Targeting bacterial nickel transport with aspergillomarasmine A suppresses virulence-associated Ni-dependent enzymes

Sychantha, David; Chen, Xuefei; Koteva, Kalinka; Prehna, Gerd; Wright, Gerard D.

doi:10.1038/s41467-024-48232-1

Download PDF

Article
Open access
Published: 13 May 2024

Targeting bacterial nickel transport with aspergillomarasmine A suppresses virulence-associated Ni-dependent enzymes

Nature Communications volume 15, Article number: 4036 (2024) Cite this article

824 Accesses
10 Altmetric
Metrics details

Subjects

Abstract

Microbial Ni²⁺ homeostasis underpins the virulence of several clinical pathogens. Ni²⁺ is an essential cofactor in urease and [NiFe]-hydrogenases involved in colonization and persistence. Many microbes produce metallophores to sequester metals necessary for their metabolism and starve competing neighboring organisms. The fungal metallophore aspergillomarasmine A (AMA) shows narrow specificity for Zn²⁺, Ni²⁺, and Co²⁺. Here, we show that this specificity allows AMA to block the uptake of Ni²⁺ and attenuate bacterial Ni-dependent enzymes, offering a potential strategy for reducing virulence. Bacterial exposure to AMA perturbs H₂ metabolism, ureolysis, struvite crystallization, and biofilm formation and shows efficacy in a Galleria mellonella animal infection model. The inhibition of Ni-dependent enzymes was aided by Zn^2+, which complexes with AMA and competes with the native nickelophore for the uptake of Ni²⁺. Biochemical analyses demonstrated high-affinity binding of AMA-metal complexes to NikA, the periplasmic substrate-binding protein of the Ni²⁺ uptake system. Structural examination of NikA in complex with Ni-AMA revealed that the coordination geometry of Ni-AMA mimics the native ligand, Ni-(l-His)₂, providing a structural basis for binding AMA-metal complexes. Structure-activity relationship studies of AMA identified regions of the molecule that improve NikA affinity and offer potential routes for further developing this compound as an anti-virulence agent.

Frameworks for transformational breakthroughs in RNA-based medicines

Article 13 May 2024

A novel antibiotic class targeting the lipopolysaccharide transporter

Article Open access 03 January 2024

Legionella effector LnaB is a phosphoryl-AMPylase that impairs phosphosignalling

Article 22 May 2024

Introduction

Ni²⁺ is a trace metal ion cofactor essential in the physiology of several microorganisms¹. Only ten Ni-dependent enzymes are currently known in nature, of which urease and [NiFe] hydrogenase are the best studied because of their established correlation with microbial virulence^2,3,4,5. The significance of these Ni-dependent enzymes is underscored by animal infection models linking the role of Ni-dependent enzymes to the colonization and survival of the bacteria Staphylococcus aureus^6,7, Helicobacter pylori^8,9, Klebsiella pneumoniae¹⁰, Proteus mirabilis¹¹, and Salmonella enterica serovar Typhimurium^12,13, and the fungi Cryptococcus neoformans^14,15 and Aspergillus fumigatus¹⁶. In contrast, no Ni-dependent enzymes have been identified in mammals. However, human calprotectin chelates Ni²⁺ with high affinity as part of the innate immune response¹⁷. As a result, calprotectin prevents the uptake of Ni²⁺ into bacteria, thereby attenuating urease¹⁷. This intrinsic mechanism of Ni²⁺ limitation at the host-pathogen interface highlights the biological importance of this metal as an accessory to the pathophysiology of many microorganisms.

Among urease-producing bacteria, Klebsiella spp., Proteus spp., Staphylococcus spp., Pseudomonas spp., and Providencia spp. are frequently associated with hospital-acquired urinary tract infections (UTIs)¹⁸. These pathogens are the etiological agents of struvite stones (magnesium ammonium phosphate; NH₄MgPO₄•6H₂O), which account for ~15% of all urinary stones. Struvite accumulates on urinary catheters and the urothelial surface in the early stages of colonization, facilitating biofilm formation and persistence¹⁹. The mechanism by which these stones form involves urea hydrolysis to ammonia (NH₃) and carbon dioxide (CO₂) catalyzed by the enzyme urease. These hydrolysis products raise the pH of urine (pH >7.5), promoting the crystallization of struvite from naturally present magnesium and phosphate ions. Such alkalinization of biological fluids may also cause tissue damage and enable bacterial survival at low pH, exacerbating UTI symptoms and bacterial burden¹⁸. Furthermore, NH₃ liberated by urease has been shown to serve as a nitrogen source for Klebsiella aerogenes²⁰, implicating urease in host nutritional adaptation. Similarly, four distinct classes of [NiFe]-hydrogenases either oxidize hydrogen (H₂) for proton uptake or reduce protons to oxidize formate and evolve H₂, playing multifaceted roles in virulence and physiology²¹. More specifically, H. pylori and S. Typhimurium utilize H₂ for energy, promoting virulence, whereas K. pneumoniae evolves H_2, which can protect it from oxidative stress^12,22,23. Given these examples, the enzymatic function of Ni-dependent enzymes plays a significant role in UTIs and other infectious diseases and is underpinned by the acquisition of an essential Ni²⁺ cofactor.

The enzymatic activities of urease and [NiFe]-hydrogenases depend on the availability of Ni²⁺ in the cytoplasm. The ABC-type transporter (NikABCDE) imports the metal from the extracellular environment through a multi-step process in many bacteria, including Enterobacteriaceae and S. aureus^6,24,25. While a bacterial nickelophore dedicated to the NikABCDE system is currently unknown, exogenous environmental l-histidine is believed to be a widespread ligand. l-Histidine forms Ni-(l-His)₂ complexes, which exhibit a strong affinity for NikA for efficient transport into the cell through the NikBCDE ABC-type transporter (Fig. 1)^26,27.

Fig. 1: Nickel trafficking in *Klebsiella pneumoniae.*

Previously, we identified that the fungal-derived polycarboxylic acid natural product aspergillomarasmine A (AMA) is a non-antimicrobial metallophore with a preference for Zn²⁺, Co²⁺, and Ni²⁺ ions^28,29,30. AMA comprises l-Asp and two units of 2,3-diaminopropionic acid (APA) (Fig. 2A)³¹. Our previous work also showed that AMA sequesters Zn²⁺ and inhibits Zn²⁺-dependent metallo-β-lactamases (MBLs) by preventing their activation and promoting spontaneous Zn²⁺ dissociation and instability^28,32. This activity raised the possibility that AMA could similarly sequester extracellular Ni²⁺ to prevent its uptake and block the maturation of urease and [NiFe]-hydrogenases. Since antibiotic-resistant UTIs are becoming increasingly common in healthcare settings, inhibiting Ni²⁺ uptake could reduce complications and the societal burden associated with such infections³³.

**Fig. 2: Metal complexes of AMA suppress the activity of Ni-dependent enzymes.**

In this work, we explore the potential of AMA to prevent Ni²⁺ uptake and attenuate urease and hydrogenase activity in pathogenic bacteria. We show that both AMA and its metal complexes inhibited urease in S. aureus and K. pneumoniae, suppressing the crystallization of struvite in urine cultures. In addition, Zn-AMA is not toxic to mammalian cells and has in vivo efficacy in Galleria mellonella larvae. AMA-metal complexes target the periplasmic Ni²⁺ uptake protein NikA through high-affinity interactions and compete with Ni-(l-His)₂ for uptake. Co-crystallographic analysis of NikA and Ni-AMA revealed that Ni-AMA resembles Ni-(l-His)₂, providing a structural basis for uptake. Finally, we explored the structure-activity relationships of Zn-AMA, which validated components of the molecule that are important for NikA interactions.

Results

AMA binds Ni²⁺ with picomolar affinity

Our previous structural analysis of AMA determined that it binds to Ni²⁺ as a pentadentate complex with distorted octahedral geometry^28,31 (Fig. 2A). Based on this observation, we hypothesized that AMA might sequester Ni²⁺ outside bacteria and compete with its uptake. To further explore this possibility, we estimated AMA’s K_D for Ni²⁺ by competition binding between AMA, Zn²⁺, and Ni²⁺ using isothermal titration calorimetry (ITC). This approach was used because the K_D for Ni²⁺ is outside the detection limit of direct titrations using ITC. The K_D value for Ni²⁺ was estimated to be 80 pM, twofold lower than AMA’s K_D for Zn²⁺, and is consistent with the Irving-Williams order of ligand strength for these metals (Fig. 2A and Fig. S1). Compared to l-His, which forms a 2:1 complex with Ni²⁺ with K_D1 and K_D2 values of 0.64 μM and 8.8 μM at pH 7.5³⁴, AMA is a better nickelophore. Thus, it was anticipated that AMA would outcompete l-His for this metal in bacterial cultures, where the concentration of Ni²⁺ is typically sub-micromolar³⁵.

AMA in complex with Zn²⁺ or Co²⁺ suppresses the activity of Ni-dependent enzymes by targeting Ni²⁺ uptake

Biological dose-response assays were performed to examine the effect of AMA on Ni²⁺ uptake. We used whole-cell urease-dependent pH changes as a readout to estimate cytoplasmic Ni²⁺ accumulation. Experiments were conducted using urease-producing K. pneumoniae and S. aureus grown in artificial urine³⁶, each supplemented with varying concentrations of AMA or the clinically approved urease inhibitor acetohydroxamic acid (AHA)^37,38. Varying concentrations of complexes of AMA with Zn²⁺, Co²⁺, or Ni²⁺ were also included as negative controls.

Contrary to our initial hypothesis, the data revealed that AMA did not significantly affect urease activity in K. pneumoniae (Fig. 2B and Fig. S2). However, its complexes with Zn²⁺ (Zn-AMA) and Co²⁺ (Co-AMA) significantly suppressed urease activity at a concentration of 50 μM. This suppression was notably more effective than AHA, which required a concentration of 12.8 mM to achieve similar results (Fig. 2B and Fig. S2). A contrasting effect was observed in S. aureus, where AMA, Zn-AMA, and Co-AMA inhibited urease activity similarly (Fig S2). This suggests that the AMA and its metal complexes inhibit urease activity through multiple mechanisms in S. aureus. Nevertheless, AMA in complex with Ni²⁺ (Ni-AMA) or ZnCl₂ did not affect urease activity in either organism (Fig. 2B, S2 and S3). Given these observations, spot dilutions were performed on cells treated with 200 μM of AMA, Zn-AMA, Co-AMA, and Ni-AMA to exclude the possibility of urease attenuation being due to lethal effects on the bacteria. The results showed that these compounds do not affect bacterial viability after 24 h of exposure (Fig S4).

We next examined artificial urine cultures of K. pneumoniae microscopically to determine if urease-dependent struvite crystallization had been affected. While Zn-AMA robustly prevented the appearance of struvite crystals, AMA did not, which was consistent with our observations in whole-cell urease assays (Fig. 2C and Fig. S5). However, at low compound concentrations, both resulted in a marginal pH-independent increase in crystal nucleation, which could not be accounted for in our experimental conditions.

Given that struvite crystallization could be inhibited, we evaluated whether Zn-AMA could suppress the formation of biofilms, as bacteria can attach to struvite crystals and embed them in extracellular polysaccharides³⁹. In a microtiter plate biofilm assay, Zn-AMA could completely suppress biofilm production in K. pneumoniae culture grown in artificial urine, tracking with the anti-urease/struvite activity of the compound (Fig. 2D and Fig. S6). This effect was specific to urine-like conditions, as biofilms were unperturbed by the compound when bacteria were grown in M9 minimal medium. Such anti-biofilm activity was not observed in S. aureus cultures grown in either condition, highlighting differences in the biology of its biofilms compared to K. pneumoniae (Fig S6).

To guide our exploration of the mode of action of Zn-AMA, we investigated whether a chemical-chemical interaction occurs with the urease inhibitor AHA. We hypothesized that a synergistic effect could be observed with AHA if Zn-AMA inhibited urease activity indirectly. This could occur through disruption of urease maturation in K. pneumoniae, specifically by interfering with the uptake of Ni²⁺. Conversely, an additive effect was anticipated if these compounds had equivalent or overlapping mechanisms. We focused on the Zn²⁺ complex because of the potentially toxic effects of Co²⁺. Using a checkerboard assay, we found the combination of Zn-AMA and AHA was synergistic, indicating that Zn-AMA affects urease indirectly (Fig. S7). This was further verified with a cell-free urease assay, which excluded the direct inhibition of urease by AMA and Zn-AMA (Fig. S7). We subsequently performed inductively coupled plasma mass spectrometry (ICP-MS) analyses to evaluate the intracellular Ni²⁺ and Zn²⁺ content of K. pneumoniae. The data showed that AMA and Zn-AMA similarly reduced intracellular Ni²⁺ levels without affecting Zn²⁺ levels, indicating that Zn-AMA has pleiotropic effects on Ni²⁺ homeostasis. (Fig. 2E).

We reasoned that disruption of Ni²⁺ uptake and homeostasis should also perturb the activity of other Ni-dependent enzymes. To examine this possibility, we tested the effects of free AMA and Zn-AMA on Ni-dependent hydrogen metabolism in bacteria. We focused on K. pneumoniae because S. aureus does not possess [NiFe] hydrogenases based on a search in HydDB²¹. K. pneumoniae produces a single [NiFe]-hydrogenase (Hyd-3) as part of the H₂-evolving formate hydrogenlyase (FHL) complex and is encoded by the hyc operon (Fig S8)²¹. Dose-response assays for [NiFe]-hydrogenase inhibition were performed on K. pneumoniae grown in LB-glucose under anaerobic conditions (10% CO₂, 5% H₂, 85% N₂). To measure [NiFe]-hydrogenase-catalyzed H₂ reduction, benzyl viologen was used as an artificial electron acceptor, as previously described⁴⁰. Although Hyd-3 is involved in the evolution of H₂, previous work in E. coli has shown that it is responsible for 90% of the hydrogen-dependent benzyl viologen reduction in crude extracts and whole-cell assays^41,42,43,44. Our results revealed that Zn-AMA inhibited K. pneumoniae Hyd-3 activity in a dose-dependent manner with an EC₅₀ value of 50.8 ± 4.4 μM (Fig. 2F). Notably, free AMA had no impact on [NiFe]-hydrogenase activity, further highlighting the unique qualities of Zn-AMA. The distinct effects of these compounds on [NiFe]-hydrogenase activity were verified with zymographic analysis of Hyd-3 in E. coli cell lysates, which can be differentiated by exposure to 100% H₂ (Fig S9)⁴².

Metal complexes of AMA target NikA of the Nickel uptake system

Our observation that Zn-AMA reduces total cellular Ni²⁺ content led us to hypothesize that AMA competes with Ni²⁺ uptake through the NikABCDE ABC transporter. Previous work has shown that the periplasmic solute binding protein NikA binds to non-native metal complexes and that ∆nikA strains lack Ni-dependent enzyme activity^26,45. We tested this hypothesis by titrating Ni-(l-His)₂ into cells containing varying amounts of Zn-AMA and observed that Ni-(l-His)₂ rescued urease activity in a dose-dependent manner, consistent with the idea that both complexes bind to the same receptor (Fig. 3A).

Fig. 3: Bacterial nickel uptake is inhibited by competitive binding to the periplasmic Ni-binding protein NikA from *K. pneumoinae.*

To further examine this common connection through NikA, K. pneumoniae was grown in a minimal medium containing urea as the sole nitrogen source. Under this condition, cellular viability becomes Ni²⁺-dependent because urease activity is necessary for metabolizing urea to NH₃ for nitrogen assimilation²⁰. Therefore, we hypothesized that if metal complexes of AMA could bind to NikA, then Ni-AMA may rescue growth under these conditions. Growth curves showed that cells were not viable when supplemented with l-His or AMA alone (Fig. 3B, C). However, Ni-(l-His)₂ and Ni-AMA complexes stimulated growth (Fig. 3B, C), while Zn-AMA or nickel-selective chelator dimethylglyoxime (DMG) did not (Fig. 3C). Indeed, Zn-AMA inhibited the growth of K. pneumoniae in this medium when supplemented with 0.25 μM NiCl, which was suppressed with the addition of excess Ni-(l-His)₂ (Fig. S10). These results indicate that cells likely transport AMA complexes into the cell through the NikA pathway, while Ni-DMG sequesters Ni²⁺ and prevents its uptake and utilization.

We validated NikA as the target of AMA metal complexes with cellular thermal shift assays (CETSA)⁴⁶. NikA levels were monitored in K. pneumoniae with immunodetection of a FLAG-tagged form of the protein and OmpA as a loading control. CESTAs showed that NikA levels began to decrease at 52.8 °C and became barely detectable at 60 °C in both AMA-treated and untreated control cells (Fig. 3D and Fig. S11). Ni-AMA increased the thermal stability of NikA, which remained detectable at 60 °C (Fig. 3D and Fig. S11) and in vitro thermal shift assays using recombinant NikA confirmed that Ni-AMA, Zn-AMA, and Co-AMA increase NikA’s stability (Fig. 3E). In experiments where only the metals were added, Zn²⁺ stabilized NikA, while Ni²⁺ and Co²⁺ did not affect it (Fig. 3F). This Zn²⁺-dependent increase in thermal stability was not observed in the Ni-AMA bound form of NikA, suggesting that the binding of these reagents is mutually exclusive (Fig. S12). The biological significance of Zn²⁺ binding by NikA remains unclear; however, it is widely acknowledged in the literature that Zn²⁺ has the potential to affect the stability and folding dynamics of proteins, regardless of the biological relevance of the metal interaction^47,48,49.

NikA binds to metal complexes of AMA with high affinity

Since metal complexes of AMA bind NikA, their binding affinities and thermodynamics were determined using ITC. To set the benchmark for high-affinity ligand interactions with K. pneumoniae NikA, the known ligand Ni-(l-His)₂ was titrated into a solution of purified protein. The binding of Ni-(l-His)₂ was exothermic with a 1:1 stoichiometry, and binding/thermodynamic parameters were analogous to the NikA homolog from E. coli⁵⁰ (Fig. 4A). The titration of Ni-AMA was similarly exothermic, enthalpy-driven, and had a K_D value of 2 μM, which was 4-fold greater than Ni-(l-His)₂ (Fig. 4B). Comparable thermodynamics were obtained for Zn-AMA and Co-AMA (Fig. 4C, D). However, incrementally increasing ∆H° values were observed for Zn-AMA and Co-AMA, respectively. These ∆H° increases corresponded with increases in the K_D values for Zn-AMA and Co-AMA, which shifted 3.5 and 7-fold relative to Ni-AMA. Even though these complexes have different affinities for NikA, we predict that their structures are pentadentate with octahedral geometry, given the known structural/conformational restraints observed in the Ni-AMA structure³¹. Therefore, the affinity differences are likely caused by distinct metal-ligand distances in each complex, impacting the fit within the binding pocket of NikA. Alternatively, water could serve as a 6^th ligand and affect each complex’s affinity for NikA, but the stability of this interaction for each complex is unknown. Despite the minor differences in affinity among the various AMA metal complexes, NikA’s affinity for Zn-AMA is 14-fold weaker than Ni-(l-His)_2. Given the relatively low concentration of Ni²⁺ in the environment, it is reasonable to expect that Zn-AMA interacts with NikA strongly enough to outcompete Ni-(l -His)₂ in living bacteria.

**Fig. 4: Metal complexes of AMA bind to NikA with high affinity.**

Crystal structure of NikA in complex with Ni-AMA

E. coli NikA (22-524), which shares 75% identity and 90.5% similarity with the K. pneumoniae ortholog, was purified for crystallization studies. The structure of the NikA was determined in complex with Ni-AMA to 2.15 Å resolution by molecular replacement using the Ni-(l-His)₂ (PDB 4I8C) as a search model (Fig. 5A) (Table S1), and Ni-AMA could be confidently placed within the electron density map (Fig. 5B). Ni-AMA adopted different coordination geometry when bound to NikA compared to the stand-alone structure determined in our previous work³¹, indicating that two configurations of the Ni-AMA complex are possible. Superposition of the Ni-AMA structures showed that relative to AMA’s l-Asp unit (l-Asp^AMA), the penultimate APA2 and N-terminal APA1 are rotated by 93.3° (Fig. 5C). Consequently, the NH₂ ligand of the terminal APA1 subunit is equatorial instead of axial as seen in the stand-alone Ni-AMA structure.

**Fig. 5: Crystal structure of *E. coli* NikA in complex with Ni-AMA.**

The interaction network between NikA and Ni-AMA revealed that the conserved His416 residue occupies the axial position within the Ni-AMA complex (Fig. 5A, D). This observation suggests that NikA either conformationally selects for one form of Ni-AMA or that Ni-AMA binding to NikA induces a conformational change to accommodate the Ni²⁺ interaction with His416. The remainder of the ligand binding pocket of NikA around the Ni-AMA is composed of Tyr22, Met27, Trp100, Tyr382, Trp398, and Tyr402 (Fig. 5D). Notable CH-π stacking interactions occur between Trp100 and APA2, and APA1 and Tyr382. Extensive electrostatic interactions also occur with the carboxyl groups of Ni-AMA, including hydrogen bonds with the side chain of Arg137 to the α-carboxyl of the l-Asp^AMA residue. The terminal APA1 carboxyl makes an additional hydrogen binding to the backbone amide of Thr23. Ser415 and Arg97 form hydrogen bonds to the carboxyl group of APA2 (Fig. 5D). Several other hydrogen bond interactions occur between Ni-AMA and ordered solvent molecules within the pocket. Together, these results provide the structural basis for the high-affinity binding of Ni-AMA, serving as a proxy for the binding of complexes composed of other metal ions.

The Ni-AMA complex mimics Ni-(l-His)₂

Ni-AMA induced the closed conformation of NikA (Fig. 6A)⁵¹. Only a small opening between the two lobes remains, slightly exposing the APA1 carboxyl group. Structural comparisons of the closed form of the NikA:Ni-AMA complex to that of the NikA:Ni-(l-His)₂ complex (PDB 4I8C) revealed an overall RMSD of 1.16 Å² (over 496 residues). Superpositions of lobe-I revealed a subtle difference in the position of lobe-II, which contains His416 that interacts with Ni-AMA. Unlike the NikA:Ni-AMA structure, the binding pocket of the Ni-(l-His)₂ complex remains ajar to accommodate the large side chain of the l-His(B) residue, which sterically affects the position of the α11 helix of lobe II by occluding the side chain of Tyr382. An additional hydrogen bond to Arg386 stabilizes the position of this alpha-helix through a hydrogen bond to the carboxyl group l-His(B). (Fig. 6B, D). In contrast, Ni-AMA lacks this bulky side chain at the equivalent position, allowing for a fully closed pocket. (Fig. 6B, D). Further comparisons to other NikA structures available in the PDB identified that a NikA:Ni-butane1,2,4-tricarboxylate (BTC) complex (PDB 3DP8) and a NikA:Fe-EDTA complex (PDB 1ZLQ) have RMSD values of 0.46 Å and 1.34 Å, respectively (over 496 residues). Like Ni-AMA, Ni-BTC also lacks a bulky group that would otherwise block the complete closure of the pocket (Fig. 6C). In contrast, the NikA-Fe-EDTA structure is in a partially open state. With Fe-EDTA being a hexadentate ligand, it sterically hinders the complete closure of the ligand-binding site. Comparing all four ligands revealed that the AMA, l-His(A), BTC, and EDTA occupy a similar region within the binding pocket, overlapping with l-Asp^AMA of Ni-AMA. The structure of the NikA:Ni-AMA complex shows that AMA metal complexes are reasonable Ni-(l-His)₂ mimetics and that full NikA closure and high-affinity binding are likely facilitated by accepting His416 as the 6^th Ni²⁺ ligand (Fig. 6C). This is on contrast to Fe-EDTA, which does not contain an available coordination site, which precludes engagement with His416. (Fig. 6C). These structural insights into the plasticity of NikA’s binding pocket will inform the selection of AMA analogs for structure-activity relationship studies.

**Fig. 6: Structural comparison of NikA:Ni-AMA to known ligand-bound structures of NikA.**

Structure-activity relationship studies

To study the structure-activity relationships of AMA, we tested synthetic and natural analogs with substitutions at APA1 and l-Asp^AMA positions we prepared previously³¹. We prioritized testing Zn²⁺ complexes instead of Co²⁺ and Ni²⁺ complexes due to potential toxicity and because Ni-AMA does not reduce urease activity.

The side chain of l-Asp^AMA is adjacent to the aromatic side chain of Trp398 within the crystal structure of the NikA complex (Fig. 5D). To potentially improve this interaction, l-Asp^AMA was substituted with l-His^AMA and l-Asn^AMA, capitalizing on potential π-π and amide-π stacking interactions. ITC experiments revealed that these substitutions improved the affinity for NikA 7-fold, as the K_D values for both compounds were ~1 μM (Table 1 and Fig. S13). As anticipated, these improvements correspond to a significant decrease in the ∆H values, indicating increased electrostatic interactions. Despite the increased affinity, the minimum inhibitory concentrations for urease activity were uncorrelated as the EC₅₀ for Zn-AMA(His) and Zn-AMA(Asn) was >200 μM and 10-fold greater than Zn-AMA, respectively (Table 1 and Fig. S14).

Table 1 Structure-activity relationships of AMA analogs in complex with Zn²⁺

Full size table

On the opposite side of AMA, APA1 forms several hydrogen bonds and is braced by a CH-π interaction with the aromatic side chain of Tyr382 (Fig. 5D). To understand the importance of APA1; we tested toxin A, an AMA analog that lacks this component, and aspergillomarasmine B (AMB), which contains a glycine residue at this position instead. The K_D of Zn-toxin A was similar to AMA but exhibited different binding thermodynamics (Table 1 and Fig. S13). The thermodynamic differences suggest less conformational restriction of Zn-toxin A occurs upon binding relative to Zn-AMA. Despite having low micromolar affinity, Zn-toxin A was found to have poor biological activity (EC₅₀ > 200 μM) (Table 1 and Fig. S14). In contrast, AMB had a 4-fold weaker affinity toward NikA characterized by less favorable ∆H from a lack of hydrogen bonding potential (Table 1 and Fig. S13). In keeping with the weak affinity of AMB, we observed an EC₅₀ of >200 μM in bacterial culture (Table 1 and Fig. S14). These data indicate that while NikA-AMA interactions can be improved, other factors significantly influence biological activity. We anticipate that it may be attributable to a combination of Zn²⁺ affinity, metal selectivity, and cellular accumulation.

In vivo toxicity and efficacy studies

We next assessed the cytotoxicity of Zn-AMA and compared it to AMA, Co-AMA, and Ni-AMA toward human embryonic kidney 293 (HEK293) cells. The cells were treated with varying amounts of each compound, with the highest test concentration fixed at 512 μg/mL (~1.4 mM). Zn-AMA, AMA, and Ni-AMA showed no significant cytotoxicity over 48 h (Fig. S15). In contrast, Co-AMA resulted in a 50% reduction in HEK293 cell viability at the highest test concentration, indicating that it has some cytotoxicity (Fig. S15).

Since Zn-AMA was not toxic in vitro, we tested its efficacy in vivo using Galleria mellonella larvae, serving as a model for the innate immune response. Although Zn-AMA does not affect bacterial viability in vitro, the in vivo efficacy data showed that Zn-AMA was an effective monotherapy for both K. pneumoniae and a methicillin-resistant strain of S. aureus (USA300) at 7.5 mg/kg (Fig. 7AB). A significant proportion of the G. mellonella larvae survived following infection by both species after seven days post-infection relative to the untreated control. This was consistent with the improved survival of an S. aureus USA300 ureC::tn transposon mutant lacking urease activity (Fig. 7C). Moreover, treating the ureC::tn mutant with Zn-AMA showed no significant survival benefit, indicating that the efficacy of Zn-AMA is predominantly associated with urease attenuation in vivo (Fig. 7C). In summary, the findings suggest that using Zn-AMA to inhibit Ni²⁺ uptake is an effective strategy for reducing the virulence of K. pneumoniae and S. aureus when used as a single treatment.

**Fig. 7: Zn-AMA attenuates virulence in vivo.**

Discussion

The significance of urease in medicine and agriculture has sustained considerable scientific, economic, and environmental interest. In medicine, ureolysis by urease-producing bacteria was recognized as the cause of struvite stones in the 1940s⁵² and in the mid-1980s⁵³, it was identified as a critical virulence determinant of H. pylori. These discoveries, among many others, established that urease is an important target for non-traditional antimicrobial chemotherapy in infections caused by urease-producing organisms. In 1980, AHA (sold as Lithostat) was approved to combat struvite formation in humans³⁷ but has remained underutilized because of concerns over safety due to its acute toxicity and carcinogenicity^38,54. The search for urease inhibitors has since continued, yielding countless compounds from natural and synthetic sources, but a promising lead has yet to justify further development (~3200 molecules as of 2022)⁵⁵. As an alternative approach to direct urease inhibition, a recent investigation of the mode of action of colloidal bismuth citrate identified that it perturbs Ni²⁺ trafficking to block the assembly of the di-Ni²⁺ metallocentre in urease to indirectly inhibit ureolysis⁵⁶.

While urease inhibition has been extensively explored, emerging interest in inhibiting [NiFe]-hydrogenases presents new opportunities and challenges in developing antimicrobial therapies^33,41,57,58. Advantages to inhibiting [NiFe]-hydrogenases include being absent from humans and reducing bacterial virulence and viability. However, a potential challenge with inhibitor development is the diversity of these enzymes in pathogenic bacteria. There are four distinct classes of [NiFe]-hydrogenase²¹, each of which is not equally represented in bacteria, suggesting a single compound may not be equally effective toward all classes and pathogens. This need for a broad-spectrum inhibitor may pose significant difficulties in compound development, particularly in achieving high affinity, potency, and efficacy.

Our work on AMA has shown that blocking the uptake of environmental Ni²⁺ is a viable approach to inhibit multiple Ni-dependent enzymes, including urease and [NiFe]-hydrogenases, to block urine alkalinization, struvite, and biofilm formation, and H₂ metabolism. It was shown previously that EDTA and the Ni-specific chelator DMG could similarly prevent Ni²⁺ uptake by sequestering the metal outside the cell^59,60. In contrast, we show that complexes of AMA with Zn²⁺ or Co²⁺ specifically compete for Ni²⁺ uptake by binding to NikA. A benefit to using preformed metal complexes of AMA compared to a chelator-based approach is offsetting the potentially adverse off-target effects of metal chelation. One potential drawback, however, is the stimulatory effect of Ni-AMA on urease activity. Given its affinity for AMA, Ni²⁺ could displace Zn²⁺ and aid in microbial uptake; however, this is unexpected given the low abundance of Ni²⁺ in most biological fluids (<5 μg/mL; 90 nM)⁶¹.

Ni-(l-His)₂ has been identified as a common ligand of NikA homologs and has been co-crystallized with several Ni-binding proteins, including orthologs from Campylobacter jejuni, Yersinia pestis, H. pylori, S. aureus, and E. coli. Our observation that the three-dimensional structure of Ni-AMA closely mimics Ni-(l-His)₂ provides a structural basis for targeting Zn-AMA to diverse bacteria. The polycarboxylic acid structure of AMA enables the formation of an extensive hydrogen bond and π-interaction network within NikA’s binding site. Furthermore, the pentadentate coordination geometry of AMA offers the flexibility of both high affinity binding to Zn²⁺ while providing an unoccupied coordination site for interactions with the His416 ligand of NikA.

Structure-activity relationship studies indicate that l-His and l-Asn analogs of AMA can improve the overall interaction with the binding site and generate high-affinity values comparable to Ni-(l-His)₂. Downstream of NikA binding, the fate of AMA/analog complexes is unclear, but we envisage three possible outcomes. (i) The entire complex is imported into the cytoplasm through the NikBCDE transporter as an inert metallophore. (ii) Zn²⁺ is released from AMA by NikA at the interface of the ABC transporter, allowing only the metal to pass through, which could interfere with enzyme maturation. (iii) The conformation of NikA in complex with Zn-AMA and analogs is incompatible with the NikBCDE transporter, and the complex remains bound to the protein in the periplasm. Considering the molecular complexity of the uptake system and that little is known about how the NikABCDE transporter translocates cognate Ni²⁺ complexes, future studies will investigate the biochemical outcome of Zn-AMA on translocation to inform the development of additional analogs.

Antibiotic-resistant infections are a global health crisis, and new approaches are urgently needed to overcome them. In this work, we show that targeting NikA to block the uptake of Ni²⁺ in several human pathogens could be a feasible strategy to attenuate Ni-dependent virulence determinants of many bacteria. The versatility of metal complexes has recently gained attention as agents to confront antimicrobial resistance, underscoring the significance of our findings⁶². Specifically, Zn-AMA represents a new example of a metal-based compound with therapeutic potential, setting a precedent for identifying additional analogs with improved biological activity and broad-spectrum activity.

Methods

Bacterial strains and growth conditions

K. pneumoniae ATCC 33495 and S. aureus ATCC 23293 were used to evaluate the effects of AMA. Where indicated, bacteria were grown in artificial urine, nitrogen-limiting minimal medium (10.5 g K₂HPO4, 4.5 g KH₂PO4, 2% (w/v) urea, 0.4% (w/v) glucose, 1 mM MgSO₄, 1 μM ZnCl₂, and 1 μM, FeCl₃) Chelex-100 treated to remove trace Ni²⁺ before the addition of Mg²⁺, Zn²⁺, and Fe³⁺, M9Cas (M9 minimal medium supplemented with 0.1% (w/v) casamino acids), LB-glucose (LB supplemented with 0.8% (w/v) glucose, 10 mM MgSO₄, 10 mM potassium phosphate). Artificial urine was prepared according to ref. ³⁶ and supplemented with 0.1% casamino acids and 0.01% (w/v) phenol red. For the growth of S. aureus, artificial urine was supplemented with 10% (v/v) LB. E. coli TOP10 was used for constructing, maintaining, and propagating plasmid DNA, and E. coli BL21 (DE3) was used for protein production. Bacteria were routinely grown in liquid culture under aerobic conditions at 37 °C using either Luria-Bertani (LB; Lennox formulation) supplemented with 50 μg/mL kanamycin when appropriate. LB agar, supplemented with 50 μg/mL kanamycin when appropriate, was used for growth on a solid medium. All bacteria were grown at 37 °C.

DNA manipulation

For protein production, plasmids containing truncated nikA homologs from K. pneumoniae and E. coli were generated using standard methods in molecular biology. Both genes were amplified using PCR from the respective genomic DNA. Forward and reverse primers used in amplification of E.coli nikA (5’-GCGGCCATGGCTGCACCAGATGAAATC-3’ and 5’-GCGCCTCGAGTTAAGGTTTCACCGGTT-3’) contained NcoI and XhoI restriction sites for ligation into pET-28b. In the case of nikA from K. pneumoniae, the sequence encoding an N-terminal Strep-II-tag (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) and tobacco etch virus (TEV) protease cleavage site (Glu-Asn-Leu-Tyr-Phe-Gln) was included in the forward primer(5’-GCGCCCATGGGCTGGAGCCATCCGCAGTTTGAAAAAGAAAACCTGTATTTTCAGAGC GCGCCGTACCAGCTCAC-3’ and 5’- GCGCCTCGAGTTATGGCGTTACCGGGG-3’)⁶³. To generate a C-terminally FLAG-tagged form of K. pneumoniae nikA, the gene was amplified from genomic DNA containing BamHI and XhoI restriction sites (5’-CGCGGGATCC ATGTCTATTATCCGCCT-3’ and 5’GCGCCCATGGATGGGCTGGAGCCATCC-3’). The nucleotide sequence encoding the FLAG tag was included in the reverse primer. The PCR product was inserted into pGDP-1 in-frame with a bla promoter for constitutive expression. The final construct was transformed into K. pneumoniae ATCC 33495.

Galleria mellonella infection model

Overnight cultures of K. pneumoniae ATCC 33495 or S. aureus USA300 were grown in LB, washed twice in PBS, and adjusted to OD₆₀₀ values of 1.0 and 2.0, respectively (~2 × 10⁸ and 1 × 10⁸ CFU, respectively). The cell suspensions were mixed at an equal volume of 300 μg/mL Zn-AMA before injection. The larvae were each injected with 10 μL (~200 μg) of bacterial suspension with and without Zn-AMA or PBS. Ten larvae were used per group, incubated at 30 °C, and monitored on a 24-hour cycle. Fresh G. mellonella larvae were obtained from The Dragon Lair (www.thedragonlair.ca).

Cytotoxicity assays

HEK293 cells (ATCC CRL-1573; generation 15) were seeded at 7500 cells/well in 384-well tissue culture-treated white plates in 50 μL Dulbecco Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM l-glutamine, 100 μg/mL streptomycin, and 100 μg/mL penicillin. Cells were incubated for 18 h at 37 °C under 5% CO₂. After 18 hours, a total volume of 500 nL of AMA, Zn-AMA, Co-AMA, or Ni-AMA (2-fold dilutions) and water was added to the cells using a Labcyte Echo acoustic dispenser (compound; Beckman Coulter) and a combi nL (water; ThermoFisher). Cells were incubated for an additional 48 h, after which cell viability was assessed using Promega Cell Titer Glo 2.0 reagent (Fisher Scientific). Cell Titer Glo (50 μL) was added directly to the media using the combi nL; the plates were shaken for 2 minutes and then incubated for 10 minutes at room temperature. The luminescence was read on a Neo2 plate reader (Biotek) using luminescence fiber. Controls were untreated cells and cells treated with water only.

Evaluation of urease-dependent pH changes in whole cells and cell-free extracts

K. pneumoniae whole-cell urease activity was determined with artificial urine containing 0.2% (w/v) casamino acids and 0.01% (w/v) phenol red in 96-well plates. For the growth of S. aureus in artificial urine, the medium was supplemented with 10% LB. After 20–24 hours of growth, bacteria were removed using 0.45 μm filter plates, and the final A₅₅₀ of the medium was measured using a plate reader.

To measure urease activity in cell-free extracts, overnight cultures (5 mL) of K. pneumoniae were grown in LB at 37 °C and collected by centrifugation (5000 × g, 10 min) resuspended in 25 mM HEPES-NaOH, 150 mM NaCl, pH 7.5. The cells were subsequently lysed by sonication, and cell debris was removed with centrifugation (20,000 × g, 10 min). The cell-free extract was used in dose-response assays containing twofold dilutions of AMA and Zn-AMA (1 mM–3.9 μM), or fluorfamide (125 μM–61 nM) in flat bottom 96-well plates. The assays were initiated with urea (40 mM) and incubated at 37 °C for 10 min. Liberated NH₃ was quantified using the indophenol-hypocholorite reaction as previously described⁶⁴. The total amount of protein was quantified by Bradford assay using bovine serum albumin as standard. Each assay was performed in duplicate wells.

Polystyrene microtiter biofilm assay

Biofilm assays to assess the effect of Zn-AMA were adapted from a previously described method⁶⁵. Overnight cultures of K. pneumoniae or S. aureus USA300 were diluted in sterile saline (NaCl, 0.9% w/v) to an OD₆₀₀ of 0.1 and diluted 1/200 in either M9-Cas, or artificial urine. Two-fold dilutions of Zn-AMA were added to the cells in a 96-well round-bottom microtiter plate, and the cells were grown at 37 °C for 18 hours in a static incubator. Following incubation, the microtiter plates were agitated on an orbital shaker (300 rpm, 2 min), the planktonic cells were transferred to a fresh plate, and their OD₆₀₀ was quantified. The biofilms were washed three times with deionized water, air-dried, and stained with 0.1% crystal violet for 15 min. Excess crystal violet was removed, the plates were washed with deionized water three times, and they were air-dried for 1 hour. The crystal violet-stained biofilms were solubilized in 33% acetic acid (100 μL) for 5 min, and the absorbance (600 nm) was measured. Experiments were performed in four replicates, and absorbance measurements were performed in a BioTek Synergy H1 plate reader.

Whole-cell [NiFe] hydrogenase assay

The whole-cell hydrogenase activity in K. pneumoniae was based on a modified method described by Lacasse et al.⁴¹ Fresh colonies of K. pneumoniae were resuspended in sterile saline of 0.85% (w/v) until an OD₆₀₀ of 0.1 was attained. The cell suspension was diluted 1/100 in LB supplemented with 0.8% glucose, 10 mM MgCl₂, and 10 mM potassium phosphate, pH 7.2. The cells were grown in 150 μL volumes in flat-bottom 96-well plates in an anaerobic glove box (85% N₂, 10% CO₂, 5% H₂) and incubated at 37 °C. Dose-response analyses of AMA and AMA metal complexes were performed using twofold dilutions of each compound (200–0.78 μM). Following an 18-hour incubation, whole-cell [NiFe] hydrogenase activity was monitored by adding benzyl viologen (1 mg/mL) to each well, followed by continuous monitoring of the change in absorbance at 630 nm using a BioTek Synergy H1 microplate reader in an anaerobic glove box.

[NiFe] hydrogenase zymography

As described for whole-cell hydrogenase assays, E. coli BW25113 cultures (2 mL) in eight-well cell culture plates were grown under anaerobic conditions. The cells were harvested by centrifugation, resuspended in PBS, and lysed by sonication. Cell debris was removed by centrifugation (21,000 × g, 5 min), and Triton X-100 was added to a final concentration of 1%. Total protein was separated using a 12% native PAGE gel containing 0.1% Triton, and [NiFe] hydrogenase gel bands were developed using benzyl viologen (0.5 mg/mL) and tetrazolium chloride (1 mg/mL) in 50 mM MOPS pH 7 in a resealable bag that was flushed and filled with 100% hydrogen. Bands were detectable within 10 mins of incubation⁴².

Cellular metal analysis

The cellular Zn²⁺ and Ni²⁺ content of K. pneumoniae was carried out according to the method described by Maunders et al.⁶⁶ with some modifications. An overnight culture of K. pneumoniae was diluted 1/200 in LB medium (5 mL) and was either untreated or treated with 0.2 mM AMA or Zn-AMA. The cells were grown for 16 h at 37 °C, harvested by centrifugation, and washed twice with PBS containing 5 mM EDTA and twice with ultra-pure water. The cell pellet was subsequently digested in 0.25 mL 65% HNO₃ at 80 °C for 30 minutes in borosilicate glass tubes using a water bath. The samples were diluted to 2% HNO₃ and filtered through a 0.45 μm syringe filter. ⁶⁰Ni and ⁶⁶Zn were quantified using a Thermo iCAP Q ICP-MS.

Cellular thermal shift assay

Overnight cultures of K. pneumoniae constitutively expression NikA-FLAG were diluted 1/20 in fresh LB (20 mL) supplemented with 50 μg/mL kanamycin and grown to an OD₆₀₀ of 0.85. The cells were subsequently chilled on ice, collected by centrifugation (5000 × g, 10 min, 4 °C), resuspended in PBS (3 mL), and split into 1 mL aliquots to which water, AMA (250 μM), or Ni-AMA (250 μM) was added. The cells were then incubated at 37 °C for 20 min before being collected and washed twice in PBS by centrifugation. The final washed cell pellet was resuspended in PBS (100 μL) and aliquoted (20 μL) into PCR tubes. The cells were subjected to a temperature gradient using a thermocycler for 3 min, followed by a 3 min incubation at 25 °C. Total cellular protein was released by lysis with PBS containing 50 μg/mL lysozyme, 150 U/mL benzonase, 0.8% (v/v) NP-40, 1× EDTA-free protease inhibitor cocktail tablet, and 1 mM MgCl₂ (20 min), followed by three freeze-thaw cycles in liquid nitrogen and a 30 °C heating block. Cell debris was removed by filtration through a 0.45 μm 96-well filter plate, and 10 μL 4× SDS-PAGE loading dye was added. The samples were analyzed by SDS-PAGE and transferred onto a PVDF membrane for immunoblotting. Membranes were blocked with 5% non-fat skim milk, probed for FLAG-tagged NikA with mouse-derived anti-DYDDDDK IG2b conjugated to HRP (1:5000), and were detected with chemiluminescence with a ChemiDoc MP imaging system. The membrane was treated with hydrogen peroxide to inactivate HRP, blocked, reprobed with rabbit anti-OmpA IgG (1:10,000) followed by HRP-conjugated mouse anti-rabbit IgG (1:20,000) and quantified with chemiluminescence.

Protein production and purification

K. pneumoniae nikA, lacking its N-terminal signal peptide (residues 20-518), was cloned into pET-28b with an N-terminal Strep-II tag. The plasmid was transformed into E. coli BL21 (DE3) for protein production, and an overnight culture was used to inoculate 1 L of LB supplemented with 50 μg/mL kanamycin, which was grown to an OD₆₀₀ of 0.6 at 37 °C. The culture was subsequently chilled to 18 °C, and isopropyl-β-thiogalactoside was added (0.5 mM) to induce expression. The culture was grown for an additional 18 h, then collected by centrifugation, resuspended in lysis buffer (100 mM Tris-HCl, 150 mM NaCl, pH 8.0), and lysed by sonication. The crude lysate was cleared by centrifugation (30,000 × g, 15 min, 4 °C), and the total cellular protein was applied to a 1 mL StrepTrap XT column with a syringe. The column was washed with 10 column volumes (CV) of lysis buffer until no protein was detected in the flow through. Strep-II NikA was eluted from the column using five CV lysis buffer containing 50 mM biotin and was >90% pure (Fig. S16). Protein fractions were pooled, concentrated, and buffer exchanged into 25 mM Tris-HCl, 150 mM NaCl, pH 7.5 using a PD-10 desalting column. Using the calculated molar extinction coefficient, K. pneumoniae NikA was quantified using UV absorbance at 280 nm.

NikA from E. coli was produced and purified based on the method of Cherrier et al.⁴⁵. Briefly, E. coli nikA was cloned into pET-28b, lacking its N-terminal signal sequence (22–524), and was kept tagless. E. coli NikA was overproduced as K. pneumoniae NikA and lysed in 40 mM Tris-HCl, 150 mM NaCl, pH 7.4. NikA was precipitated from cell lysates using 80% (w/v) ammonium sulfate, following a 40% (w/v) cut and dialyzed in 25 mM Tris-HCl, pH 8.0. NikA was further purified using anion exchange chromatography with a RESOUCE Q column and eluted with a gradient of NaCl. Peak fractions were pooled, and the >90% pure fractions were pooled (Fig. S16). The E. coli NikA was quantified with UV absorbance.

In vitro thermal shift assay

K. pneumoniae NikA (1 μM) was incubated with AMA, Ni-AMA, Zn-AMA, Co-AMA, NiCl₂, CoCl₂, or ZnCl₂ (100 μM) in 25 mM Tris-HCl, 150 mM NaCl, pH 7.5 containing 2 X SYPRO Orange Dye. Thermal denaturation was monitored using an RT-PCR system (BioRad) between 25 °C and 95 °C at 0.5 °C increments. The melting temperatures of each sample were determined by identifying the inflection point of the derivative data of the melt curve.

Isothermal titration calorimetry

Affinity and thermodynamic analyses of K. pneumoniae NikA were performed on a Malvern MicroCal PEAQ microcalorimeter. Titrations were performed in 25 mM Tris-HCl, 150 mM NaCl, 0.1% (v/v) Triton X-100, pH 7.5. It was found that the inclusion of detergent significantly deterred protein precipitation caused by the titration of Zn²⁺ complexes. Compounds were prepared in the same buffer. NikA (15 μM) was loaded into the sample cell, and the various metal complexes (250 μM) were loaded into the syringe as ligands. In the case of Zn-toxin and AMB, 350 μM of the ligand was used. Titrations were conducted in duplicate at 37 °C with constant stirring at 750 rpm with an initial injection of 0.4 μL followed by 18, 3 μL injections. Control titrations to determine the heat of compound dilution into buffer were performed under the same conditions and subtracted from the experimental titration. Data were fit to a one-site model to determine the thermodynamic parameters of binding.

To determine the Ni²⁺ affinity of AMA, competitive titrations were carried out with AMA, Zn²⁺, and Ni²⁺ using 25 mM Tris-HCl, 150 mM NaCl, pH 7.5. The sample cell was loaded with a ZnCl₂ and AMA at a 2:1 ratio using 200 μM and 100 μM, respectively. NiCl₂ (1 mM) was loaded into the syringe for titration into the sample cell. Titrations were performed in duplicate as described above. Data were fit to a one-site model competitive binding model.

Crystallization, data collection, and structure determination

E. coli NikA was concentrated at 10 mg/mL, to which Ni-AMA was added at a final concentration of 400 μM (1:2 protein to ligand ratio). The sample was then immediately used in sparse matrix crystallization screens with the hanging-drop vapor diffusion method with 2 μL drops and protein to reservoir ratio of 1:1. Needle-like crystals were identified in condition 9 (0.17 ammonium acetate, 0.085 sodium citrate pH 5.6, 25.5% PEG 4000, 15% glycerol) of the Hampton Research Crystal Screen Cryo suite after one week at 21 °C. The crystals were further optimized, and the best that grew as long rods in 0.17 M ammonium acetate, 0.1 M sodium citrate pH 5.8, 23% PEG 4000, and 17% glycerol were vitrified in liquid nitrogen. Native datasets were collected at the CMCF-BM (08IB1) beamline at the Canadian Light Source, Saskatoon, SK, Canada. The X-ray data were processed using autoPROC⁶⁷, XDS⁶⁸, and CCP4⁶⁹. The structure of NikA was determined by molecular replacement using the NikA:Ni-(His)₂ complex (PDB ID 4I8C) as the search model. Model building and refinement were done in Coot⁷⁰ and Phenix⁷¹ with translation/libration/screw (TLS) groups determined automatically using the TLSMD webserver⁷². Ramachandran statistics were calculated using Phenix using Molprobity, which gave 97% favored and 0.2% outliers. Ligand restraints for AMA generated using the GradeWebServer (http://grade.globalphasing.org). Data are listed in supplementary table S1. The coordinates and structure factors have been deposited (PDB ID 8SPM) in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NY. Molecular graphics and analyses were performed using Pymol.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The coordinates and structure factors of NikA:Ni-AMA generated in this study are available at the PDB under the accession number 8SPM. The previously published coordinates for NikA apoprotein, NikA:Fe-EDTA, NikA-Ni(l-His)₂, and NikA:Ni-BTC are available at the PDB under the accession numbers, 1UIU, 1ZLQ, 4I8C, and 3DP8, respectively. Source data are provided with this paper.

References

Mulrooney, S. B. & Hausinger, R. P. Nickel uptake and utilization by microorganisms. FEMS Microbiol. Rev. 27, 239–261 (2003).
Article CAS PubMed Google Scholar
Boer, J. L., Mulrooney, S. B. & Hausinger, R. P. Nickel-dependent metalloenzymes. Arch. Biochem. Biophys. 544, 142–152 (2014).
Article CAS PubMed Google Scholar
Funck, D. et al. Discovery of a Ni²⁺-dependent guanidine hydrolase in bacteria. Nature 603, 515–521 (2022).
Article ADS CAS PubMed Google Scholar
Alfano, M. & Cavazza, C. Structure, function, and biosynthesis of nickel‐dependent enzymes. Protein Sci. 29, 1071–1089 (2020).
Article CAS PubMed PubMed Central Google Scholar
Benoit, S. L., Maier, R. J., Sawers, R. G. & Greening, C. Molecular hydrogen metabolism: a widespread trait of pathogenic bacteria and protists. Microbiol. Mol. Biol. Rev. 84, e00092–19 (2020).
Article CAS PubMed PubMed Central Google Scholar
Hiron, A. et al. A nickel ABC‐transporter of Staphylococcus aureus is involved in urinary tract infection. Mol. Microbiol. 78, 788–788 (2010).
Article CAS Google Scholar
Zhou, C. et al. Urease is an essential component of the acid response network of Staphylococcus aureus and is required for a persistent murine kidney infection. PLOS Pathog. 15, e1007538 (2019).
Article PubMed PubMed Central Google Scholar
Fischer, F. et al. Characterization in Helicobacter pylori of a nickel transporter essential for colonization that was acquired during evolution by gastric Helicobacter species. PLOS Pathog. 12, e1006018 (2016).
Article PubMed PubMed Central Google Scholar
Eaton, K. A. & Krakowka, S. Effect of gastric pH on urease-dependent colonization of gnotobiotic piglets by Helicobacter pylori. Infect. Immun. 62, 3604–3607 (1994).
Article CAS PubMed PubMed Central Google Scholar
Maroncle, N., Rich, C. & Forestier, C. The role of Klebsiella pneumoniae urease in intestinal colonization and resistance to gastrointestinal stress. Res. Microbiol. 157, 184–193 (2006).
Article CAS PubMed Google Scholar
Jones, B. D., Lockatell, C. V., Johnson, D. E., Warren, J. W. & Mobley, H. L. Construction of a urease-negative mutant of Proteus mirabilis: analysis of virulence in a mouse model of ascending urinary tract infection. Infect. Immun. 58, 1120–1123 (1990).
Article CAS PubMed PubMed Central Google Scholar
Maier, R. J., Olczak, A., Maier, S., Soni, S. & Gunn, J. Respiratory hydrogen use by Salmonella enterica serovar Typhimurium is essential for virulence. Infect. Immun. 72, 6294–6299 (2004).
Article CAS PubMed PubMed Central Google Scholar
Maier, L. et al. Microbiota-derived hydrogen fuels Salmonella Typhimurium invasion of the gut ecosystem. Cell Host Microbe 14, 641–651 (2013).
Article CAS PubMed Google Scholar
Cox, G. M., Mukherjee, J., Cole, G. T., Casadevall, A. & Perfect, J. R. Urease as a virulence factor in experimental cryptococcosis. Infect. Immun. 68, 443–448 (2000).
Article CAS PubMed PubMed Central Google Scholar
Baker, R. P. & Casadevall, A. Reciprocal modulation of ammonia and melanin production has implications for cryptococcal virulence. Nat. Commun. 14, 849 (2023).
Article ADS CAS PubMed PubMed Central Google Scholar
Xiong, Z. et al. Urease of Aspergillus fumigatus is required for survival in macrophages and virulence. Microbiol. Spectr. 11, e03508-e03522 (2023).
Nakashige, T. G., Zygiel, E. M., Drennan, C. L. & Nolan, E. M. Nickel sequestration by the host-defense protein human calprotectin. J. Am. Chem. Soc. 139, 8828–8836 (2017).
Article CAS PubMed PubMed Central Google Scholar
Flores-Mireles, A. L., Walker, J. N., Caparon, M. & Hultgren, S. J. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nat. Rev. Microbiol. 13, 269–284 (2015).
Article CAS PubMed PubMed Central Google Scholar
Flannigan, R., Choy, W. H., Chew, B. & Lange, D. Renal struvite stones—pathogenesis, microbiology, and management strategies. Nat. Rev. Urol. 11, 333–341 (2014).
Article CAS PubMed Google Scholar
Friedrich, B. & Magasanik, B. Urease of Klebsiella aerogenes: control of its synthesis by glutamine synthetase. J. Bacteriol. 131, 446–452 (1977).
Article CAS PubMed PubMed Central Google Scholar
Søndergaard, D., Pedersen, C. N. S. & Greening, C. HydDB: a web tool for hydrogenase classification and analysis. Sci. Rep. 6, 34212 (2016).
Article ADS PubMed PubMed Central Google Scholar
Olson, J. W. & Maier, R. J. Molecular hydrogen as an energy source for Helicobacter pylori. Science 298, 1788–1790 (2002).
Article ADS CAS PubMed Google Scholar
Kanazuru, T. et al. Role of hydrogen generation by Klebsiella pneumoniae in the oral cavity. J. Microbiol. 48, 778–783 (2010).
Article CAS PubMed Google Scholar
Navarro, C., Wu, L. & Mandrand‐Berthelot, M. The nik operon of Escherichia coli encodes a periplasmic binding‐protein‐dependent transport system for nickel. Mol. Microbiol. 9, 1181–1191 (1993).
Article CAS PubMed Google Scholar
Remy, L. et al. The Staphylococcus aureus Opp1 ABC transporter imports nickel and cobalt in zinc‐depleted conditions and contributes to virulence. Mol. Microbiol. 87, 730–743 (2013).
Article CAS PubMed Google Scholar
Chivers, P. T., Benanti, E. L., Heil-Chapdelaine, V., Iwig, J. S. & Rowe, J. L. Identification of Ni-(l-His)₂ as a substrate for NikABCDE-dependent nickel uptake in Escherichia coli. Metallomics 4, 1043–1050 (2012).
Article CAS PubMed Google Scholar
Lebrette, H. et al. Promiscuous nickel import in human pathogens: structure, thermodynamics, and evolution of extracytoplasmic nickel-binding proteins. Structure 22, 1421–1432 (2014).
Article CAS PubMed Google Scholar
Sychantha, D., Rotondo, C. M., Tehrani, K. H. M. E., Martin, N. I. & Wright, G. D. Aspergillomarasmine A inhibits metallo-β-lactamases by selectively sequestering Zn²⁺. J. Biol. Chem. 297, 100918 (2021).
Article CAS PubMed PubMed Central Google Scholar
King, A. M. et al. Aspergillomarasmine A overcomes metallo-β-lactamase antibiotic resistance. Nature 510, 503–506 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Bergstrom, A. et al. Probing the Interaction of Aspergillomarasmine A with Metallo-β-lactamases NDM-1, VIM-2, and IMP-7. ACS Infect. Dis. 4, 135–145 (2018).
Article CAS PubMed Google Scholar
Koteva, K. et al. Three-dimensional structure and optimization of the metallo-β-lactamase inhibitor aspergillomarasmine A. ACS Omega 7, 4170–4184 (2022).
Article CAS PubMed PubMed Central Google Scholar
Rotondo, C. M., Sychantha, D., Koteva, K. & Wright, G. D. Suppression of β-Lactam resistance by aspergillomarasmine A is influenced by both the metallo-β-lactamase target and the antibiotic partner. Antimicrob. Agents Chemother. 64, e01386–19 (2020).
Article CAS PubMed PubMed Central Google Scholar
Rowinska-Zyrek, M., Zakrzewska-Czerwinska, J., Zawilak-Pawlik, A. & Kozlowski, H. Ni²⁺ chemistry in pathogens – a possible target for eradication. Dalton Trans. 43, 8976–8989 (2014).
Article CAS PubMed Google Scholar
Zhang, Y., Akilesh, S. & Wilcox, D. E. Isothermal titration calorimetry measurements of Ni(II) and Cu(II) binding to His, GlyGlyHis, HisGlyHis, and bovine serum albumin: a critical evaluation. Inorg. Chem. 39, 3057–3064 (2000).
Article CAS PubMed Google Scholar
Nakashige, T. G. & Nolan, E. M. Human calprotectin affects the redox speciation of iron. Metallomics 9, 1086–1095 (2017).
Article CAS PubMed Google Scholar
Sarigul, N., Korkmaz, F. & Kurultak, İ. A new artificial urine protocol to better imitate human urine. Sci. Rep. 9, 20159 (2019).
Article ADS CAS PubMed PubMed Central Google Scholar
Lake, K. D., Brown, D. C. & McLeod, D. C. New drug therapy for kidney stones: a review of cellulose sodium phosphate, acetohydroxamic acid, and potassium citrate. Drug Intel. Clin. Pharm. 19, 530–539 (1985).
CAS Google Scholar
Williams, J. J., Rodman, J. S. & Peterson, C. M. A randomized double-blind study of acetohydroxamic acid in struvite nephrolithiasis. New Engl. J. Med. 311, 760–764 (1984).
CAS Google Scholar
Espinosa-Ortiz, E. J., Eisner, B. H., Lange, D. & Gerlach, R. Current insights into the mechanisms and management of infection stones. Nat. Rev. Urol. 16, 35–53 (2019).
Article PubMed Google Scholar
Ballantine, S. P. & Boxer, D. H. Nickel-containing hydrogenase isoenzymes from anaerobically grown Escherichia coli K-12. J. Bacteriol. 163, 454–459 (1985).
Article CAS PubMed PubMed Central Google Scholar
Lacasse, M. J. et al. A whole-cell, high-throughput hydrogenase assay to identify factors that modulate [NiFe]-hydrogenase. Act. J. Biol. Chem. 294, 15373–15385 (2019).
Article CAS Google Scholar
Pinske, C., Jaroschinsky, M., Sargent, F. & Sawers, G. Zymographic differentiation of [NiFe]-Hydrogenases 1, 2 and 3 of Escherichia coli K-12. BMC Microbiol. 12, 134 (2012).
Article CAS PubMed PubMed Central Google Scholar
Sawers, R. G., Ballantine, S. P. & Boxer, D. H. Differential expression of hydrogenase isoenzymes in Escherichia coli K-12: evidence for a third isoenzyme. J. Bacteriol. 164, 1324–1331 (1985).
Article CAS PubMed PubMed Central Google Scholar
Pinske, C. et al. Efficient electron transfer from hydrogen to benzyl viologen by the [NiFe]-hydrogenases of Escherichia coli is dependent on the coexpression of the iron–sulfur cluster-containing small subunit. Arch. Microbiol. 193, 893–903 (2011).
Article CAS PubMed Google Scholar
Cherrier, M. V., Cavazza, C., Bochot, C., Lemaire, D. & Fontecilla-Camps, J. C. Structural characterization of a putative endogenous metal chelator in the periplasmic nickel transporter NikA. Biochemistry 47, 9937–9943 (2008).
Article CAS PubMed Google Scholar
Mateus, A. et al. Thermal proteome profiling in bacteria: probing protein state in vivo. Mol. Syst. Biol. 14, e8242 (2018).
Article PubMed PubMed Central Google Scholar
Blanden, A. R. et al. Zinc shapes the folding landscape of p53 and establishes a pathway for reactivating structurally diverse cancer mutants. Elife 9, e61487 (2020).
Article CAS PubMed PubMed Central Google Scholar
Iannuzzi, C. et al. The role of zinc in the stability of the marginally stable IscU scaffold protein. Protein Sci. 23, 1208–1219 (2014).
Article CAS PubMed PubMed Central Google Scholar
Prehna, G. & Stebbins, C. E. A Rac1–GDP trimer complex binds zinc with tetrahedral and octahedral coordination, displacing magnesium. Acta Crystallogr. Sect. D. Biol. Crystallogr. 63, 628–635 (2007).
Article ADS CAS Google Scholar
Law, W. W. H., Kanelis, V. & Zamble, D. B. Biochemical studies highlight determinants for metal selectivity in the Escherichia coli periplasmic solute binding protein NikA. Metallomics 14, Mfac084 (2022).
Article PubMed PubMed Central Google Scholar
Heddle, J., Scott, D. J., Unzai, S., Park, S.-Y. & Tame, J. R. H. Crystal structures of the liganded and unliganded nickel-binding protein NikA from Escherichia coli. J. Biol. Chem. 278, 50322–50329 (2003).
Article CAS PubMed Google Scholar
Chute, R. & Suby, H. I. Prevalence and importance of urea-splitting bacterial infections of the urinary tract in the formation of calculi. J. Urol. 44, 590–595 (1940).
Article CAS Google Scholar
Owen, R. J., Martin, S. R. & Borman, P. Rapid urea hydrolysis by gastric campylobacters. Lancet 325, 111 (1985).
Article Google Scholar
Rosenstein, I. J. M., Hamilton-Miller, J. M. T. & Musher, D. M. Inhibitors of urease as chemotherapeutic agents. Crit. Rev. Microbiol. 11, 1–12 (1984).
Article CAS PubMed Google Scholar
Aniceto, N., Bonifácio, V. D. B., Guedes, R. C. & Martinho, N. Exploring the chemical space of urease inhibitors to extract meaningful trends and drivers of activity. J. Chem. Inf. Model. 62, 3535–3550 (2022).
Article CAS PubMed PubMed Central Google Scholar
Yang, X. et al. Metallochaperone UreG serves as a new target for design of urease inhibitor: a novel strategy for development of antimicrobials. PLoS Biol. 16, e2003887 (2018).
Article PubMed PubMed Central Google Scholar
Sebastiampillai, S. et al. Using a high-throughput, whole-cell hydrogenase assay to identify potential small molecule inhibitors of [NiFe]-hydrogenase. Metallomics 14, mfac073 (2022).
Article PubMed Google Scholar
Nie, W. et al. Hydrogenase: the next antibiotic target? Clin. Sci. 122, 575–580 (2012).
Article CAS Google Scholar
Svane, S., Sigurdarson, J. J., Finkenwirth, F., Eitinger, T. & Karring, H. Inhibition of urease activity by different compounds provides insight into the modulation and association of bacterial nickel import and ureolysis. Sci. Rep. 10, 8503 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Benoit, S. L. et al. Nickel chelation therapy as an approach to combat multi-drug resistant enteric pathogens. Sci. Rep. 9, 13851 (2019).
Article ADS PubMed PubMed Central Google Scholar
Sunderman, F. W. A review of the metabolism and toxicology of nickel. Ann. Clin. Lab. Sci. 7, 377–398 (1977).
CAS PubMed Google Scholar
Frei, A., Verderosa, A. D., Elliott, A. G., Zuegg, J. & Blaskovich, M. A. T. Metals to combat antimicrobial resistance. Nat. Rev. Chem. 7, 202–224 (2023).
Article CAS PubMed PubMed Central Google Scholar
Schmidt, T. G. & Skerra, A. The Strep-tag system for one-step purification and high-affinity detection or capturing of proteins. Nat. Protoc. 2, 1528–1535 (2007).
Article CAS PubMed Google Scholar
Weatherburn, M. W. Phenol-hypochlorite reaction for determination of ammonia. Anal. Chem. 39, 971–974 (1967).
Article CAS Google Scholar
Coles, V. E. et al. Exploration of BAY 11-7082 as a potential antibiotic. ACS Infect. Dis. 8, 170–182 (2022).
Article CAS PubMed Google Scholar
Maunders, E. A. et al. The Role of ZntA in Klebsiella pneumoniae zinc homeostasis. Microbiol. Spectr. 10, e01773–21 (2022).
Article CAS PubMed PubMed Central Google Scholar
Vonrhein, C. et al. Data processing and analysis with the autoPROC toolbox. Acta Crystallogr. Sect. D. Biol. Crystallogr. 67, 293–302 (2010).
Article ADS Google Scholar
Kabsch, W. XDS. Acta Crystallogr. Sect. D. Biol. Crystallogr. 66, 125–132 (2010).
Article ADS CAS Google Scholar
Winn, M. D. et al. Overview of the CCP4 suite and current developments. Acta Crystallogr. Sect. D. 67, 235–242 (2011).
Article ADS CAS Google Scholar
Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr. Sect. D. Biol. Crystallogr 60, 2126–2132 (2004).
Article ADS Google Scholar
Afonine, P. V. et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr. D. Biol. Crystallogr. 68, 352–367 (2012).
Article ADS CAS PubMed PubMed Central Google Scholar
Painter, J. & Merritt, E. A. TLSMD web server for the generation of multi-group TLS models. J. Appl. Crystallogr. 39, 109–111 (2006).
Article ADS CAS Google Scholar

Download references

Acknowledgements

We thank John C. Whitney for providing crystallography resources, Caitlyn M. Rotondo for technical support in cloning nikA, Victoria E. Coles for helpful discussions, and Susan McCusker and Tracey Campbell for their technical support with the cytotoxicity assays. We would also like to thank the ANALEST facility at the University of Toronto for providing access to their ICP-MS system. This research was funded by a Canadian Institutes of Health Research grant (FRN-148463), a Canadian Institutes of Health Research Fellowship award (to David Sychantha), and a Natural Sciences and Engineering Research Council of Canada (NSERC) grant RGPIN-2018-04968 (to Gerd Prehna).

Author information

David Sychantha
Present address: Department of Chemistry, University of Waterloo, Waterloo, ON, Canada

Authors and Affiliations

David Braley Centre for Antibiotic Discovery, McMaster University, Hamilton, ON, Canada
David Sychantha, Xuefei Chen, Kalinka Koteva & Gerard D. Wright
M.G. DeGroote Institute for Infectious Disease Research, McMaster University, Hamilton, ON, Canada
David Sychantha, Xuefei Chen, Kalinka Koteva & Gerard D. Wright
Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, ON, Canada
David Sychantha, Xuefei Chen, Kalinka Koteva & Gerard D. Wright
Department of Microbiology, University of Manitoba, Winnipeg, MB, Canada
Gerd Prehna

Authors

David Sychantha
View author publications
You can also search for this author in PubMed Google Scholar
Xuefei Chen
View author publications
You can also search for this author in PubMed Google Scholar
Kalinka Koteva
View author publications
You can also search for this author in PubMed Google Scholar
Gerd Prehna
View author publications
You can also search for this author in PubMed Google Scholar
Gerard D. Wright
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

D.S. conceived, performed, and analyzed data for all experiments. X.C. Conducted G. mellonella infection models. K.K. synthesized AMA analogs. G.P. performed data collection and analysis of X-ray data. G.D.W. conceived the project, analyzed data, and directed the work of D.S. G.D.W. and D.S. prepared the manuscript with support from the other authors.

Corresponding author

Correspondence to Gerard D. Wright.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Anthony Verderosa and the other, anonymous, reviewers for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Sychantha, D., Chen, X., Koteva, K. et al. Targeting bacterial nickel transport with aspergillomarasmine A suppresses virulence-associated Ni-dependent enzymes. Nat Commun 15, 4036 (2024). https://doi.org/10.1038/s41467-024-48232-1

Download citation

Received: 02 June 2023
Accepted: 23 April 2024
Published: 13 May 2024
DOI: https://doi.org/10.1038/s41467-024-48232-1

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.