Generation of antigen-specific mature T cells from RAG1−/−RAG2−/−B2M−/− stem cells by engineering their microenvironment

Chang, Patrick C; Yuan, Xuegang; Zampieri, Alexandre; Towns, Chloe; Yoo, Sang Pil; Engstrom, Claire; Tsai, Steven; Robles, Christopher R.; Zhu, Yuhua; Lopez, Shawn; Montel-Hagen, Amelie; Seet, Christopher S.; Crooks, Gay M.

doi:10.1038/s41551-023-01146-7

Download PDF

Article
Open access
Published: 07 December 2023

Generation of antigen-specific mature T cells from RAG1^−/−RAG2^−/−B2M^−/− stem cells by engineering their microenvironment

Patrick C Chang^1,2,
Xuegang Yuan²^na1,
Alexandre Zampieri²^na1,
Chloe Towns²,
Sang Pil Yoo^1,2,
Claire Engstrom²,
Steven Tsai³,
Christopher R. Robles⁴,
Yuhua Zhu²,
Shawn Lopez²,
Amelie Montel-Hagen²,
Christopher S. Seet^3,5,6,7 &
…
Gay M. Crooks ORCID: orcid.org/0000-0002-2488-8468^2,5,6,7,8

Nature Biomedical Engineering (2023)Cite this article

4642 Accesses
11 Altmetric
Metrics details

Subjects

Abstract

Pluripotent stem cells (PSCs) are a promising source of allogeneic T cells for off-the-shelf immunotherapies. However, the process of differentiating genetically engineered PSCs to generate mature T cells requires that the same molecular elements that are crucial for the selection of these cells be removed to prevent alloreactivity. Here we show that antigen-restricted mature T cells can be generated in vitro from PSCs edited via CRISPR to lack endogenous T cell receptors (TCRs) and class I major histocompatibility complexes. Specifically, we used T cell precursors from RAG1^−/−RAG2^−/−B2M^−/− human PSCs expressing a single TCR, and a murine stromal cell line providing the cognate human major histocompatibility complex molecule and other critical signals for T cell maturation. Possibly owing to the absence of TCR mispairing, the generated T cells showed substantially better tumour control in mice than T cells with an intact endogenous TCR. Introducing the T cell selection components into the stromal microenvironment of the PSCs overcomes inherent biological challenges associated with the development of T cell immunotherapies from allogeneic PSCs.

FOXO1 is a master regulator of memory programming in CAR T cells

Article Open access 10 April 2024

FOXO1 enhances CAR T cell stemness, metabolic fitness and efficacy

Article Open access 10 April 2024

Depleting myeloid-biased haematopoietic stem cells rejuvenates aged immunity

Article 27 March 2024

Main

Cell-based immunotherapies in which autologous T cells have been engineered to express chimaeric antigen receptors and antigen-specific T cell receptors (TCRs) have produced impressive clinical responses in patients with otherwise treatment-refractory diseases^1,2,3,4. Despite producing curative results, the widespread application of adoptive cell therapies is limited by the complex and costly manufacturing processes needed for the delivery of patient-specific treatments². Currently, autologously engineered T cell products rely on adequate patient lymphocyte counts and on a clinical status that allows the incorporation of cell therapy^5,6,7. In addition, clinical responses are uneven, at least in part because of the variability of the T cell composition of each patient product⁸.

To overcome these constraints, development of an ‘off-the-shelf’ engineered T cell product has garnered increasing interest. However, the requirement for an allogeneic source with this approach presents two main barriers: donor T cell-mediated alloreactivity (causing graft-versus-host disease)⁹ and host-mediated rejection of human leucocyte antigen (HLA)-mismatched allogeneic donor cells¹⁰. Although the manipulation of these allogeneic mechanisms via gene editing of healthy donor peripheral blood (PB) T cells has been performed⁷, current techniques do not guarantee complete ablation of endogenous TCRs, and the process of gene editing carries the risk of genomic translocations and deleterious off-target events. Thus, there is a need to identify self-renewing sources of engineered T cells that allow for the validation and expansion of suitable clones after multiple cycles of gene editing.

Owing to their self-renewing capacity, human pluripotent stem cells (PSCs) are especially amenable to gene editing and clonal selection. A unique hurdle for the use of PSCs, however, is the complex in vitro process of haematopoietic and T cell development that must follow genetic manipulation of PSCs. Recent development of a three-dimensional culture method called the artificial thymic organoid (ATO) allows highly efficient and reproducible T cell differentiation with positive selection of mature, conventional CD8αβ⁺ (CD3⁺TCRαβ⁺CD8αβ⁺, hereafter SP8) T cells from multiple haematopoietic and PSC sources^11,12. Induction of T cell development in the ATO system is accomplished using the murine MS5 stromal cell line engineered to express human delta-like ligand 4 (hDLL4) as a transgene. PSCs engineered using lentivirus to express a transgenic tumour-specific TCR¹² or chimaeric antigen receptor¹³ can produce antigen-specific T cells after differentiation in ATOs; however, these previous studies were performed in cells with intact endogenous TCR and major histocompatibility complex (MHC) expression, thus allowing positive selection through a broad repertoire of endogenous TCRs and a diverse range of peptide MHCs (pMHCs) presented by PSC-derived cells (self-selection).

In this article, we report a method that provides all the necessary signals required for the positive selection of antigen-specific, mature, conventional CD8αβ⁺ T cells from PSCs that lack all endogenous TCR rearrangements and MHC class I expression. To prevent the generation of any endogenous TCRs, recombination activation gene 1 (RAG1) and RAG2, which together facilitate V(D)J recombination of germline TCR loci¹⁴, was ablated via CRISPR–Cas9 gene editing in PSCs. To generate the class I MHC-null phenotype, β₂-microglobulin (B2M) was targeted for knockout (KO)^15,16. Full T cell differentiation, including positive selection, was achieved from RAG1⁻^/−RAG2⁻^/−B2M^−/− PSCs by combining transgenic expression of a single TCR in PSCs, with exogenous expression of the cognate human MHC in the MS5-hDLL4 stromal line. The resulting SP8 T cells showed potent antigen-specific cytotoxicity in vitro and tumour control in vivo that was superior to PSC-derived T cells with intact endogenous TCR rearrangement. Overall, these results show that the presentation of a single human MHC complex in a murine stromal line can rescue developing human T cells that express a single, exogenous TCR.

Results

KO of RAG1 and RAG2 prevents TCR rearrangement and T cell maturation

As RAG1 and RAG2 are located within an ~30 kb region of chromosome 11, complete deletion of their coding sequences was achieved with two single guide RNAs (sgRNAs; Fig. 1a and Supplementary Fig. 1a,b). Following identification of optimal sgRNAs (Supplementary Fig. 1c–g), single-cell RAG1 and RAG2 double KO (DKO) clones were generated from both the H1 and ESI017 parent embryonic stem cell lines, and then differentiated towards the T cell lineage using our previously developed protocol for the ATO system¹² (Fig. 1a and Supplementary Fig. 2a). Unedited (wild type, hereafter WT) PSCs proceeded through development normally, with surface expression of TCR and CD3 and spontaneous positive selection predominantly towards the CD8αβ⁺ T cell lineage (Fig. 1b,c and Supplementary Fig. 2b,c). Differentiation of both DKO PSC lines proceeded normally into the T lineage-committed phase (CD45⁺CD5⁺CD7⁺; Supplementary Fig. 2d,e), but did not express surface TCR at any stage of differentiation, confirming a functional loss of endogenous TCR rearrangement (Fig. 1b). Although there was an early, transient population of CD8α⁺ cells, they did not persist in cultures and lacked surface TCR expression (CD45⁺CD5⁺CD7⁺CD8α⁺TCRαβ⁻CD3⁻), indicating that they did not undergo positive selection. Differentiation of DKO PSCs proceeded no further than the double-positive (DP; CD45⁺CD5⁺CD7⁺CD8α⁺CD4⁺) T precursor stage, indicating a failure to undergo positive selection in the absence of endogenous TCRs (Fig. 1c). Output of DKO cultures peaked at 3 weeks, with a dramatic decrease in DP T precursors over the remainder of differentiation, consistent with ‘death by neglect’ (Fig. 1c,d and Supplementary Fig. 2d,e). Together, the differentiation profile of DKO PSCs showed that RAG1 and RAG2 deletion halts conventional T cell development at the DP T precursor stage and prevents positive selection, similar to previous studies characterizing T cell development from RAG-deficient PSCs^17,18.

**Fig. 1: Inhibition of T cell development at the DP stage of T cell differentiation by DKO of *RAG1* and *RAG2*.**

Positive selection of RAG1 and RAG2 knockout PSCs is MHC restricted

We next investigated whether lentiviral expression of a single exogenous TCR could overcome the halt in differentiation seen in DKO PSCs and restore positive selection. The WT and DKO clones of H1, an HLA-A*02:01 positive (A*0201^pos) PSC line, and ESI017, an HLA-A*02:01 negative (A*0201^neg) PSC line, were transduced with a lentiviral vector encoding the α- and β-chains of the HLA-A*02:01-restricted 1G4 TCR specific for the tumour-associated NYESO_157–165 peptide (hereafter, WT + TCR and DKO + TCR PSCs, respectively)^19,20.

Lentiviral transduction of the 1G4 TCR in both H1 and ESI017 DKO PSC lines produced high levels of expression of the transgene in all resulting T cells after differentiation in ATOs (Fig. 2a). Expression of the transgenic TCR did not impair differentiation from either of the WT + TCR PSC lines, with robust production of mature, conventional, single-positive CD8αβ⁺ T cells (SP8), regardless of MHC expression (Fig. 2b,c and Supplementary Fig. 3).

**Fig. 2: Class I MHC-restricted rescue of T cell development by 1G4 TCR in *RAG1* and *RAG2* DKO PSCs.**

In contrast, when 1G4 TCR was expressed in DKO lines, only the A*0201^pos line (H1) generated SP8 T cells (Fig. 2b and Supplementary Fig. 3). The A*0201^neg (ESI017) line did not proceed beyond the DP T precursor stage (Fig. 2b and Supplementary Fig. 3), and cultures were dominated by CD4⁻CD8⁻ (double negative) cells (Fig. 2b,d). Thus, in the RAG-deficient setting, positive selection only occurred in cultures initiated from PSCs that expressed the cognate MHC to which the transgenic TCR was restricted, showing that ‘self-selection’ occurs during T cell differentiation.

Although positively selected SP8s generated from H1 DKO + TCR PSCs showed a conventional CD8αβ⁺ phenotype and naive T cell markers (CD8αβ⁺CD45RO⁻CD45RA⁺CD62L⁺; Fig. 2c and Supplementary Fig. 3), the overall SP8 percentage and yield per ATO aggregate was significantly lower compared with that of the WT line, indicating that rescue of positive selection was incomplete with the exogenous 1G4 TCR in a RAG-deficient setting (Fig. 2d,e).

Generating RAG1, RAG2 and B2M triple-KO PSCs

To remove class I MHC expression, a CRISPR–Cas9 sgRNA was designed to target the start of the B2M coding sequence to generate insertion–deletion (indel) mutations (Fig. 3a and Supplementary Fig. 4a–e) in ESI017 DKO + TCR PSCs, thus producing RAG1^−/−RAG2^−/−B2M^−/− (that is, triple KO (TKO)) PSCs transduced with the 1G4 TCR (TKO + TCR, hereafter). Edited cells were isolated by flow cytometry based on a class I MHC-null phenotype (HLA-A,-B,-C⁻B2M⁻; Supplementary Fig. 4f). TKO + TCR PSCs were expanded and growth, morphology and karyotype remained unchanged from the parent or DKO + TCR PSC lines.

**Fig. 3: Engineering the ATO stroma to express *HLA-A***02:01* rescues differentiation of 1G4 TCR-transduced *RAG1*, *RAG2* and *B2M* TKO PSCs.**

Engineering ATOs to induce positive selection from TKO PSCs

As class I MHC molecules were ablated in TKO + TCR PSCs, rescue of positive selection via the transgenic TCR could not be achieved through self-selection on MHC from PSC-derived cells (Fig. 3b). Therefore, to provide a positive selection signal for developing DP T precursors, the MS5-hDLL4 line (hDLL4 hereafter) was further transduced to express HLA-A*02:01 (the cognate MHC for the 1G4 TCR), with or without human B2M (hB2M), generating the hDLL4-A*0201-hB2M (hDLL4-A02B) and hDLL4-A*0201 (hDLL4-A02) lines, respectively (Supplementary Fig. 5). A subset of the hDLL4-A02B stroma was transduced to also express cell adhesion molecule intercellular adhesion molecule 1 (ICAM1), which has been shown to interact with lymphocyte function-associated antigen 1 (LFA1) on T cells to increase the strength of signalling through the TCR and survival of thymocytes^21,22,23. The resulting hDLL4-A*0201-hB2M-ICAM1 stroma is hereafter referred to as ‘hDLL4-A02BI’.

Full differentiation of WT + TCR PSCs was induced in the ATO using either standard hDLL4 or modified stromal lines expressing the additional transgenes mentioned above (Fig. 3a,b and Supplementary Fig. 6a–c). In contrast, development of T cells from TKO + TCR PSCs was halted at the DP stage of development using either hDLL4 (Fig. 3b and Supplementary Fig. 6d–f) or hDLL4-A02 stroma (Supplementary Fig. 7a). In these conditions, DP T precursors from TKO + TCR PSCs decreased rapidly (Fig. 3b,c and Supplementary Fig. 7b), similar to previous experiments with DKO + TCR PSCs (Fig. 2d).

In contrast, stromal conditions that expressed both HLA-A*02:01 and hB2M induced positive selection of SP8 cells from TKO + TCR PSCs (Fig. 3b,c and Supplementary Figs. 6e and 7a). Interestingly, although inclusion of ICAM1 in the hDLL4-A02BI stroma did not change the percentage of SP8 T cells in ATO cultures, it significantly increased the output of SP8 T cells per ATO (Supplementary Fig. 7a–c). TKO + TCR SP8 T cells reached peak enrichment in organoid cultures after 6 weeks of T cell differentiation (Fig. 4a,b), and showed a mature, conventional, naive phenotype (Fig. 4c and Supplementary Fig. 6e,f). In addition, the use of hDLL4-A02BI stroma in ATOs induced positive selection from a TKO line derived from the H1 parent PSC line transduced with the 1G4 TCR (Supplementary Fig. 7d), and generated SP8 T cells with the HLA-A*02:01-restricted F5 TCR recognizing MART1_26–35 peptide, expressed in ESI017 TKO PSCs (TKO + F5 TCR) (Supplementary Fig. 8a,b).

**Fig. 4: Output and phenotypic characterization of SP8 T cells from *RAG1*, *RAG2* and *B2M* TKO PSCs.**

Previously published approaches generate SP8 T cells through agonist selection or antigen stimulation of isolated DP precursors^24,25,26. Although direct comparison of these complete protocols with the model presented here is not possible, we attempted to compare these methods using the TKO + TCR DP precursors collected from week 3 ATOs. DP precursors were activated through CD3 engagement (OKT3 antibody or anti-CD3/CD28 microbeads) or K562 artificial antigen-presenting cells (aAPCs) engineered to express the cognate antigen and co-stimulatory factors CD80, CD83 and CD137L (4-1BBL) (Supplementary Fig. 9a). SP8s generated through activation of ATO⁻ DP precursors through CD3 engagement adopted a CD8αβ⁺CD45RO⁻CD45RA⁺CD62L⁻ phenotype (Supplementary Fig. 9b), but did not expand with further stimulation in the absence of PB mononuclear cell feeders (Supplementary Fig. 9c,d). SP8s generated through aAPC stimulation of DPs initially adopted a CD8αβ⁺CD45RO^intermedCD45RA^intemedCD62L⁻ phenotype and achieved ~15-fold further expansion either with additional aAPC or phytohaemagglutinin stimulation; in both methods of expansion, cells converted to a CD8αβ⁺CD45RO⁻CD45RA⁺CD62L⁻ phenotype similar to that seen with CD3-based selection (Supplementary Fig. 9c,d). In contrast, ATO-generated SP8s displayed a typical naive mature (CD8αβ⁺CD45RA⁺CD62L⁺) phenotype (Supplementary Figs. 3f and 6e,f) after 6 weeks of ATO culture, and adopted a T effector memory phenotype (CD8αβ⁺CD45RO⁺CD45RA⁻CD62L⁻CD27⁻CCR7⁻) after isolation and expansion (Supplementary Fig. 9e).

Transcriptomic analysis of TKO + TCR SP8 T cells

To characterize the transcriptomic identity of TKO + TCR SP8 T cells, single-cell RNA sequencing (scRNA-seq) was performed on isolated SP8 cells from TKO + TCR ATOs along with SP8s from WT PSC-derived controls (WT with hDLL4 stroma, WT + TCR with hDLL4 stroma and WT + TCR with hDLL4-A02BI stroma). In addition, scRNA-seq datasets from thymic SP8 (ref. ²⁷), whole PB^28,29 and unpublished PB SP8 datasets were incorporated for comparison. Dimensionality reduction through uniform manifold approximation and projection (UMAP) (Fig. 5a and Supplementary Fig. 10a,b) and quantification of SP8 T cell lineage genes (Fig. 5b and Supplementary Fig. 10c,d) indicated that TKO + TCR SP8 T cells closely resemble SP8s derived from unedited PSCs from thymus and PB. In addition, unsupervised hierarchical clustering and pairwise Pearson’s correlation analysis of global gene expression for each sample showed that TKO + TCR SP8 T cells cluster and closely correlate with WT ATO-derived SP8 T cells, and with isolated thymic and PB SP8s (Fig. 5c).

**Fig. 5: scRNA-seq profiling of PSC-derived, peripheral and thymus SP8s.**

TCR mispairing enables MHC-independent positive selection

Despite the presence of positive selection from TKO + TCR PSCs, overall SP8 T cell output was reduced compared with WT + TCR PSCs (Fig. 4a,b). As positive selection in the WT + TCR (A*0201^neg) ES017 line occurred in the absence of the 1G4 TCR’s cognate MHC (Fig. 2b,d), we hypothesized that in the presence of competent RAG1 and RAG2, mispairing between endogenous and exogenous TCR chains would broaden the range of pMHCs that could induce positive selection and circumvent the cognate MHC restriction of the 1G4 TCR.

To investigate the mechanism by which WT T cells carrying a transgenic TCR escaped MHC restriction, SP8 T cells were isolated from ATOs generated from WT, WT + TCR and TKO + TCR PSCs, and sequenced using the 10X Genomics platform to detect exogenous and endogenous TCR V_α and V_β chains at single-cell resolution.

Although all WT + TCR SP8 cells expressed the 1G4 transgene, TCR sequencing showed that only 21% ± 3.06% of WT + TCR SP8 exclusively expressed 1G4 (Fig. 6a); endogenously rearranged TCR V_α chains were detected in 76.78% ± 4.04% (mean ± s.d.) of WT + TCR SP8 T cells generated using hDLL4 stroma (n = 2, 8,618 cells total) and in 76.53% ± 1.56% of WT + TCR SP8 T cells generated with hDLL4-A02BI stroma (n = 3, 12,797 cells total). A diverse TCR V_α repertoire was observed in WT + TCR SP8 cells (Fig. 6b), indicating (as expected) that the exogenous TCR transgene was ineffective in suppressing endogenous TCR V_α rearrangement during T cell development.

**Fig. 6: Mispairing between endogenous TCR chains and transgenic TCR chains is absent in SP8s derived from TKO + TCR PSCs.**

Interestingly, endogenously rearranged TCR V_β chains were also detected in addition to the exogenous 1G4 TCR in 21.00% ± 9.18% of WT + TCR SP8 T cells generated with hDLL4 stroma and in 13.32% ± 3.57% of WT + TCR SP8 T cells generated with hDLL4-A02BI stroma (Fig. 6a,c). Typically, allelic exclusion of endogenous TCR V_β loci is observed when an exogenous TCR is expressed before V(D)J recombination^30,31; however, these results indicate that allelic exclusion of the endogenous TCR V_β was not complete in the context of in vitro PSC differentiation of T cells (Fig. 6a). Whereas only a minority of T cells co-expressed endogenous TCR V_β in addition to the exogenous TCR (Fig. 6a), the TCR V_β repertoire was still broadly distributed (Fig. 6c).

As expected, the TKO + TCR SP8 T cells expressed only the transgenic 1G4 TCR, confirming that RAG1 and RAG2 deletion prevented all endogenous TCR V_α and TCR V_β rearrangement (n = 3, 7,930 cells total; Fig. 6a–c). Combined with the previous observation that selection in DKO + TCR PSCs was MHC restricted (Fig. 2a,b and Supplementary Fig. 2d,e), these results show that WT + TCR PSCs escape HLA-A*02:01 restriction of the exogenous 1G4 TCR through RAG-mediated endogenous TCR recombination.

Functional characterization of TKO PSC-derived SP8 T cells

To explore the functional consequences of TCR mispairing, in vitro and in vivo assays were performed on WT + TCR and TKO + TCR SP8 T cells isolated from week 6 ATO cultures. Before the functional assays, SP8 T cells were expanded with aAPCs expressing the cognate antigen (NYESO_157–165). Similar to WT + TCR SP8 T cells, TKO + TCR SP8 T cells showed polyfunctional cytokine production and CD107α mobilization in response to stimulation with aAPCs expressing the cognate antigen but not an irrelevant (MART1_26–35) peptide (Fig. 7a). Both WT + TCR and TKO + TCR SP8 T cells upregulated surface CD25 and 4-1BB after overnight stimulation with cognate antigen (Fig. 7b) and underwent antigen-specific proliferation (Fig. 7c).

**Fig. 7: Functional characterization of PSC-derived, antigen-specific T cells in vitro.**

Despite uniform expression of the transgenic V_β13.1 TCR chain, ~60% of WT + TCR SP8 cells did not stain with tetramer for the 1G4 TCR, consistent with mispairing of TCRs at the cell surface (Fig. 7d). In contrast, TKO + TCR SP8 T cells retained a 1:1 ratio of 1G4 TCR tetramer to transgenic V_β13.1 staining (Fig. 7d). TKO + TCR SP8 T cells showed robust loss of surface TCR in response to cognate antigen (consistent with intracellular relocation), whereas 60% of WT + TCR SP8 T cells retained surface TCR (Fig. 7e).

Expanded WT + TCR and TKO + TCR T cells also showed potent antigen-specific cytotoxicity in vitro (Fig. 7f). Both WT + TCR and TKO + TCR SP8 T cells were able to undergo robust expansion over input SP8, reaching >250-fold expansion over 5 cycles of antigen-specific activation in the presence of interleukin-7 (IL-7) and interleukin-2 (IL-2) (Fig. 7g).

Expanded TKO + TCR and WT + TCR SP8 T cells were subjected to one freeze–thaw cycle and then further expanded with aAPCs expressing NYESO_157–165 peptide before testing in an in vivo tumour challenge. Immune-deficient (NOD scid gamma (NSG)) mice were intravenously (I.V.; tail vein) engrafted with luciferase-expressing NALM6 tumour cells engineered to express NYESO_157–165 peptide as a single-chain trimer (SCT; Fig. 8a). Engraftment of NALM6 cells was confirmed after 5 days by imaging, before mice were stratified into groups with equivalent tumour signal (n = 9 for each group; Fig. 8b). After stratification, SP8 T cells were injected I.V. (retro-orbitally) and monitoring of tumour progression was performed by imaging (Fig. 8a–c). IL-2 (10,000 IU per mouse) was provided intraperitoneally during the course of the experiment (Fig. 8a). At the conclusion of the experiment, TKO + TCR SP8 T cells showed significantly improved tumour control compared with mice that received either no T cells or WT + TCR SP8 T cells (Fig. 8b–d), and they showed improved survival compared with mice that received no T cells (Supplementary Fig. 10e).

**Fig. 8: In vivo function of 1G4-expressing, class I MHC-null, *RAG1*- and *RAG2*-null SP8 T cells.**

Discussion

The challenges inherent in using an allogeneic source for adoptive T cell therapy take on a new level of complexity in the setting of PSC-derived T cells, where the recapitulation of T cell differentiation requires the same TCR and MHC machinery that must be removed to avoid alloreactivity. Here we report that, by introducing the components required for positive selection into separate cellular sources, it is possible to generate antigen-restricted, mature, conventional T cells from PSCs in which all endogenous TCR and class I MHC expression has been removed. Specifically, two transgenic class-I-restricted TCRs were expressed in PSCs to circumvent the loss of endogenous TCR rearrangement, and cognate MHC was provided by a supportive stromal line, also engineered to provide other critical external signals during T cell development. Whereas SP8 differentiation efficiency varied based on the TCR, the dependence of in vitro T cell differentiation on the MHC expressed by PSC-derived cells (self-selection) was removed, and the murine stromal cells were used as a surrogate for the thymic epithelial cells that normally provide these critical signals in the thymus.

Production of SP8 T cells from PSCs has been achieved by other groups after TRAC or RAG disruption to prevent expression of endogenous TCRs; all such approaches used agonist or antigen-specific stimulation of cells arrested at the DP stage in monolayer or non-stromal T cell differentiation cultures^24,25,26. Although CD8αβ T cells could be generated using such approaches with ATO-derived DPs, the phenotypes were different from CD8αβ T cells spontaneously generated in ATO cultures, both after initial DP stimulation (based on lack of CD62L expression) and further expansion (based on persistent CD45RA expression in DP stimulated and expanded cells). In contrast, the ATO-derived SP8s initially appeared to be phenotypically closer to mature, naive T cells, and converted to a T effector memory phenotype with further expansion; the functional relevance of these phenotypic differences will require rigorous analysis in future studies.

By deleting both RAG1 and RAG2 genes, we avoided the possibility of residual recombination activity that can occur with single gene disruption^{25,26,32,33,34}. Furthermore, the absence of observable defects in function or cytotoxicity with full RAG ablation allowed us to manipulate T cell differentiation in the complete absence of endogenous TCRα and TCRβ rearrangement.

Consistent with data from patient samples^17,18, RAG1^−/−RAG2^−/− PSCs were able to differentiate as far as the DP stage and cell cultures failed early. Although expression of a transgenic TCR produced some mature SP8s from RAG1⁻^/−RAG2⁻^/− PSCs, cell output was low and most cells failed to advance beyond the double-negative stage, suggesting that self-selection is inefficient when it relies on a single TCR. The more robust output of mature T cells from unedited PSCs that were transduced with the same A*0201-restricted 1G4 TCR was likely due to the wider array of MHC interactions provided by mispairing between the 1G4 TCR and the broad repertoire of endogenous TCRs produced in RAG-competent cells. This conclusion is further strengthened by the efficient T cell differentiation even from A*0201^neg RAG-competent PSCs that expressed the 1G4 TCR.

It was previously shown that TCRα rearrangement occurs from induced PSCs from reprogrammed T cells in which a pre-rearranged TCR exists²⁵. The TCR V_β rearrangements that we noted to also be present in the RAG1- and RAG2-competent cells showed that allelic exclusion induced by the exogenous 1G4 V_β chain was not absolute; however, expression of these low-frequency V_β chains was barely, if at all, detectable on the cell surface by flow cytometry, and the functional relevance of potential V_β mispairing is unclear^11,12.

Although conventional, mature SP8 T cells generated from TKO + TCR PSCs were transcriptionally and functionally similar to WT + TCR PSC-derived SP8 T cells based on in vitro proliferation and killing, TKO + TCR T cells proved to be significantly superior in controlling tumour growth in vivo. In line with previous studies^{25,35,36,37,38}, our results are consistent with decreased potency of antigen-specific killing due to TCR mispairing, and we found that this effect was particularly important under in vivo conditions; however, we note the ability of such models to predict clinical responses remains to be determined.

In contrast to the poor efficiency of positive selection through self-selection of a single transgenic TCR and intact MHC in the PSCs, a significant improvement in positive selection and cell output was seen when fully human class I MHC (including hB2M) was instead provided by the stromal component of the cultures. It is intriguing to speculate how the MHC–TCR interaction may be quantitively or even qualitatively different when it involves stromal–T, rather than T–T, interaction, but it is conceivable that the mechanosensory stimulation of the TCR is different in each case^39,40.

The murine stromal cell line was further engineered to provide an additional co-factor that could enhance positive selection. ICAM1 has been reported to potentiate TCR activation and antigen sampling through LFA1 interactions at low pMHC densities^21,22,23, which is an inherent nature of positive selection when T cells are scanning for low-affinity, ‘weak’ peptides. It has also been shown that ICAM1–LFA1 signalling leads to cytoskeletal remodelling, increased TCR signal transduction, and both NOTCH-responsive and survival gene expression⁴¹. Although the direct mechanism of ICAM1 during T cell development was not characterized, its inclusion in the murine MS5 stromal cells significantly increased output of SP8 T cells, while having no observable effects on the ratios of developing T cells. Future studies could focus on delineating the effects of including additional signals and co-factors at the immune synapse similar to those provided by thymic epithelial cells during physiological thymopoiesis. In addition, further studies to understand how these manipulations affect TCR signalling during positive selection would be of interest, although the analyses will be challenging given the dynamic nature of complex in vitro development systems, such as the ATO, which comprise heterogeneous populations of differentiating cells.

In summary, we have shown that both stem cells and the in vitro microenvironment can be modified to deliver the necessary signals when alloreactive mechanisms are disrupted. To avoid all immune-mediated rejection of allogeneic T cells, additional manipulations of the class I MHC-null T cells to avoid natural killer (NK)-mediated rejection will be required^42,43,44, along with the deletion of class II MHC. Notably, we have shown that the block to positive selection caused by the removal of class I MHC expression in allogeneic PSCs can be rescued by pairing an exogenous TCR in developing T cells with an engineered murine stromal microenvironment. In addition to providing a cognate MHC, the accessory stromal cells of the ATO system can be modified to deliver other extrinsic signals or co-stimulation factors that improve T cell function and specification, providing an experimental method to dissect T cell differentiation and positive selection in vitro. Owing to their inherent self-renewal capacity, gene-edited PSCs and their stromal counterparts can be readily engineered with additional strategies that will augment T cell function and immune evasion for immunotherapy.

Methods

Cell lines

The MS5-hDLL4 cell line was generated in our laboratory as previously described¹². For clarity, we reproduce the following description from ref. ¹². Briefly, MS5 cells⁴⁵ were transduced with a lentiviral vector encoding full-length hDLL4. The highest 5% of DLL4-expressing cells were isolated by fluorescence-activated cell sorting (FACS) using an anti-hDLL4 antibody and passaged in DMEM with 10% fetal calf serum (FCS). Stable expression was confirmed by flow cytometry for hDLL4 expression after several weeks of culture, along with quantitative RT-PCR and RNA sequencing.

For the cell lines including class I MHC and scaffolding proteins, the previously derived MS5-hDLL4 line was transduced with varying combinations of individual lentiviruses encoding human HLA-A*02:01, hB2M and human ICAM1 (hICAM1). The highest 5% of transduced cells were isolated by FACS using antibodies detecting HLA-A*02:01, hB2M and hICAM1, and then passaged in DMEM with 10% FCS for expansion and cryopreservation. Stable expression was also confirmed by flow cytometry for hDLL4, HLA-A*02:01, hB2M and hICAM1.

aAPCs were generated in our laboratory as previously described¹². For clarity, we reproduce the following description from ref. ¹². K562 cells (catalogue number CCL-243; ATCC) were transduced with lentiviral vectors encoding full-length human CD80, CD83, CD137L and HLA-A*02:01-B2M-NYESO_157–165 SCT (gifts from David Baltimore; Caltech). Target cells for the cytotoxicity assay were created by transduction of K562 with either NYESO1 or MART1 SCTs.

Lentiviral vector packaging

The full-length coding sequences of hDLL4, human HLA-A*02:01, hB2M and hICAM1 were synthesized (Integrated DNA Technologies) and cloned into third-generation lentiviral vector backbone pCCL-c-MNDU3 (gift from Donald Kohn, University of California, Los Angeles (UCLA)). The mStrawberry fluorescence protein coding sequence was added downstream of HLA-A*02:01, separated by a furin-SGSG-2A linker for polycistronic expression.

The codon-optimized TCR V_α and V_β (including V_β13.1) chains of a TCR specific for HLA-A*02:01/NYESO_157–165 (derived from the 1G4 TCR²⁰) were previously described¹⁹ (gift from Antoni Ribas; UCLA). TCR coding sequences and the mTagBFP2 fluorescence protein⁴⁶, all separated by furin-SGSG-2A linkers, were subcloned into the third-generation pCCL lentiviral vector downstream of the ubiquitin C promoter with intron 1.

Packaging and concentration of lentivirus particles were performed as previously described¹¹. For clarity, we reproduce the following description from ref. ¹¹. Briefly, 293T cells (catalogue number CRL-3216; ATCC) were co-transfected with the lentiviral vector plasmids pCMV-DR8.9 and pCAGGS-VSVG using TransIT 293T (Mirus Bio) for 17 hours followed by treatment with 20 mM sodium butyrate for 8 hours, followed by generation of cell supernatants in serum-free UltraCulture for 48 hours. Supernatants were concentrated by ultrafiltration using Amicon Ultra-15 100K filters (EMD Millipore) at 4,000g for 40 min at 4 °C and stored as aliquots at −80 °C.

Human pluripotent cell lines

The human Embryonic Stem Cell Research Oversight Committee and Institutional Review Board have approved all protocols for the use of PSCs for this study. The human embryonic stem cell lines⁴⁷ (catalogue number WA01; WiCell) and ESI017 (ref. ⁴⁸) (catalogue number ES-700; ESI BIO) were maintained and expanded on Matrigel-coated 6-well plates (Growth Factor Reduced Matrigel Matrix; catalogue number 356231; BD Biosciences) in mTeSR Plus complete medium (mTeSR Plus Basal Medium and mTeSR 5X Supplement; catalogue number 100-0276; Stem Cell Technologies). Culture medium was changed daily. After reaching ~70% confluency, PSC cultures were dissociated with TrypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) and seeded in single-cell suspension at a density of 2 × 10⁵ cells per well of a Matrigel-coated 6-well plate in mTeSR Plus complete medium and ROCK inhibitor Y-27632 dihydrochloride (10 µM; catalogue number 1254; Tocris Bioscience), which was removed from culture medium after 1 day.

Design and validation of CRISPR–Cas9 guide RNAs

Using published algorithms found on the Benchling web tool (https://benchling.com), 5 guide RNAs (gRNAs) with optimal in silico-predicted on- and off-target scores (out of 100) were designed to target sequences near the start of RAG1, RAG2 and B2M^{49,50,51,52,53,54}. On-target efficiency was assayed in vitro at each target locus by nucleofection of gRNA expressing pX459 plasmid (catalogue number 62988; Zhang Lab, MIT; Addgene) into K562 erythroleukemia cells (catalogue number CCL-243; ATCC).

Genomic DNA was collected from nucleofected cells, and the regions flanking the cleavage sites were amplified by PCR for RAG1 (693 bp; forward, 5′-TGTATACTGGGACCCTTGGGGAG-3′; reverse, 5′-AGAATTCCCACAGATGCGGCAGAG-3′), RAG2 (865 bp; forward, 5′-TCATCAGTGAGAAGCCTGGCTG-3′; reverse, 5′-GTCACGGCTTTTGTAACCTCGG-3′) and B2M (644 bp; forward, 5′-TGAAGTCCTAGAATGAGCGCCC-3′; reverse, 5′-TAAACTTTGTCCCGACCCTCCC-3′). Products were purified and on-target CRISPR–Cas9 cutting efficiency was determined by Sanger sequencing of the PCR products using the Tracking of Indels by Decomposition (TIDE) tool⁵⁵. The percentage of edited cells was calculated based on the indels produced as a result of double-stranded breaks from CRISPR–Cas9.

For each gene target, the two gRNA candidates with the highest on-target in vitro cutting activity were chosen for off-target cleavage activity in vitro via the genome-wide, unbiased identification of double-stranded breaks enabled by sequencing (GUIDE-seq) method⁵⁶. One gRNA with high on- and low off-target cutting activity was chosen for each target gene to proceed with editing in PSC lines.

Gene editing of human PSC lines

CRISPR–Cas9 gene editing of PSCs was performed with ribonucleoprotein (RNP) complexes⁵⁷ of purified spCas9-NLS (QB3 MacroLab, University of California, Berkeley) and custom-synthesized sgRNAs (Synthego). spCas9-NLS and gRNAs were stored at −80 °C before use for gene editing of PSCs.

Briefly, PSCs were allowed to grow in wells of a Matrigel-coated 6-well plate until reaching ~70% confluency before being dissociated with TrypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) and resuspended in single-cell solution. Before nucleofection, 84 pmol of each gRNA was complexed with 60 pmol of spCas9, individually, at a ratio of 1 pmol spCas9 to 1.4 pmol gRNA for 15 min at room temperature. PSCs were resuspended at a concentration of 2 × 10⁵ cells in 14 µl of P4 Primary Cell Nucleofector Solution (P4 Primary Cell 4D-Nucleofector X Kit S, catalogue number V4XP-4032; Lonza).

For sgRNA reactions, fully complexed RNPs (60 pmol spCas9:84 pmol gRNA) were added to resuspended cells and the volume was brought up to 20 µl using P4 Primary Cell Nucleofector Solution (Lonza). For dual gRNA reactions, RNPs were complexed individually and then added (2× 60 pmol spCas9 total) into the cell suspension with a custom-synthesized single-stranded oligonucleotide donor template (ssODN, 100 bp, resuspended at 100 µM; Ultramer DNA Oligo; Integrated DNA Technologies) to a final concentration of 3 µM in solution. Twenty microlitres of combined PSC, RNP and/or ssODN solutions were added into individual wells of the 16-well Nucleocuvette Strip (Lonza). Nucleofection was performed on the 4D-Nucleofector Core and X Unit (catalogue numbers AAF1003B and AAF-1003X; Lonza) using pulse and frequency code CB-150. Cells were allowed to rest in the cuvette for 10 min before transferring into 1.5 ml mTeSR Plus and ROCK inhibitor Y-27632 dihydrochloride (10 µM), and then plated in 1 well of a Matrigel-coated 12-well plate. Culture medium was changed daily, and ROCK inhibitor Y-27632 dihydrochloride (10 µM) was removed from the medium after 48 hours. Edited PSCs were allowed to reach ~70% confluency before being expanded for single-cell cloning and cryopreservation.

KO of RAG1 and RAG2 in both H1 and ESI017 parent lines was achieved using a gene-ablation strategy that excised the ~30 kb region on chromosome 11 in which their coding regions were located using both RAG1 CRISPR number 4 and RAG2 CRISPR number 14 gRNAs (Supplementary Fig. 1c,d), and a 100 bp ssODN homology-directed repair template (5′-TTTTCATTGTTCTCAGGTACCTCAGCCAGCATGGCAGCCTCTTTCCCAC CCCCTGGTATTGCTGGAGCCTCTCCTGGGGACTTTTGAACAGGTGACCCGA-3′) (Supplementary Fig. 1g). Complete ablation of RAG1 and RAG2 genes was confirmed by PCR amplification of a 693 bp sequence within the excised region in PSC clones (RAG PCR number 1, forward, 5′-TGTATACTGGGACCCTTGGGGAG-3′; reverse, 5′-AGAATTCCCACAGATGCGGCAGAG-3′); proper re-joining of the chromosomal ends was confirmed with PCR amplification of a novel 609 bp product using primers that targeted sequences outside of the ~30 kb region excised by gene editing in PSC clones (RAG PCR number 2, forward, 5′-TGTATACTGGGACCCTTGGGGAG-3′; reverse, 5′-GTCACGGCTTTTGTAACCTCGG-3′) (Supplementary Fig. 1g,h). KO of B2M in DKO lines was achieved by introducing indels at the beginning of its coding sequence (exon 1 with B2M gRNA number 3), and polyclonal KO lines were purified via FACS (Supplementary Fig. 4c–f).

Single-cell cloning of edited human PSC lines

Single-cell cloning was achieved with low-density plating of expanded, edited PSCs⁵⁴. Briefly, expanded, edited PSCs were dissociated into single-cell solution with TrypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) and then plated in Matrigel-coated 10 cm dishes at a density of 0.5–1 × 10⁴ cells per plate in mTeSR Plus complete culture medium with ROCK inhibitor Y-27632 dihydrochloride (10 µM). Culture medium was changed daily, and ROCK inhibitor Y-27632 dihydrochloride (10 µM) was removed from the medium after 48 hours. After colony formation, 24–48 individual colonies were scraped with a 200 µl ‘P200’ pipette tip under a microscope, and then they were transferred into individual wells of a Matrigel-coated 12-well plate with mTeSR Plus culture medium. Once cells reached 60–80% confluency, cells were passaged via scraping for expansion and genotyping PCRs to determine bi-allelic KO of edited genes. Clones with bi-allelic KOs were expanded, cleaned for differentiation, and then genotyped once again before cryopreservation and karyotyping.

Transduction of human PSC lines

NYESO TCR-transduced PSC lines were generated by transduction of unedited or KO H1 or ESI017 PSCs with either lentiviral vectors encoding the 1G4 TCR (HLAA*02:01 restricted recognizing NYESO_157–165 peptide) or the F5 TCR (HLA-A*02:01 restricted recognizing MART1_26–35 peptide) and the fluorescence marker mTagBFP2. Briefly, PSCs were dissociated into single-cell suspension and plated at a density of 2 × 10⁵ cells per well of a Matrigel-coated 6-well plate in mTeSR Plus culture medium with ROCK inhibitor Y-27632 dihydrochloride (10 µM). The following day, the culture medium was changed to 1 ml of mTeSR, and concentrated lentiviral supernatant was added directly into the wells. The medium was changed each day until cells reached ~70% confluency, when cells were dissociated with TypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) and purified via FACS sorting using the phenotype TRA1-81⁺mTagBFP2⁺. Isolated cells were returned to culture on Matrigel-coated 6-well plates and mTeSR Plus culture medium for expansion and cryopreservation.

Generation and isolation of human embryonic mesodermal progenitors

Mesodermal commitment was induced as previously described with certain optimizations^12,58,59. Briefly, PSCs were maintained as single-cell cultures on Matrigel-coated 6-well plates in mTeSR Plus complete medium. PSCs were collected as a single-cell suspension after treatment with TrypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) for 6 min at 37 °C, washed and counted. Cells were resuspended directly in X-VIVO 15 medium (catalogue number 04-418Q; Lonza) supplemented with recombinant human (rh) activin A (10 ng ml⁻¹; catalogue number 338-AC-0101; R&D Systems), rhBMP4 (10 ng ml⁻¹; catalogue number 314-BP-010; R&D Systems), rhVEGF (10 ng ml⁻¹; catalogue number 298-VS-005; R&D Systems), rhFGF (10 ng ml⁻¹; catalogue number 233-FB-025; R&D Systems) and ROCK inhibitor Y-27632 dihydrochloride (10 µM; catalogue number 1254; Tocris Bioscience). Cells were plated on Matrigel-coated 6-well plates at 3.3 × 10⁶ cells per well in 3 ml. The medium was then changed daily with X-VIVO 15 supplemented with rhBMP4 (10 ng ml⁻¹), rhVEGF (10 ng ml⁻¹) and rhFGF (10 ng ml⁻¹). At day 3.5, cells were washed 3 times with PBS and incubated with Accutase (catalogue number AT-104; Innovative Cell Technologies): 1 ml per well for 10 min at 37 °C. Cells were collected by dilution with magnetic-activated cell sorting (MACS) buffer (PBS, 0.5% bovine serum albumin and 2 mM EDTA) followed by depletion of CD326⁺ (EpCAM) cells by MACS using CD326 (EpCAM) MicroBeads (catalogue number 130-061-101; Miltenyi). In addition, embryonic mesodermal progenitors (EMPs) derived from RAG1^−/−RAG2^−/−B2M⁻^/− TKO PSCs were stained with PE-conjugated hB2M antibody (BioLegend) and also depleted of B2M⁺ cells using MACS Anti-PE MicroBeads (catalogue number 130-048-801; Miltenyi) in addition to CD326 MicroBeads.

Human PSC-derived embryonic mesodermal organoid and ATO cultures

Embryonic mesodermal organoids (EMOs) and ATOs were generated as previously described¹². For clarity, we reproduce the following description from ref. ¹². Briefly, sequential generation of EMOs and then ATOs was accomplished in three-dimensional aggregates through changing media (Fig. 1a and Supplementary Fig. 2a). EMOs were established by aggregating purified EMPs with MS5-hDLL4 cells. MS5-hDLL4 cells were collected by trypsinization and resuspended in ‘haematopoietic induction media’ comprising EGM2 (catalogue number CC-4176; Lonza) supplemented with ROCK inhibitor Y-27632 dihydrochloride (10 µM; catalogue number 1254; Tocris Bioscience) and TGFβRI inhibitor SB-431542 (10 µM; SB Blocker, catalogue number 1614; Tocris Bioscience). At day −14, 5 × 10⁵ MS5-hDLL4 cells were combined with 5 × 10⁴ (H1) or 1 × 10⁵ (ESI017) purified EMPs per ATO in 1.5 ml Eppendorf tubes and centrifuged at 300g for 5 min at 4 °C in a swinging bucket centrifuge.

Multiple (up to 180) EMOs were prepared per tube. Supernatants were carefully removed and the cell pellet was briefly vortexed and resuspended in haematopoietic induction medium at a volume of 5 µl per EMO. Three EMOs were individually plated (5 µl per EMO) on a 0.4 mm Millicell transwell insert (catalogue number PIMC0R5G50; EMD Millipore) and then placed in a 6-well plate containing 1 ml of haematopoietic induction medium per well. The medium was changed every 2–3 days for 1 week with medium composed of EGM2 with SB Blocker (10 mM). At day −7, the medium was changed to EGM2 + SB Blocker (10 mM) with the haematopoietic cytokines, 5 ng ml⁻¹ rhTPO (catalogue number 288-TPN-025; R&D Systems), 5 ng ml⁻¹ rhFLT3L (catalogue number 308-FK-025; R&D Systems) and 50 ng ml⁻¹ rhSCF (catalogue number 255-SC-200; R&D Systems). This medium was changed every 2–3 days for an additional 7 days. At day 0, ATOs were initiated by simply changing to ATO culture medium (RB27) composed of RPMI 1640 (catalogue number 10-040-CV; Corning), 4% B27 supplement (catalogue number 17504044; Thermo Fisher Scientific), 30 mM l-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (catalogue number A8960-5G; Sigma-Aldrich) reconstituted in PBS, 1% penicillin-streptomycin (catalogue number 15140122; Thermo Fisher Scientific), 1% Glutamax (catalogue number 35050061; Thermo Fisher Scientific), 10 ng ml⁻¹ rhSCF (R&D Systems), 5 ng ml⁻¹ rhFLT3L (R&D Systems) and 5 ng ml⁻¹ rhIL-7 (catalogue number 207-IL-200; R&D Systems). The medium was completely changed every 3–4 days.

For experiments involving the use of engineered stromal lines for ATO T cell differentiation (MS5-hDLL4-A*0201, MS5-hDLL4-A*0201-hB2M and MS5-hDLL4-A*0201-hB2M-ICAM), EMOs were collected in bulk after 14 days (day 0) by adding 1 ml MACS buffer (PBS, 0.5% bovine serum albumin and 2 mM EDTA) to each filter, briefly disaggregating the ATO by scraping with a 1 ml ‘P1000’ pipette and then passed through a 50 µm nylon strainer. Collected cells were counted, and then 2 × 10⁴ cells were combined with 2.5 × 10⁵ engineered MS5-hDLL4 stromal cell lines per ATO in 1.5 ml Eppendorf tubes. Cell mixtures were centrifuged at 300g for 5 min at 4 °C in a swinging bucket centrifuge before the formation of 3 ATO aggregates (5 µl per aggregate) per 0.4 mm Millicell transwell insert (catalogue number PIMC0R5G50; EMD Millipore), similarly to the EMO aggregate formation described above.

Isolation of ATO-derived SP8 and DP precursor cells

ATOs were collected by adding MACS buffer (PBS, 0.5% bovine serum albumin and 2 mM EDTA) to each filter, briefly disaggregating the ATO by pipetting with a 1 ml P1000 pipette, and then they were passed through a 50 µm nylon strainer; SP8 T cells were collected after 6 weeks of T cell differentiation, and DP precursors were collected after 3 weeks. For bulk-scale collection of ATOs, aggregates were collected in a similar fashion; however, up to 150 aggregates were collected in a well filled with MACS buffer and then they were transferred onto a 50 µm nylon filter, where aggregates were physically dissociated on top of the filter using the back end of a sterile 1 ml syringe. After dissociation, the filter was washed with MACS buffer and cell mixtures were centrifuged at 300g for 5 min at 4 °C in a swinging bucket centrifuge.

Stimulation and expansion of DP precursors

ATO-derived DP precursors were isolated as described above and seeded at an initial density of 5 × 10⁵ cells per well of a 48-well plate with 1 ml of specific culture medium described below. The activation and expansion of DP precursors using OKT3 antibody followed previously published protocols^25,26. DP precursors were isolated as described above and stimulated with 500 ng ml⁻¹ Ultra-LEAF Purified anti-human CD3 antibody (clone OKT3; BioLegend) and activated through CD3 engagement with Ultra-LEAF Purified anti-human CD3 antibody (catalogue number 317326; BioLegend) in MEMα (catalogue number 12561049; Thermo Fisher Scientific) supplemented with 15% FCS, 1% Glutamax (catalogue number 35050061; Thermo Fisher Scientific), 1% penicillin-streptomycin (catalogue number 15140122; Thermo Fisher Scientific), 1% Insulin-Transferrin-Selenium solution (catalogue number 41400045; Thermo Fisher Scientific) and 50 µg ml⁻¹ l-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma-Aldrich) in the presence of 10 ng ml⁻¹ rhIL-7 (R&D Systems) and 10 nM dexamethasone (catalogue number D4902; Sigma-Aldrich) for 3 days before anti-human CD3 antibody and dexamethasone were removed. Expansion of T cells was carried out after 7 days for an additional 14 days (21 days total) in MEMα (catalogue number 12561049; Thermo Fisher Scientific) supplemented with 15% FCS, 1% Glutamax (catalogue number 35050061; Thermo Fisher Scientific), 1% penicillin-streptomycin (catalogue number 15140122; Thermo Fisher Scientific), 1% Insulin-Transferrin-Selenium solution (catalogue number 41400045; Thermo Fisher Scientific) and 50 µg ml⁻¹ l-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma-Aldrich) in the presence of 10 ng ml⁻¹ rhIL-7 (R&D Systems), 5 ng ml⁻¹ rhIL-15 (catalogue number 247-ILB-025; R&D Systems) and 2 µg ml⁻¹ phytohaemagglutinin (catalogue number L1668-5MG; Sigma-Aldrich). For both activation and expansion stages, fresh medium was added every 2–3 days, and cells were replated into larger wells as necessary.

Activation and expansion of DP precursors was also performed using Dynabeads Human T-Activator CD3/CD28 (catalogue number 11131D; Thermo Fisher Scientific) according to the manufacturer’s protocol. Briefly, beads were added in a 1:1 ratio of T cells to beads in AIM V (catalogue number 12055083; Thermo Fisher Scientific) supplemented with 5% human AB serum (catalogue number 100-512; Gemini Bio-Products), 20 ng ml⁻¹ rhIL-2 (catalogue number 200-02; Peprotech) and 5 ng ml⁻¹ rhIL-7 (R&D Systems). Beads were replenished every 7 days, fresh medium was added every 2–3 days and cells were replated into larger wells as necessary.

Activation and expansion of DP precursors was also performed with irradiated antigen-expressing K562 aAPCs (K562 CD80-CD83-CD137L expressing either HLA-A*02:01-B2M-NYESO_157–165 SCT or HLA-A*02:01-B2M-MART1_26–35 SCT) in a 1:3 aAPC:T cell ratio in AIM V (Thermo Fisher Scientific) supplemented with 5% human AB serum (Gemini Bio-Products), 20 ng ml⁻¹ rhIL-2 (Peprotech) and 5 ng ml⁻¹ rhIL-7 (R&D Systems). Irradiated aAPCs were added every 7 days in a 1:3 aAPC:T cell ratio, fresh medium was added every 2–3 days and cells were replated into larger wells as necessary.

Single-cell RNA library preparation and sequencing

ATO-derived T cells were isolated as described above and then FACS sorted for ATO-derived SP8 T cells from WT (mCD29⁻CD45⁺CD8α⁺CD4⁻) and 1G4 TCR-transduced (mCD29⁻mTagBFP2⁺CD45⁺CD8α⁺CD4⁻) PSC ATOs into PBS + 0.04% bovine serum albumin. Cells were counted and resuspended at a concentration of ~1,000 cells per µl and provided to the Technology Center for Genomics and Bioinformatics (TCGB) core for unique molecular identifier (UMI) tagging and generation of gene expression (GEX) and human TCR repertoire (V(D)J) libraries using the 10X Chromium Next GEM Single Cell V(D)J Reagent Kit v.1.1 (10X Genomics). Similarly, PB SP8s were FACS isolated (CD45⁺CD8α⁺CD8β⁺CD4⁻TCRαβ⁺CD3⁺) from PB mononuclear cells obtained from healthy donors, and provided to the TCGB core for UMI tagging and library generation. Fully constructed libraries for all samples were run in one S4 flow cell on the Illumina NovaSeq Platform.

GEX and TCR reference genomes

The reference genomes used for GEX and TCR alignment, both of which correspond to the GRCh38 genome, were downloaded from the 10X Genomics website. To detect the exogenous TCR, which was expressed using a codon-optimized sequence, the GRCh38 reference genome was customized using the Cell Ranger v.7.0.0 (10X Genomics) ‘mkref’ pipeline.

scRNA-seq data filtration and cleaning

Sequenced reads from each sample were aligned to the human reference genome GRCh38 and filtered for empty droplets using the Cell Ranger v.7.0.0 (10X Genomics) ‘multi’ pipeline that generated count matrices from the GEX libraries and assembled full TCR contigs from the V(D)J libraries. On average, we achieved >30,000 mean reads per cell for GEX expression libraries and >7,000 mean reads per cell for V(D)J libraries.

For samples that were acquired for this study, GEX (RNA) count matrices were loaded with Seurat v.4.3.0 (Satija Lab)⁶⁰. As V(D)J libraries were also generated from the same complementary DNA, TCR genes aligned by whole transcriptomic sequencing were removed to prevent clustering bias from samples with intact germline TCR recombination. Count matrices were loaded separately and barcoded cells were filtered for cells with outlier UMI counts (low-quality cells and doublets), high mitochondrial gene expression (due to cellular stress or loss of cytoplasmic RNA) and low number of sequenced genes. After initial data filtration, individual datasets were bioinformatically cleaned for doublets using DoubletFinder v.2.0.3 (ref. ⁶¹), and cells were cleaned for stochastic dropouts of identity genes based on their sorted SP8 phenotype (CD8α, CD8β, CD3 > 0 and CD4 < 0). Cleaned cells were then batch corrected for technical and biological variations using the reciprocal principal component analysis (RPCA) integration method in Seurat. For integration of the combined ATO-derived SP8 T cell samples, molecular count data for each sample were individually normalized and variance stabilized using SCTransform in Seurat, and then cell cycle phase scores were calculated for each individual sample based on the expression of canonical cell cycle genes within a barcoded cell. Following cell cycle scoring, raw counts were normalized and variance was stabilized again using SCTransform in Seurat with the additional steps of regressing calculated cell cycle scores and mitochondrial genes to mitigate the effects of cell cycle heterogeneity and mitochondrial gene expression.

To perform RPCA integration of ATO-derived SP8 samples, highly variable genes (nfeatures = 5,000) were identified and then used to find integration anchors between datasets. Clustering of the fully integrated object of ATO-derived SP8 samples was performed using the IKAP (Identifying K mAjor cell Population group in scRNA-seq analysis) package⁶². IKAP analysis identified the optimal principal components and clusters for the dataset. Of the three clusters identified, one cluster was removed based on high mitochondrial gene expression, indicating stressed cells or loss of cytoplasmic RNA, and the other two were identified as immature (CD45RO⁺) and mature, naive (CD45RA⁺) SP8 T cells based on differentially expressed genes. Mature, naive CD45RA⁺ SP8 T cells were used for downstream analyses.

For publicly available datasets from human thymic SP8 (GSE148981; ref. ²⁷), PB NK and CD14⁺ monocyte (PB monocytes) cells (10X Genomics^28,29), raw sequencing reads were downloaded from their respective repositories and then aligned to the human reference genome GRCh38 using the Cell Ranger v.7.0.0 (10X Genomics) ‘count’ pipeline, similarly to method described above, which only generated count matrices from the GEX reads. Individual samples were loaded, filtered and cleaned using Seurat v.4.3.0 (Satija Lab), similarly to that described above. Total PB samples were SCTransform normalized in Seurat and variance stabilized before integration, and principal components were identified from the integrated object. Then, dimensional reduction (UMAP) and cell clustering was performed on the integrated object using the functions included in the Seurat package (Satija Lab). PB NK and CD14⁺ monocytes (PB monocytes) and PB SP8 T cells were identified and subset out of the integrated object for downstream analyses.

Analysis and visualization of scRNA-seq data

Cleaned samples were merged into a single Seurat (Satija Lab) object, preserving only the raw RNA count matrices for each object. Each sample was then normalized and variance stabilized using SCTransform in Seurat before regressing cell cycle phase scores and mitochondrial genes, as described above, before remerging the list back into a single object. Given the individual SCTransform models calculated from each sample, the minimum median UMI was used to recorrect the counts and data slot for downstream analysis using PrepSCTFindMarkers in Seurat (Satija Lab). Scaled expression values of highly variable genes, which were identified as the union of the top 5,000 genes from each individual sample during SCTransform in Seurat, were used to calculate principal component analysis for dimensionality reduction using the UMAP function in Seurat (Satija Lab). Individual cell populations (SP8, NK and monocytes) clustered together, and minor outliers were manually cleaned for gene expression visualization using the DotPlot function in Seurat (Satija Lab).

To perform global gene expression analysis between individual samples and their respective sources, a pseudobulk approach was taken by extracting the raw counts and metadata from the object, described above, and creating an object using the SingleCellExperiment package⁶³. Individual samples were assigned identities based on cell type identity and source to create a DEseq2 (ref. ⁶⁴) object in R, and pseudobulked counts were normalized using the regularized-logarithm transformation (rlog) function. Pearson’s correlations of global gene expression for all pairwise combinations between each sample were calculated from the rlog-normalized data using the cor() function in R v.4.2.1 (ref. ⁶⁵). Dendrogram and hierarchical clustering analysis were visualized using the pheatmap package⁶⁶.

For the purposes of analysing SP8 T cells without the addition of PB monocytes and PB NK cells, SP8 T cells were subset out of the object and each individual sample was normalized using SCTransform in Seurat and integrated using the RPCA integration method in Seurat with nfeatures = 5,000 highly variable genes. Clustering of the fully integrated object of ATO-derived SP8 samples was performed with the IKAP package⁶², which identified the optimal principal components and clusters for UMAP dimensionality reduction of the integrated object. Dendrogram, hierarchical clustering and global gene expression analyses were performed as described above.

TCR repertoire analysis by scRNA-seq

Full, endogenous TCR V_α and V_β contigs were aligned and assembled using the Cell Ranger v.7.0.0 (10X Genomics) multi pipeline, as described above. As the exogenous TCR was expressed using a codon-optimized sequence, reads from the 5′ GEX libraries were aligned using a custom human genome reference (GRCh38), described above, which included codon-optimized sequence for the 1G4 TCR. After full reconstruction of TCRs and gene alignment, Cell Ranger output matrices were filtered using Seurat v.4.3.0 (Satija Lab), as described above. For samples including the exogenous 1G4 TCR, barcoded cells were also extracted for cells that expressed the exogenous transgene. Finally, the remaining barcoded cells were exported as a list and used to filter V(D)J sequencing outputs in R for TCR diversity calculations, using the number of barcoded cells remaining after quality control as a denominator, and calculations of percentages of cells expressing endogenous and/or exogenous TCR.

Expansion of ATO-derived T cells for functional assays

ATO-derived SP8 T cells were isolated as described above and expanded in vitro using irradiated antigen-expressing K562 aAPCs (K562 CD80-CD83-CD137L and HLA-A*02:01-B2M-NYESO_157–165 SCT) in a 1:3 aAPC:T cell ratio in AIM V (Thermo Fisher Scientific) supplemented with 5% human AB serum (Gemini Bio-Products), 20 ng ml⁻¹ rhIL-2 (Peprotech) and 5 ng ml⁻¹ rhIL-7 (R&D Systems). Fresh medium was added every 2–3 days, and cells were replated into larger wells as necessary. Restimulations for proliferation assays were performed every 5 days. Before functional and proliferation assays, expanded SP8 T cells were rested for an additional 2 days after the previous expansion cycle (7 days from aAPC stimulation) with reduced cytokines, 5 ng ml⁻¹ rhIL-2 (Peprotech) only, on the night before the assays.

CFSE proliferation assays

As described above, SP8 T cells were expanded and rested before performing proliferation assays. Briefly, 5 × 10⁵ were labelled with CFSE (BioLegend) at a final concentration of 5 µM and co-cultured with irradiated K562 aAPCs expressing cognate (NYESO, HLA-A*02:01-B2M-NYESO_157–165) or irrelevant (MART1, HLA-A*02:01-B2M-MART1_26–35) SCTs at a 1:1 T cell:aAPC ratio in a 24-well plate and 3 ml AIM V (Thermo Fisher Scientific) with 5% human AB serum (Gemini Bio-products) and 20 ng ml⁻¹ rhIL-2 (Peprotech)¹². On day 5, cells were washed and stained for CD25 and 4-1BB (BioLegend) and analysed by flow cytometry.

T cell cytokine assays

Expanded SP8 T cells from ATOs were rested as described above. A total of 2 × 10⁵ rested ATO-derived SP8 T cells were co-cultured with K562 aAPCs expressing cognate (NYESO) or irrelevant (MART1) SCTs at a 2:1 T cell:aAPC ratio in 96-well U-bottom plates and 200 µl AIM V (Thermo Fisher Scientific) with 5% human AB serum (Gemini Bio-products) and protein transport inhibitor cocktail (catalogue number 00-4980-03; eBioscience) for 6 hours. After 4 hours, CD107α-APC antibody (BioLegend) was added to wells at a 1:50 final dilution. Cells were washed and stained for CD3, CD4 and CD8α (BioLegend) and Zombie NIR Fixable Viability Dye (BioLegend) before fixation and permeabilization with an intracellular staining buffer kit (catalogue number 88-8824-00; eBioscience) and intracellular staining with antibodies against IFNγ, TNFα and IL-2 (BioLegend).

In vitro cytotoxicity assays

Expanded SP8 T cells from ATOs were rested as described above. For cytotoxicity assays, 2-fold serial dilutions of rested SP8 T cells were performed in 96-well U-bottom plates starting at 1 × 10⁵ cells in 200 µl AIM V (Thermo Fisher Scientific) with 5% human AB serum (Gemini Bio-products). K562 aAPCs expressing cognate (NYESO) or irrelevant (MART1) SCTs were plated at 1 × 10⁵ target cells per well. Apoptotic cell death of target cells was quantified by Apotracker Green (BioLegend) and DAPI staining at 6 hours. Target cell death was calculated by subtracting the percentage of Apotracker Green-positive target cells in wells receiving no T cells from wells that received T cells.

In vivo tumour assay

All animal experiments were conducted under an ethics protocol approved by the UCLA Chancellor’s Animal Research Committee (protocol number ARC-2008-175). Female 6- to 8-week-old NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice (strain 005557, RRID IMSR_JAX:005557; Jackson Laboratory) were I.V. injected (tail vein) with 5 × 10⁵ NALM6 target cells transduced with the HLA-A*02:01-B2M-NYESO_157–165 SCT and firefly luciferase. In vivo imaging was performed by intraperitoneal injection of luciferin (IVIS spectrum; Perkin Elmer) 5 days after tumour injection. Groups of n = 9 mice were randomized based on average luciferase signal activity. ATO-derived SP8 T cells expressing NYESO TCR (1 × 10⁷ cells per mouse) were I.V. injected (retro-orbitally) after mice were grouped on day 5; control mice received PBS injections. Mice were dosed intraperitoneally with 10,000 IU rhIL-2 (catalogue number 202-IL-500; R&D Systems) on days 5–7 post-tumour injection, and then every 3 days until euthanasia was humane and necessary, as determined by our ethics committee. Tumour bioluminescence was repeated twice a week (every 3–4 days) for at least 26 days, and mice were euthanized based on disease burden criteria (Fig. 7a). Luminescence images were analysed using Living Image software v.4.7.4 (Perkin Elmer).

Flow cytometry and antibodies

Staining for flow cytometry was performed in PBS with 0.5% bovine serum albumin and 2 mM EDTA for 15 min at 4 °C in the dark. TruStain FcX (catalogue number 422302; BioLegend) was added to all samples for 5 min before antibody staining. Tetramer staining was performed with the PE-conjugated HLA-A*02:01/NYESO_157–165 tetramer (catalogue number TB-M011-1; MBL International) or PE-conjugated HLA-A*02:01/MART1_26–35 tetramer (catalogue number TB-0009-1; MBL International) at a 1:50 final dilution at room temperature for 20 min before additional antibody staining for 15 min at 4 °C. DAPI was added to all samples before analysis.

Analysis was performed on a BD LSRII Fortessa, and FACS sorting was performed on BD FACSAria or BD FACSAria-H instruments (BD Biosciences) at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD instruments used BDFACSDiva software v.8.0.2 (BD Biosciences). For all analyses (except intracellular staining), DAPI-positive cells were gated out, and doublets were removed through forward scatter height versus forward scatter width and side scatter height versus side scatter width gating. The following anti-human antibody clones for surface and intracellular staining were obtained from BioLegend: CD3 (UCHT1), CD4 (RPA-T4), CD5 (UCHT2), CD7 (CD7-6B7), CD8α (SK1), CD25 (BC96), CD27 (O323), CD28 (CD28.2), CD326 (EpCAM; clone 9C4), CD34 (581), CD45 (HI30), CD45RA (HI100), CD45RO (UCHL1), CD56 (HCD56), CD62L (DREG-56), CD107α (H4A3), B2M (2M2), CCR7 (G043H7), HLA-ABC (W6/32), IFNγ (4S.B3), IL-2 (MQ1-17H12), TCRαβ (IP26), TNFα (MAb11), V_β13.1 (H131) and 4-1BB (clone 4B4-1). The anti-human antibody clone CD8β (clone REA715) was obtained from Miltenyi. Anti-mouse CD29 (clone HMb1-1) was obtained from BioLegend. Flow cytometry data were analysed with FlowJo software (Tree Star).

Statistics

In all figures, exact n values represent independent experiments and are specified in the figure legends, and mean ± s.e.m. values are shown. Statistics were analysed using GraphPad Prism software and P values were calculated using the two-tailed unpaired t-test, two-tailed Mann–Whitney U-test and the log-rank test. The P values are indicated directly on the figure within the corresponding graphs; *P < 0.05, **P < 0.01 and ***P < 0.001 were considered statistically significant.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The main data supporting the results in this study are available within the paper and its Supplementary Information. The raw and analysed datasets generated during this study for gene expression and TCR-encoding genes are available from the NCBI Gene Expression Omnibus (GSE237780). The public datasets used for this study can be found at the NCBI Gene Expression Omnibus for the human thymic SP8, GSE148981 (ref. ²⁷), and at 10X Genomics^28,29 (https://www.10xgenomics.com/resources/datasets/8-k-pbm-cs-from-a-healthy-donor-2-standard-2-1-0 and https://www.10xgenomics.com/resources/datasets/human-pbmc-from-a-healthy-donor-10-k-cells-v-2-2-standard-5-0-0) for PB NK cells and CD14⁺ monocytes. The raw and analysed datasets generated during the study are available for research purposes from the corresponding author on reasonable request. Source data are provided with this paper.

References

Hinrichs, C. S. & Rosenberg, S. A. Exploiting the curative potential of adoptive T‐cell therapy for cancer. Immunol. Rev. 257, 56–71 (2014).
Article CAS PubMed PubMed Central Google Scholar
June, C. H., Riddell, S. R. & Schumacher, T. N. Adoptive cellular therapy: a race to the finish line. Sci. Transl. Med. 7, 280ps7 (2015).
Article PubMed Google Scholar
Restifo, N. P., Dudley, M. E. & Rosenberg, S. A. Adoptive immunotherapy for cancer: harnessing the T cell response. Nat. Rev. Immunol. 12, 269–281 (2012).
Article CAS PubMed PubMed Central Google Scholar
Kalos, M. & June, C. H. Adoptive T cell transfer for cancer immunotherapy in the era of synthetic biology. Immunity 39, 49–60 (2013).
Article CAS PubMed Google Scholar
Eyquem, J. et al. Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection. Nature 543, 113–117 (2017).
Article CAS PubMed PubMed Central Google Scholar
MacLeod, D. T. et al. Integration of a CD19 CAR into the TCR alpha chain locus streamlines production of allogeneic gene-edited CAR T cells. Mol. Ther. 25, 949–961 (2017).
Article CAS PubMed PubMed Central Google Scholar
Poirot, L. et al. Multiplex genome-edited T-cell manufacturing platform for ‘off-the-shelf’ adoptive T-cell immunotherapies. Cancer Res. 75, 3853–3864 (2015).
Article CAS PubMed Google Scholar
Fraietta, J. A. et al. Determinants of response and resistance to CD19 chimaeric antigen receptor (CAR) T cell therapy of chronic lymphocytic leukemia. Nat. Med. 24, 563–571 (2018).
Article CAS PubMed PubMed Central Google Scholar
Qasim, W. et al. Molecular remission of infant B-ALL after infusion of universal TALEN gene-edited CAR T cells. Sci. Transl. Med. 9, eaaj2013 (2017).
Article PubMed Google Scholar
Torikai, H. et al. Toward eliminating HLA class I expression to generate universal cells from allogeneic donors. Blood 122, 1341–1349 (2013).
Article CAS PubMed PubMed Central Google Scholar
Seet, C. S. et al. Generation of mature T cells from human hematopoietic stem and progenitor cells in artificial thymic organoids. Nat. Methods 14, 521–530 (2017).
Article CAS PubMed PubMed Central Google Scholar
Montel-Hagen, A. et al. Organoid-induced differentiation of conventional T cells from human pluripotent stem cells. Cell Stem Cell 24, 376–389.e8 (2019).
Article CAS PubMed PubMed Central Google Scholar
Wang, Z. et al. 3D-organoid culture supports differentiation of human CAR⁺ iPSCs into highly functional CAR T cells. Cell Stem Cell 29, 515–527.e8 (2022).
Article PubMed PubMed Central Google Scholar
Klein, L., Kyewski, B., Allen, P. M. & Hogquist, K. A. Positive and negative selection of the T cell repertoire: what thymocytes see (and don’t see). Nat. Rev. Immunol. 14, 377–391 (2014).
Article CAS PubMed PubMed Central Google Scholar
Liu, X. et al. CRISPR-Cas9-mediated multiplex gene editing in CAR-T cells. Cell Res. 27, 154–157 (2017).
Article PubMed Google Scholar
Mandal, P. K. et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell Stem Cell 15, 643–652 (2014).
Article CAS PubMed PubMed Central Google Scholar
Bosticardo, M. et al. Artificial thymic organoids represent a reliable tool to study T-cell differentiation in patients with severe T-cell lymphopenia. Blood Adv. 4, 2611–2616 (2020).
Article CAS PubMed PubMed Central Google Scholar
Gardner, C. L. et al. Gene editing rescues in vitro T cell development of RAG2-deficient induced pluripotent stem cells in an artificial thymic organoid system. J. Clin. Immunol. 41, 852–862 (2021).
Article CAS PubMed PubMed Central Google Scholar
Gschweng, E. H. et al. HSV-sr39TK positron emission tomography and suicide gene elimination of human hematopoietic stem cells and their progeny in humanized mice. Cancer Res. 74, 5173–5183 (2014).
Article CAS PubMed PubMed Central Google Scholar
Robbins, P. F. et al. Single and dual amino acid substitutions in TCR CDRs can enhance antigen-specific T cell functions. J. Immunol. 180, 6116–6131 (2008).
Article CAS PubMed Google Scholar
O’Rourke, A. M., Shao, H. & Kaye, J. A role for p21ras/MAP kinase in TCR-mediated activation of LFA-1. J. Immunol. 161, 5800–5803 (1998).
Article PubMed Google Scholar
Ma, V. P.-Y. et al. The magnitude of LFA-1/ICAM-1 forces fine-tune TCR-triggered T cell activation. Sci. Adv. 8, eabg4485 (2022).
Article CAS PubMed PubMed Central Google Scholar
Evans, R., Lellouch, A. C., Svensson, L., McDowall, A. & Hogg, N. The integrin LFA-1 signals through ZAP-70 to regulate expression of high-affinity LFA-1 on T lymphocytes. Blood 117, 3331–3342 (2011).
Article CAS PubMed Google Scholar
van der Stegen, S. J. C. et al. Generation of T-cell-receptor-negative CD8αβ-positive CAR T cells from T cell-derived induced pluripotent stem cells. Nat. Biomed. Eng. 6, 1284–1297 (2022).
Minagawa, A. et al. Enhancing T cell receptor stability in rejuvenated iPSC-derived T cells improves their use in cancer immunotherapy. Cell Stem Cell 23, 850–858.e4 (2018).
Article CAS PubMed Google Scholar
Wang, B. et al. Generation of hypoimmunogenic T cells from genetically engineered allogeneic human induced pluripotent stem cells. Nat. Biomed. Eng. 5, 429–440 (2021).
Article CAS PubMed Google Scholar
Chopp, L. B. et al. An integrated epigenomic and transcriptomic map of mouse and human αβ T cell development. Immunity 53, 1182–1201.e8 (2020).
Article CAS PubMed PubMed Central Google Scholar
8k PBMCs from a healthy donor, single cell gene expression dataset by Cell Ranger 2.1.0. 10X Genomics https://www.10xgenomics.com/resources/datasets/8-k-pbm-cs-from-a-healthy-donor-2-standard-2-1-0 (2017).
Human PBMC from a healthy donor, 10k cells (v2), single cell immune profiling dataset by Cell Ranger 5.0.0. 10X Genomics https://www.10xgenomics.com/resources/datasets/human-pbmc-from-a-healthy-donor-10-k-cells-v-2-2-standard-5-0-0 (2020).
Gschweng, E., Oliveira, S. D. & Kohn, D. B. Hematopoietic stem cells for cancer immunotherapy. Immunol. Rev. 257, 237–249 (2014).
Article CAS PubMed PubMed Central Google Scholar
Giannoni, F. et al. Allelic exclusion and peripheral reconstitution by TCR transgenic T cells arising from transduced human hematopoietic stem/progenitor cells. Mol. Ther. 21, 1044–1054 (2013).
Article CAS PubMed PubMed Central Google Scholar
Santagata, S. et al. N-terminal RAG1 frameshift mutations in Omenn’s syndrome: internal methionine usage leads to partial V(D)J recombination activity and reveals a fundamental role in vivo for the N-terminal domains. Proc. Natl Acad. Sci. USA 97, 14572–14577 (2000).
Article CAS PubMed PubMed Central Google Scholar
Maitra, R. & Sadofsky, M. J. A WW-like module in the RAG1 N-terminal domain contributes to previously unidentified protein–protein interactions. Nucleic Acids Res. 37, 3301–3309 (2009).
Article CAS PubMed PubMed Central Google Scholar
Ijspeert, H. et al. Similar recombination-activating gene (RAG) mutations result in similar immunobiological effects but in different clinical phenotypes. J. Allergy Clin. Immunol. 133, 1124–1133.e1 (2014).
Article CAS PubMed PubMed Central Google Scholar
Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A. & Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, 8878–8886 (2006).
Article CAS PubMed PubMed Central Google Scholar
Bethune, M. T. et al. Domain-swapped T cell receptors improve the safety of TCR gene therapy. eLife 5, e19095 (2016).
Article PubMed PubMed Central Google Scholar
Cohen, C. J. et al. Enhanced antitumor activity of T cells engineered to express T-cell receptors with a second disulfide bond. Cancer Res. 67, 3898–3903 (2007).
Article CAS PubMed PubMed Central Google Scholar
Legut, M., Dolton, G., Mian, A. A., Ottmann, O. G. & Sewell, A. K. CRISPR-mediated TCR replacement generates superior anticancer transgenic T cells. Blood 131, 311–322 (2018).
Article CAS PubMed PubMed Central Google Scholar
Wang, J. T cell receptors, mechanosensors, catch bonds and immunotherapy. Prog. Biophys. Mol. Biol. 153, 23–27 (2020).
Article CAS PubMed Google Scholar
Kim, S. T. et al. The αβ T cell receptor is an anisotropic mechanosensor. J. Biol. Chem. 284, 31028–31037 (2009).
Article CAS PubMed PubMed Central Google Scholar
Verma, N. K. & Kelleher, D. Not just an adhesion molecule: LFA-1 contact tunes the T lymphocyte program. J. Immunol. 199, 1213–1221 (2017).
Article CAS PubMed Google Scholar
Gornalusse, G. G. et al. HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells. Nat. Biotechnol. 35, 765–772 (2017).
Article CAS PubMed PubMed Central Google Scholar
Deuse, T. et al. Hypoimmunogenic derivatives of induced pluripotent stem cells evade immune rejection in fully immunocompetent allogeneic recipients. Nat. Biotechnol. 37, 252–258 (2019).
Article CAS PubMed PubMed Central Google Scholar
Xu, H. et al. Targeted disruption of HLA genes via CRISPR-Cas9 generates iPSCs with enhanced immune compatibility. Cell Stem Cell 24, 566–578.e7 (2019).
Article CAS PubMed Google Scholar
Itoh, K. et al. Reproducible establishment of hemopoietic supportive stromal cell lines from murine bone marrow. Exp. Hematol. 17, 145–153 (1989).
CAS PubMed Google Scholar
Subach, O. M., Cranfill, P. J., Davidson, M. W. & Verkhusha, V. V. An enhanced monomeric blue fluorescent protein with the high chemical stability of the chromophore. PLoS ONE 6, e28674 (2011).
Article CAS PubMed PubMed Central Google Scholar
Thomson, J. A. et al. Embryonic stem cell lines derived from human blastocysts. Science 282, 1145–1147 (1998).
Article CAS PubMed Google Scholar
Crook, J. M. et al. The generation of six clinical-grade human embryonic stem cell lines. Cell Stem Cell 1, 490–494 (2007).
Article CAS PubMed Google Scholar
Doench, J. G. et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol. 34, 184–191 (2016).
Article CAS PubMed PubMed Central Google Scholar
Doench, J. G. et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat. Biotechnol. 32, 1262–1267 (2014).
Article CAS PubMed PubMed Central Google Scholar
Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281–2308 (2013).
Article CAS PubMed PubMed Central Google Scholar
Shalem, O. et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84–87 (2014).
Article CAS PubMed Google Scholar
Hsu, P. D. et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827–832 (2013).
Article CAS PubMed PubMed Central Google Scholar
Young, C. S. et al. A single CRISPR-Cas9 deletion strategy that targets the majority of DMD patients restores dystrophin function in hiPSC-derived muscle cells. Cell Stem Cell 18, 533–540 (2016).
Article CAS PubMed PubMed Central Google Scholar
Brinkman, E. K., Chen, T., Amendola, M. & van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
Article PubMed PubMed Central Google Scholar
Tsai, S. Q. et al. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat. Biotechnol. 33, 187–197 (2015).
Article CAS PubMed Google Scholar
Liang, X. et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. J. Biotechnol. 208, 44–53 (2015).
Article CAS PubMed Google Scholar
Chin, C. J. et al. Genetic tagging during human mesoderm differentiation reveals tripotent lateral plate mesodermal progenitors. Stem Cells 34, 1239–1250 (2016).
Article CAS PubMed Google Scholar
Evseenko, D. et al. Mapping the first stages of mesoderm commitment during differentiation of human embryonic stem cells. Proc. Natl Acad. Sci. USA 107, 13742–13747 (2010).
Article CAS PubMed PubMed Central Google Scholar
Hao, Y. et al. Integrated analysis of multimodal single-cell data. Cell 184, 3573–3587.e29 (2021).
Article CAS PubMed PubMed Central Google Scholar
McGinnis, C. S., Murrow, L. M. & Gartner, Z. J. DoubletFinder: doublet detection in single-cell RNA sequencing data using artificial nearest neighbors. Cell Syst. 8, 329–337.e4 (2019).
Article CAS PubMed PubMed Central Google Scholar
Chen, Y.-C. et al. IKAP—Identifying K mAjor cell Population groups in single-cell RNA-sequencing analysis. Gigascience 8, giz121 (2019).
Article PubMed PubMed Central Google Scholar
Amezquita, R. A. et al. Orchestrating single-cell analysis with Bioconductor. Nat. Methods 17, 137–145 (2020).
Article CAS PubMed Google Scholar
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Article PubMed PubMed Central Google Scholar
R Core Team. R: a language and environment for statistical computing. R Foundation for Statistical Computing https://www.r-project.org/ (2022).
Kolde, R. pheatmap: pretty heatmaps. R package version 1.0.12. R Foundation for Statistical Computing https://CRAN.R-project.org/package=pheatmap (2019).

Download references

Acknowledgements

We thank J. Scholes, F. Codrea and J. Calimlim from the UCLA Broad Stem Cell Research Center (BSCRC) Flow Cytometry core for their assistance with FACS sorting, the UCLA TCGB core for high-throughput sequencing; D. B. Kohn and C. Kuo for their advice regarding gene-editing techniques; L. Yang and Y. Chen for their advice on T cell biology and immunotherapy; A. Pyle, H. Xi and C. Young for their collective experience with generating clonal PSC KO lines; and S. C. de Barros for assisting with illustrations. This research was made possible with support from NIH/NCI F31CA239555 (P.C.C.), NIH/NHLBI T32HL086345 (P.C.C), UCLA BSCRC fellowships (X.Y., S.P.Y. and C.S.S.), NIH K08CA235525 (C.S.S.), the V Foundation Scholar Award (C.S.S.) and the California Institute of Regenerative Medicine (CIRM) DISC2-10134 (G.M.C.). The contents of this publication are solely the responsibility of the authors and do not represent the official views of CIRM or any other agency of the state of California. The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.

Author information

These authors contributed equally: Xuegang Yuan, Alexandre Zampieri.

Authors and Affiliations

Molecular Biology Interdepartmental Program, University of California, Los Angeles (UCLA), Los Angeles, CA, USA
Patrick C Chang & Sang Pil Yoo
Department of Pathology and Laboratory Medicine, David Geffen School of Medicine, UCLA, Los Angeles, CA, USA
Patrick C Chang, Xuegang Yuan, Alexandre Zampieri, Chloe Towns, Sang Pil Yoo, Claire Engstrom, Yuhua Zhu, Shawn Lopez, Amelie Montel-Hagen & Gay M. Crooks
Division of Hematology-Oncology, Department of Medicine, David Geffen School of Medicine, UCLA, Los Angeles, CA, USA
Steven Tsai & Christopher S. Seet
Department of Computational Medicine, UCLA, Los Angeles, CA, USA
Christopher R. Robles
Molecular Biology Institute, UCLA, Los Angeles, CA, USA
Christopher S. Seet & Gay M. Crooks
Broad Stem Cell Research Center, UCLA, Los Angeles, CA, USA
Christopher S. Seet & Gay M. Crooks
Jonsson Comprehensive Cancer Center, UCLA, Los Angeles, CA, USA
Christopher S. Seet & Gay M. Crooks
Department of Pediatrics, David Geffen School of Medicine, UCLA, Los Angeles, CA, USA
Gay M. Crooks

Authors

Patrick C Chang
View author publications
You can also search for this author in PubMed Google Scholar
Xuegang Yuan
View author publications
You can also search for this author in PubMed Google Scholar
Alexandre Zampieri
View author publications
You can also search for this author in PubMed Google Scholar
Chloe Towns
View author publications
You can also search for this author in PubMed Google Scholar
Sang Pil Yoo
View author publications
You can also search for this author in PubMed Google Scholar
Claire Engstrom
View author publications
You can also search for this author in PubMed Google Scholar
Steven Tsai
View author publications
You can also search for this author in PubMed Google Scholar
Christopher R. Robles
View author publications
You can also search for this author in PubMed Google Scholar
Yuhua Zhu
View author publications
You can also search for this author in PubMed Google Scholar
Shawn Lopez
View author publications
You can also search for this author in PubMed Google Scholar
Amelie Montel-Hagen
View author publications
You can also search for this author in PubMed Google Scholar
Christopher S. Seet
View author publications
You can also search for this author in PubMed Google Scholar
Gay M. Crooks
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

P.C.C. conceptualized and performed experiments, curated and analysed data, prepared figures, and wrote and edited the article. X.Y. assisted with the in vivo experiments and edited the article. A.Z. assisted with the in vivo experiments. C.T. assisted with gene editing, with the cloning of stem cell lines and with the stem cell and ATO cultures. C.R.R. assisted with data processing and analysis. S.P.Y., C.E., S.T. and Y.Z. assisted with stem cell and ATO cultures. S.L. maintained the cell line cultures. A.M.-H. provided conceptual advice and guidance. C.S.S. provided critical materials, conceptual advice and guidance. G.M.C. directed the project and co-wrote and edited the article.

Corresponding author

Correspondence to Gay M. Crooks.

Ethics declarations

Competing interests

Pluto Immunotherapeutics is supporting further preclinical research on the ATO system at UCLA through a sponsored research agreement with G.M.C. as principal investigator. A.M.-H., G.M.C. and C.S.S. are co-founders of Pluto Immunotherapeutics, which holds certain rights relating to the ATO system. G.M.C. and C.S.S. are consultants to, and A.M.-H. is a current employee of, Pluto Immunotherapeutics. The other authors declare no competing interests.

Peer review

Peer review information

Nature Biomedical Engineering thanks George Daley, Ludger Klein, Nico Lachmann and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Supplementary figures.

Reporting Summary

Peer Review File

Supplementary Data

Source data for Supplementary Figs. 7, 9 and 10.

Source data

Source Data Figs. 1–8

Source data and statistics.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Chang, P.C., Yuan, X., Zampieri, A. et al. Generation of antigen-specific mature T cells from RAG1^−/−RAG2^−/−B2M^−/− stem cells by engineering their microenvironment. Nat. Biomed. Eng (2023). https://doi.org/10.1038/s41551-023-01146-7

Download citation

Received: 08 September 2022
Accepted: 25 October 2023
Published: 07 December 2023
DOI: https://doi.org/10.1038/s41551-023-01146-7