insights into double-stranded RNA-mediated immunopathology
- Richard de Reuver
- Jonathan Maelfait
Nature Reviews Immunology (2024)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Subjects

Abstract

Similar content being viewed by others

Main

ZBP1 loss rescues ADAR1 mutation

An inflammatory signature remains in rescued mice

Cell death signalling in ADAR1 mutant mice

Caspase 8 suppresses lethal inflammation

Methods

Mice

Cell lines

Plasmids, lentiviral vectors and short interfering RNA

Antibodies and inhibitors

Western blot, immunoprecipitation and infrared crosslinkingand immunoprecipitation

Flow cytometry

Cell death analysis

Pathology

Quantitative PCR analysis

RNA-sequencing and NanoString analysis

Statistical analysis

Reporting summary

Data availability

Code availability

References

Acknowledgements

Author information

Authors and Affiliations

Contributions

Corresponding author

Ethics declarations

Competing interests

Peer review

Peer review information

Additional information

Extended data figures and tables

Supplementary information

Source data

Rights and permissions

About this article

Cite this article

Share this article

This article is cited by

Comments

Search

Quick links