Evolutionary origin of Hoxc13-dependent skin appendages in amphibians

Carron, Marjolein; Sachslehner, Attila Placido; Cicekdal, Munevver Burcu; Bruggeman, Inge; Demuynck, Suzan; Golabi, Bahar; De Baere, Elfride; Declercq, Wim; Tschachler, Erwin; Vleminckx, Kris; Eckhart, Leopold

doi:10.1038/s41467-024-46373-x

Download PDF

Article
Open access
Published: 18 March 2024

Evolutionary origin of Hoxc13-dependent skin appendages in amphibians

Nature Communications volume 15, Article number: 2328 (2024) Cite this article

2028 Accesses
115 Altmetric
Metrics details

Subjects

Abstract

Cornified skin appendages, such as hair and nails, are major evolutionary innovations of terrestrial vertebrates. Human hair and nails consist largely of special intermediate filament proteins, known as hair keratins, which are expressed under the control of the transcription factor Hoxc13. Here, we show that the cornified claws of Xenopus frogs contain homologs of hair keratins and the genes encoding these keratins are flanked by promoters in which binding sites of Hoxc13 are conserved. Furthermore, these keratins and Hoxc13 are co-expressed in the claw-forming epithelium of frog toe tips. Upon deletion of hoxc13, the expression of hair keratin homologs is abolished and the development of cornified claws is abrogated in X. tropicalis. These results indicate that Hoxc13-dependent expression of hair keratin homologs evolved already in stem tetrapods, presumably as a mechanism for protecting toe tips, and that this ancestral genetic program was coopted to the growth of hair in mammals.

Transcriptome analysis reveals the genetic basis underlying the development of skin appendages and immunity in hedgehog (Atelerix albiventris)

Article Open access 18 August 2020

Identification of epidermal differentiation genes of the tuatara provides insights into the early evolution of lepidosaurian skin

Article Open access 30 July 2020

Evolutionary diversification of epidermal barrier genes in amphibians

Article Open access 10 August 2022

Introduction

The evolution of terrestrial vertebrates is characterized by the appearance of an efficient barrier against water loss in a dry environment and by the evolution of hard cornified skin appendages, such as claws, scales, feathers, and hair, which are critical for the capture of prey, protection, support of special modes of locomotion, and thermoinsulation^1,2,3. Cornified skin appendages are characteristic features of important phylogenetic clades of terrestrial vertebrates, exemplified by hair in mammals and feathers in birds. Thus, the evolution of skin appendages is a major research question in the biology of tetrapods².

Cornified skin appendages consist of terminally differentiated and inter-connected keratinocytes which are packed with specific cytoskeletal and other structural proteins. The keratinocytes within the mature parts of hard skin appendages such as hair, feathers, claws and nails are dead, meaning that they lack gene expression and metabolism. Importantly, the aforementioned skin appendages are regenerated either continuously in the case of cornified claws and nails or cyclically in the case of hair and feathers. Thus, the program of keratinocyte differentiation and cornification is not only active during embryonic development but also in the adult organism. Mammalian cornified skin appendages are characterized by the expression of so-called hair keratins, i.e. keratin intermediate filament proteins which were originally identified in hair⁴. Human hair keratins are comprised of KRT31-KRT40, which are type I keratins, and KRT81-KRT86, which are type II keratins⁵. Type I and type II hair keratins heterodimerize to form intermediate filaments. Not only hair, but also claws, nails, horns, filiform papillae of the tongue, and other hard skin appendages of mammals contain hair keratins⁵. We identified homologs of hair keratins in the green anole lizard and showed that these keratins are expressed in the cornified claws⁶, which are homologous to human nails. The conserved expression in claws and nails suggested that (1) proteins of the type I and II “hair keratin” families originated prior to the divergence of mammals and reptiles, and (2) the primordial sites of “hair keratin expression” were not hair follicles but other structures that were likely homologous to claws in extant reptiles and mammals. Further studies led to the identification of hair keratin-like proteins, though distinguished from human hair keratins by a low content of cysteine, in amphibians^7,8,9. These homologs of hair keratins are expressed in toe pads of tree frogs¹⁰, but it has remained unknown where they are expressed in phylogenetically diverse amphibians with claw-like structures, such as clawed frogs of the genus Xenopus, clawed salamanders of the genus Onychodactylus and some sirens such as Pseudobranchus striatus¹¹. Because of developmental and morphological differences to claws of amniotes, such as the accumulation of parallel cornified cell layers in claws of Xenopus frogs as opposed to the proximal-to-distal growth of human and mouse nails and claws of lizards, it was proposed that claws of clawed frogs had evolved independently from claws of amniotes^11,12. However, a conclusive molecular analysis of amphibian claws has not been reported yet.

While structural proteins as components of cornified keratinocytes determine the hardness of skin appendages, the spatial and temporal pattern of expression of the corresponding genes and thereby the development and continuous regeneration of hard skin appendages are regulated at the level of gene transcription. One of the best characterized regulators of mammalian hair keratins is the transcription factor Hoxc13, which is expressed in the hair matrix and nail matrix^13,14. Hoxc13 induces the expression of several hair keratin genes by binding to specific sites in the proximal promoters of hair keratin genes¹⁴. Mutations in human HOXC13 cause ectodermal dysplasia 9, a severe defect of hair and nails^15,16. Likewise, mutations of Hoxc13 in mice, rabbits and pigs suppressed the growth of hair and nails^17,18,19. The primordial function of Hox genes is to specify regions of the body along the head-tail axis during embryonic development^20,21,22, whereby Hoxc13 as the terminal gene of the HoxC gene cluster is activated in the posterior part of the body, such as the tail fin of Actinopterygii (ray-finned fishes)²³. During the evolution of Sarcopterygii (lobe-finned fishes), Hoxc13 was coopted to expression in paired fins, the evolutionary precursors of limbs in tetrapods²⁴. Recent research has identified enhancer elements critical for the expression of HoxC genes in developing nails and hair follicles of mammals²⁵. Importantly, the evolutionary steps between the role of Hoxc13 in fins of early Sarcopterygians and the regulatory role of Hoxc13 in mammalian hair and nails have remained elusive.

Here, we investigated the evolutionary origin of the link between Hoxc13 and hair keratins. We show that amphibian homologs of hair keratins are components of claws in the Western clawed frog (X. tropicalis), a model for basal tetrapods. The expression of these keratins and the formation of cornified claws were abrogated by the targeted disruption of hoxc13 in X. tropicalis, which is equivalent to the absence of hair and nails in mammals upon genetic inactivation of Hoxc13. Our results highlight a conserved role of Hoxc13 in claws and hair and link the evolution of limbs with the evolution of cornified skin appendages in tetrapods.

Results

Phylogenetic analysis indicates that type I and type II hair keratin gene families have originated in stem tetrapods

To determine when in evolution genes of the type I and type II hair keratin gene families have appeared, we compared the organization of keratin gene loci (Fig. 1a, b) and performed phylogenetic analyses (Fig. 1c, d) of keratins of species representing the three main clades of amphibians, i.e. frogs (western clawed frog, X. tropicalis), salamanders (axolotl, Ambystoma mexicanum) and caecilians, together with keratins of the lungfish (Protopterus annectens) as the closest piscine relative of tetrapods²⁴. We found that orthologs of human type I and type II hair keratins, denoted krt34 and krt59 in amphibians, exist in the clawed frog and the axolotl but not in the lungfish and in caecilians, which are limbless amphibians (Fig. 1). Orthology of krt34 and krt59 X. tropicalis and axolotl with human hair keratins was supported by bootstrap values > 0.9 in molecular phylogenetics (Fig. 1c, d) and shared synteny of gene loci (Fig. 1a, b). The species distribution of hair keratin homologs suggests that the hair keratin subfamilies of type I and type II keratins have originated in stem tetrapods and that they have been lost in caecilians (Fig. 1e).

**Fig. 1: Synteny analysis and molecular phylogenetics identify hair keratin homologs in amphibians.**

Homologs of hair keratins are components of claws in Xenopus frogs

For further studies of amphibian hair keratin expression, we used the western clawed frog (X. tropicalis) as a model. X. tropicalis is a diploid relative of the allotetraploid African clawed frog (X. laevis), in which the morphology and development of claws were studied previously¹¹. Cornified claws develop on toes I, II, III of the hindlimbs, here collectively referred to as hindlimb inner (HI) toes. Toes IV, V of the hindlimbs, here referred to as hindlimb outer (HO) toes, and the toes of the forelimbs lack claws (Fig. 2a) in X. tropicalis. Claws ensheath the living epithelium from which they differentiate (Fig. 2b).

**Fig. 2: Expression of hair keratin homologs of *Xenopus tropicalis* is associated with cornified claws.**

RT-PCR analysis showed that the hair keratin orthologs, krt34 and krt59, are expressed in the clawed HI toes but neither in clawless HO toes nor in back skin of X. tropicalis (Fig. 2c, d). The corresponding proteins were highly abundant in cornified claws, as revealed by mass spectrometry (MS)-based proteomic analysis (Fig. 2f, g). By contrast, X. tropicalis krt53, which is associated with adult frog skin⁸ and not related to hair keratins (Fig. 1c), was not enriched in claws (Fig. 2e, h).

Co-expression in frog toes and promoter assays in transfected cells suggest regulation of amphibian hair keratin homologs by Hoxc13

Given the conserved expression of hair keratin homologs at the toe tips of frogs and mammals and loss of hair keratin homologs in limbless caecilians (Fig. 1a, b) and snakes²⁶, we hypothesized that hair keratin homologs of both amphibians and amniotes are regulated by Hoxc13, a transcription factor evolutionarily associated with the development of limbs²⁴. As the contribution of Hoxc13 in the regulation of human hair keratins was already demonstrated previously¹⁴, we focused on X. tropicalis as model for amphibians. mRNA in situ hybridization showed that hoxc13 (Fig. 3a, d; Supplementary Fig. 1a, c), krt34 (Fig. 3b, e; Supplementary Fig. 1b, d) and krt59 (Fig. 3c, f) co-localize in the claw-forming epithelium of X. tropicalis. Next, we screened the promoter sequences of hair keratin homologs of clawed frogs for sequences similar to the binding sites of Hoxc13 that were previously identified and validated within human hair keratin promoters¹⁴. Several sites matching the Hoxc13 binding consensus sequence, TT(T/A)ATx(A/G)(A/G), were identified in the proximal promoters of krt34 and krt59 genes of X. tropicalis and X. laevis (Fig. 3g). These potential binding sites of Hoxc13 were located at similar distance from the TATA box as the validated binding sites in human hair keratin genes (Fig. 3g).

**Fig. 3: Co-expression with *krt34* in clawed toes and promoter assays suggest Hoxc13 as regulator of hair keratin expression.**

To test whether Hoxc13 is able to activate transcription from the proximal promoter regions of krt34 and krt59, we co-transfected HEK293T cells with a Hoxc13 expression construct and a reporter vector harboring a luciferase reporter gene downstream of the proximal promoter sequences of krt34 and krt59 in which predicted Hoxc13 binding sites were either preserved as in wildtype (WT) genes or mutated. Hoxc13 activated transcription of both krt34 and krt59 promoter constructs (Fig. 3h, i). Mutations of putative Hoxc13 binding sites in krt34 and krt59 promoters significantly reduced luciferase reporter expression (Fig. 3h, i). Residual activation by Hoxc13 suggests that Hoxc13 binds at additional promoter sites besides those mutated in our experiment. Together, these data show that homologs of hair keratins, which are essential for hair and nail development in mammals^15,17, are expressed in claws of X. tropicalis and their promoters contain conserved and functional Hoxc13 binding sequences.

Deletion of Hoxc13 abolishes the expression of hair keratin homologs and the formation of cornified claws in X. tropicalis

To test the role of Hoxc13 in the regulation of keratins in X. tropicalis, we generated Hoxc13-deficient frogs and determined their phenotype in comparison to control frogs. A double-strand break was introduced by CRISPR-Cas9-mediated genome editing²⁷ at the codon for amino acid residue 80 of Hoxc13 to cause nucleotide deletions or insertions of various lengths upstream of the homeobox domain (amino acid residues 239-292), which is essential for DNA binding and activation of transcription (Supplementary Fig. 2). Out-of-frame (frame-shift) mutations were predicted to abrogate protein function. By contrast, short in-frame deletions and substitutions of single amino acid residues at this site were predicted to be compatible with the function of Hoxc13 as a transcription factor, thereby providing negative controls for the following investigations of the phenotypes. Two-cell stage embryos of X. tropicalis were targeted by CRISPR-Cas9-induced mutagenesis to generate mosaic frogs carrying different mutations in different parts of the body including germ cells. By crossing mosaic mutant frogs, we obtained frogs that carried one or two mutant alleles of hoxc13 in all cells of the body (Fig. 4a).

**Fig. 4: *hoxc13* knockout frogs lack claws and do not express hair keratins homologs.**

Frogs with out-of-frame deletions in both hoxc13 alleles, here referred to as knockout (KO) frogs, developed normally except for one striking phenotype, the absence of claws (Fig. 4b–e). By contrast, frogs with one out-of-frame mutant allele (heterozygotes) and frogs with in-frame deletions (3 or 6 nucleotides) in both hoxc13 alleles displayed normal development of macroscopically visible claws on HI toes (Fig. 4a). Furthermore, some of the mosaic mutant frogs lacked claws on one or both hind-limbs. Sequencing of hoxc13 showed two out-of-frame alleles in clawless HI toes and the presence of one allele encoding a functional Hoxc13 protein in clawed HI toes of a mosaic mutant (Supplementary Fig. 3). Histological analysis confirmed the presence of darkly pigmented cornified claws on HI toes of WT frogs (Fig. 4f) and their absence on the HI toes of KO frogs (Fig. 4g). These phenotyping data demonstrated that biallelic out-of-frame mutations of hoxc13 abolished, either directly or indirectly, the differentiation of toe tip keratinocytes into cornified claws whereas single alleles of wildtype or in-frame-mutant hoxc13 sufficed to induce claw formation. As off-target effects of CRISPR-Cas9 genome editing are equally likely in frogs with in-frame mutations and frogs with out-of-frame mutations of hoxc13, the claw-loss phenotype can be clearly attributed to the direct inactivation of hoxc13.

The impact of hoxc13 mutations on the expression of hair keratin homologs was determined by quantitative RT-PCR analysis (Fig. 4h, i). The inactivation of Hoxc13 abrogated the expression of both krt34 (Fig. 4h) and krt59 (Fig. 4i) in HI toes. RNA-seq analysis showed that krt34 and krt59 were more strongly decreased than any other keratin in Hoxc13-deficient (clawless) HI toes as compared to HI toes in which Hoxc13 (either wildtype or carrying an R80M substitution) was expressed (Supplementary Fig. 4). By contrast, krt78.3 and krt78.4 were upregulated in the absence of Hoxc13, suggesting that an alternative keratinization program is activated in clawless HI toes (Supplementary Fig. 4). Collectively, these data demonstrate that Hoxc13 is essential for the expression of hair keratin homologs and the development of claws in western clawed frog, X. tropicalis.

The expression of hoxc13 and hair keratin homologs is conserved in the axolotl

As orthologs of krt34 and krt59 are also present in salamanders (Fig. 1), we investigated their expression pattern in the axolotl. Although the axolotl lacks claws, its toe tips are covered by a brownish cornified cell layer (Fig. 5a–d). RT-PCR analysis of keratins showed that hoxc13 and the hair keratin orthologs, krt34 and krt59, are expressed in the toes but not in the skin of the belly, whereas other epithelial keratins are expressed independently of Hoxc13 at both body sites (Fig. 5e). mRNA in situ hybridization demonstrated expression of krt34 in the epithelium of the toe tips of the axolotl (Fig. 5f). These data show that the expression of hoxc13 and homologs of hair keratins is conserved in the toe tips of representative species of anurans and salamanders. Together with the confirmation that hoxc13 and homologs of hair keratins are also expressed in the clawed toes of green anole lizards (Supplementary Fig. 5) and the well-established co-expression of hoxc13 and hair keratins in nails of mammals, these data lead us to conclude that the expression of hoxc13 and homologs of hair keratins in toe tips was inherited from a common ancestor of tetrapods (Fig. 6).

**Fig. 5: Hoxc13 and hair keratin homologs are expressed at the toe tips of the axolotl.**

**Fig. 6: Model for the evolutionary origin of Hoxc13 and hair keratin-dependent cornified skin appendages.**

Discussion

This study reveals an unexpected conservation of the molecular composition and transcriptional regulation of cornified skin appendages in frogs and humans, and suggests a scenario for the evolution of hair. In contrast to the previously held assumption that claws of clawed frogs and claws of amniotes have evolved independently¹¹, the present study indicates that they are homologous. Claws of Xenopus form by the accumulation of layers of cornified keratinocytes whereas keratinocytes in the claws of amniotes lack this organization^11,12. Unexpectedly, we found a single layer of cornified pigmented keratinocytes also on the toe tips of the axolotl, suggesting the existence of a similar mode of keratinocyte differentiation, but without thickening of the cornified layer. Conservation of Hoxc13 and keratin expression indicate that the cornified epithelium of axolotl toes is homologous to claws. Our data show that Hoxc13 is essential for the expression of homologs of both type I and type II hair keratins in Xenopus claws, which is equivalent to the critical role of Hoxc13 in controlling the expression of hair keratins in human nails and hair¹⁵. The conservation of critical genes indicates that claws of amphibians, claws of amniotes and hair of mammals have evolved from a common ancestral skin structure.

We propose the following scenario for the evolution of claws and hair (Fig. 6). Hoxc13 was present in the last common ancestor of all jawed vertebrates with a primordial function in regulating the development of the tail fin. In the last common ancestor of lungfish and tetrapods, expression of Hoxc13 appeared, together with other distal genes of Hox gene clusters²⁸, in paired fins²⁴. The latter evolved into limbs of tetrapods and, accordingly, Hoxc13 was expressed in the distal phalanges of primitive tetrapods. At this stage of evolution, the promoters of a subset of keratin genes acquired Hoxc13 binding sites, thereby facilitating the specific expression of these keratins on toes. This expression pattern of specialized keratins allowed the adaptive evolution of epithelial structures for toe-associated functions, such as the protection against mechanical stress, the support of locomotion as provided also by adhesive toe pads of modern tree frogs, or the capture of prey as facilitated by claws of several species of amniotes. The original function of the primordial “hair keratins” as “toe keratins” is conserved in toe pads of tree frogs¹⁰, toe tips of the axolotl (this study), claws of clawed frogs (this study), claws of lizards⁶ and nails of humans¹⁵. As part of a complex evolutionary transition that is not yet understood, the evolution of Hoxc13 expression at other sites of the integument, besides toes, redirected the expression of the Hoxc13-dependent toe keratins and contributed to the evolutionary innovation of hair shafts in which the primordial toe keratins became the main structural components, i.e. hair keratins.

This scenario is simplified by focusing on the evolution of hair keratins and their regulation by Hoxc13. A more comprehensive model for the evolution cornified skin appendages will need to address other important aspects, such as epithelial-mesenchymal signaling and morphogenesis^1,2,29. For example, sonic hedgehog (Shh) is implicated in the evolution of skin appendages and plays a critical role in the morphogenesis of hair follicles^30,31,32. Interestingly, the inhibition of Shh signaling in late stages of limb development allows the formation of claws on digits IV and V (HO toes) of Xenopus tropicalis³³. The effects of Shh signaling on the expression of hair and claw keratins are likely indirect, whereas experimental data obtained in cultured cells indicate that Hoxc13 directly regulates the expression of human hair keratins¹⁴ and Xenopus claw keratins (Fig. 3h, i). However, additional indirect effects of Hoxc13 on keratin genes are possible in vivo. While the regulation of hair keratin homologs by Hoxc13 appears to have evolved in stem tetrapods, the high content of cysteine residues in hair keratins^6,34 is not shared by their orthologs in amphibians⁹, suggesting that the initial evolution of keratin gene regulation preceded the evolution of cysteine-dependent crosslinking of hair keratin homologs. The scenario for the evolution of claws and hair (Fig. 6) does not imply that Hoxc13 and hair keratins were involved in the evolution of all types of cornified skin appendages. In particular, the molecular architecture of feathers, which involves sauropsid-specific cysteine-rich keratins, beta-keratins (also known as corneous beta proteins) and other epidermal differentiation proteins^9,35, has likely evolved independently from claws and hair^9,36, and the role of Hoxc13 in the control of feather keratins is not known.

The evolutionary model depicted in Fig. 6 suggests further directions of research. For example, the mechanism of the shift of Hoxc13 expression from toes to newly evolving hair follicles at other body sites is currently unknown. This evolutionary transition has probably involved intermediate stages, such as hair fibers as organs of tactile sensation³⁷ or filiform papillae of the tongue³⁸. In line with these hypotheses, Hoxc13 is expressed in both vibrissae and lingual filiform papillae of the mouse¹⁷. At the genetic level, mammal-specific enhancer elements of the Hoxc13 gene have contributed to evolutionarily important changes of expression²⁵. The roles of other protein components besides hair keratins and the roles of other regulatory factors besides Hoxc13 remain to be integrated into the scenario for the evolution of hair and nails.

The evolution of Hoxc13 from a regulator of toes to a regulator of toe keratins links the evolution of body appendages to the evolution of skin appendages in tetrapods. Furthermore, the primordial function of Hoxc13 in embryonic development evolved into a new function in cell differentiation within an adult tissue. Skin appendages, such as claws, nails and hair are regenerating throughout life to compensate for abrasion and damage caused by the direct contact to the environment. Thus, the cooption of a regulator of development has contributed to the evolution of tissue regeneration in the adult organism.

Methods

Animals

Xenopus tropicalis animals were kept at 25–27 °C in an aquatic system on a biofilter. All experiments on X. tropicalis were executed in accordance with the guidelines and regulations of Ghent University, Faculty of Sciences, Ghent, Belgium. Approval of the project was obtained by the Ethical Committee for Animal Experimentation, Ghent University, Faculty of Sciences (approval number EC2023-041). Additionally, X. tropicalis frogs were purchased from Interaquaristik.de Shop (Biedenkopf-Breidenstein, Germany). These animals were killed and tissues were sampled in accordance with the guidelines of the Ethics Committee of the Medical University of Vienna. Both male and female animals were investigated. Axolotls were generously provided by Elly Tanaka, Research Institute of Molecular Pathology (IMP), Vienna, Austria. cDNA from two adult individuals of Anolis carolinensis was prepared in a previous study⁶.

Generation of hoxc13 ^−/− frogs

A sgRNA targeting a site in the X. tropicalis hoxc13 coding sequence upstream of the homeodomain (GenBank accession number NC_030678.2, nucleotides 146200810-146200832) was designed using CRISPRScan (https://www.crisprscan.org/) and Indelphi (https://indelphi.giffordlab.mit.edu/) algorithms. The sgRNA was synthetized as previously described²⁷.

Natural matings were set up as described previously²⁷. Embryos were collected and de-jellied in 2% L-cysteine (catalog number: CALB243005-1, Calbiochem) in 0.1x Marc’s Modified Ringer Solution (MMR) adjusted to pH 8.0 (10x MMR stock: 1 M NaCl, 20 mM KCl, 20 mM CaCl₂, 10 mM MgCl₂, 50 mM HEPES, pH 7.8), washed and submerged in 0.1X MMR/6% Ficoll (catalog number: F8016, Sigma-Aldrich). Two-cell stage embryos were bilaterally injected with 1 nl of a mix of sgRNA and recombinant NLS-Cas9-NLS (VIB Protein Service Facility, UGent) to generate mutant mosaic F0 offspring. The editing efficiency was determined by deep amplicon sequencing of DNA extracted from embryos after injection as described previously³⁹. The F1 generation was obtained via subsequent breeding of the mosaic F0 founders. Genotyping was done by either high-resolution melting analysis (HRMA) analysis as previously described⁴⁰ and/or Sanger sequencing by Mix2Seq (Eurofins Genomics). All genotyping was validated by targeted amplicon sequencing and BATCH-GE analysis⁴¹ or CRISPResso2 analysis (version: 2.2.1)⁴². Primers for HRMA analysis were HRMAF1hoxc13v1, 5′-CTAGTGCCATTGGGTCTCAC-3′; HRMAR1hoxc13v1, 5′-AGAGCCTGCAGCCGTAATAG-3′; HRMAF2hoxc13v1, 5′-CACGGACATTACCTCTCCAG-3′; HRMAR2hoxc13v1, 5′-AGTTGACGTTGTGGGACTGA-3′; HRMAF1hoxc13v2, 5′-AGTAGTGCCAGGCATCAGC-3′; HRMAR1hoxc13v2, 5′-GGATTGGTCCTTTGAGCAGT-3′. To determine the genotype of toes in F0 mosaic mutant frogs, hoxc13 was amplified from cDNA preparations using the primers HRMAF1hoxc13v1 and HRMAR1hoxc13v1. The products were ligated into a pGEM-T Easy vector (catalog number: A1380, Promega) which was amplified in E. coli (catalog number: L2001, Promega). Using the same primers, hoxc13 was also amplified from toe cDNAs of wildtype frogs and frogs carrying two hoxc13 KO alleles. PCR products and inserts of plasmids were subjected to Sanger sequencing (Microsynth). Frogs containing two alleles with out-of-frame mutations, leading to premature termination of the coding sequence upstream of the homeodomain-encoding region were designated as hoxc13 knockout frogs. Wildtype frogs, heterozygous frogs containing one wildtype and one out-of-frame allele of hoxc13, and frogs containing two alleles with in-frame deletions were investigated as controls.

Tissue sampling and fixation

Adult X. tropicalis frogs were euthanized with 0.15% benzocaine (catalog number: 94-09-7, Sigma-Aldrich). Hindlimbs were examined before tissue sampling and images were taken with a Zeiss Lumar V12 stereoscope and a Zeiss AxioCam MRc. Tissue for RNA extraction was dissected and placed immediately in RNAlater (catalog number: AM7020, Invitrogen). Tissue for histological analysis was incubated in 7.5% neutral-buffered formalin (NBF) (catalog number: 18727.00500, Morphisto) overnight. Formalin-fixed toes were decalcified by incubation in a solution containing 5% formic acid (catalog number: 695076, Honeywell-Fluka) and 0.2 M EDTA, adujusted to pH 8.0 with sodium hydroxide, for three days. Afterwards samples were washed intensively with water and incubated in 5% sodium sulfate to neutralize the samples. Samples were further washed for one day in water and subsequently treated with 10% thioglycolate in 7.5% NBF for two days, followed by a last washing step with water and dehydration. The samples were embedded in paraffin and stored for further analysis.

Histology

Sections of formalin-fixed tissues were prepared with a Microm HM 335E microtome at a thickness of 5 µm and collected in a water bath set to 42 °C. The sections were subjected to hematoxylin and eosin (H&E) staining and photographed with an Olympus BX63 light microscope equipped with a UC-90 camera and the software cellSense Dimension (version: 2.3.18987.0).

Preparation of riboprobes

Riboprobe templates that anneal at the end of the coding region and the 3’-untranslated regions of X. tropicalis hoxc13 and krt34 were amplified by RT-PCR from HI toe cDNA. The PCR products were ligated into a pGEM-T Easy vector (catalog number: A1380, Promega) and plasmids containing the correct insert were amplified in E. coli (catalog number: L2001, Promega). T7 RNA polymerase was used for in vitro transcription of the riboprobes. Detailed information is provided in the Supplementary Methods.

In situ hybridization

mRNA in situ hybridization was performed on tissue sections of formalin-fixed paraffin-embedded HI toes. The samples were incubated with antisense probes that targeted either hoxc13 or krt34. The corresponding sense probes were used as negative controls. Detailed information is provided in the Supplementary Methods.

RNA isolation and quantitative RT-PCR

RNA was isolated from tissues using Trizol (catalog number: 30-2010, VWR) and a Precellys homogenizer (VWR) following the instructions of the manufacturer. The RNA was reverse-transcribed with the qScript® cDNA synthesis kit (catalog number: 95047-025, Quantabio). cDNAs from X. tropicalis tissues were subjected to real-time PCR with primers (Microsynth) specific for krt34 (forward: 5′-GTTACGGCGGTCAACTTTCC-3′ and reverse: 5′-CAAGGCAATCAGGCGAAGTT-3′), krt59 (forward: 5′-CTGCTAGAAGGGGAGGAAGG-3′ and reverse: 5′-TGTTTCATCCTCAGGCTCCA-3′), krt53 (forward: 5′-GCTGGATAAACTAGGGGCCA-3′ and reverse: 5′-AGAAGTCAACGATCCCTGGA-3′), and eef1a1 (forward: 5′-CTGAAGTCTGGTGATGCTGC-3′ and reverse: 5′-GGAGCTGGCAAAGTCACAAA-3′). Amplifications were performed on a Light Cycler® 480 II (Roche) and involved initial denaturation at 95 °C for 10 min and 50 cycles of 95 °C for 10 s, 60 °C for 10 s and 72 °C for 15 seconds with a ramp rate of 2.2 °C per second. Quantities of target mRNAs relative to transcripts of the housekeeping gene, eef1a1⁴³, were calculated according to a published model⁴⁴. Axolotl cDNAs were subjected to PCRs with primer pairs that anneal to hoxc13 (forward: 5′-GGACGGACAGGTCTACTGC-3′ and reverse: 5′-GGAGCTGGAGAAGGAGTACG-3′), krt34 (forward: 5′-AACCAGATCCAGGGCTTGAT-3′ and reverse: 5′-TTCCGGAGGCAAAGATGTCT-3′), krt59 (forward: 5′-AAGCTGGGTCTGGACATTGA-3′ and reverse: 5′-GCGGAAGCAGATTTAGCACA-3′), krt-T1-3 (forward: 5′-AAGATCCGAGACTGGTACCA-3′ and reverse: 5′-GAGAATGAGCTGGCCATGTG-3′), krt78L2 (forward: 5′-GATTGCCGACACCTCTGTTG-3′ and reverse: 5′-ACTGAACCGCATGATCCAGA-3′), eef1a1 (forward: 5′-TGCTCACATCGCTTGCAAAT-3′ and reverse: 5′-TGCGTGACATGAGACAGACT-3′). cDNAs of the green anole lizard (Anolis carolinensis)⁶ were subjected to PCR with primers specific for hoxc13 (forward: 5′-CTTTGCCAGCTCCTACCAAG-3′ and reverse: 5′-AAGTGAGCAGCTACCGTAGG-3′), krt36L/HA1 (forward: 5′-AATAAGGTCCTGGATGAGATG-3′ and reverse: 5′-CTGATCAGCAATGTAGAGGCC-3′), krt84L/HB1 (forward: 5′-CTCTCAAAGATGCCAAGTGC-3′ and reverse: 5′-TGTGATCCCGATCCTTGCATT-3′)⁶, and eef1a1 (forward: 5′-TTGCCACACTGCCCATATTG-3′ and reverse: 5′-AGGCAGTTGACAAGAAAGCG-3′).

Analysis of proteins

Tissue samples for proteomic analysis were dissected freshly and placed immediately in 200 µl lysis buffer, which consisted of 30 mM Tris, 7 M urea (catalog number: 0568, VWR), 2 M thiourea (catalog number: T7875, Sigma-Aldrich), 4% CHAPSO (catalog number: 28304, Pierce) and 0.2 M dithiothreitol (DTT). After incubation at 70 °C for 3 h the samples were homogenized with a homogenizer (Precellys, VWR) and centrifuged at 18,000 g for 15 min at 4 °C. The supernatant was collected and processed for mass spectrometry-based proteomics as described in the Supplementary Methods.

Hoxc13 binding site prediction

Potential Hoxc13 binding sites in the krt34 and krt59 promoter regions were identified using the Scan tool at the JASPAR website (https://jaspar.genereg.net/, last visited on 22.05.2023) with a relative profile score threshold of 70%. The search for Hoxc13 binding sites was narrowed down by searching specifically for the sequences matching the consensus Hoxc13 binding motif that was defined and validated in human hair keratin promoters¹⁴. Two sites of the krt34 promoter (see the Methods section “Construction of vectors for the promoter activation assay”) and one site of the krt59 promoter (see the Methods section “Construction of vectors for the promoter activation assay”) were selected for testing in a promoter activation assay (see below). Note that some of the potential Hoxc13 binding sites identified by JASPAR were not altered in the mutated reporter plasmids.

Construction of vectors for promoter activation assays

The complete coding sequence of X. tropicalis hoxc13 (GenBank accession number XM_002936645.5, nucleotides 78-998), flanked by the sequence TGTAAAACGACGGCCAGTGGATCCGCCACC on the 5′-side and TCTAGAGGTCATAGCTGTTTCCTG on the 3′-side, was synthesized as G-block DNA fragment (Integrated DNA Technologies, IDT). This fragment was amplified using M13 primers (forward: 5′-TGTAAAACGACGGCCAGT-3′ and reverse: 5′-CAGGAAACAGCTATGACC-3′) and cloned at BamHI and XbaI restriction sites in the pCS2+ plasmid⁴⁵. The correct sequence of the construct was verified by whole plasmid sequencing (Plasmidsaurus).

For the generation of reporter plasmids, G-blocks (IDT) containing wild-type and mutated proximal promoter regions of X. tropicalis krt34 and krt59 (Supplementary Fig. 6) were inserted into pGL4.10[luc2], linearized by digestion with XhoI and EcoRV, using the Genbuilder® cloning kit (Genscript) according to manufacturer’s instructions. The sequences of the constructs were verified by Sanger sequencing after amplification with the primers 5′-gaatcgatagtactaacatacgctctc-3′ and 5′-GATCTGGTTGCCGAAGATGGG-3′. All plasmids generated in this study were deposited in the BCCM/GeneCorner Plasmid Collection, Ghent University, Ghent, Belgium.

Transient transfection and luciferase reporter-based promoter activation assays

HEK293T cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, Waltham, MA, USA), supplemented with 10% fetal calf serum. HEK293T cells were seeded at a density of 4 × 10⁴ cells in 24-well plates and transfected with a plasmid DNA mix (1000 ng total DNA per well) using the calcium phosphate method. The plasmid DNA mix consisted of 200 ng pGL4.10[luc2]-Krt[x] (with x one of the keratin promoter constructs), 200 ng of either pCS2+XtHoxc13 or the empty pCS2+ vector, 100 ng PB-RL2(PYL9) and 500 ng pCS2+. PB-RL2(PYL9) encoding Renilla luciferase was co-transfected as an internal control. Six hours after transfection, the medium was replaced by fresh medium and the transfected cells were maintained in culture overnight.

The krt-promoter luciferase assays were performed using the Dual-Luciferase® Reporter Assay System (Promega) according to manufacturer’s guidelines. The transfected HEK293T cells were lysed in passive lysis buffer 24 h post transfection, 50 µL LARII was added to 20 µL lysate and firefly luminescence signals were measured. Afterwards 50 µL Stop&Glo® mix was added, and Renilla luminescence signals were again measured for standardization. All luminescence signals were measured using the GloMax 96 microplate luminometer (Promega).

Molecular phylogenetics

Keratin sequences were collected from sequence databases listed in Supplementary Tables 1 and 2. Multiple sequence alignments of the intermediate filament rod domains were created with aliview⁴⁶ (Source Data file). Prottest (version 3.0)^47,48 was used to calculate the amino acid substitution model. All available matrices and models with rate variation among sites were included. The Akaike information criterion was used to assess the likelihood of the predicted models⁴⁹. The best suited amino acid substitution model for the phylogeny was LG⁵⁰. Maximum likelihood tree and bootstrap analysis was done using PhyML (Version 20120412). Tree topology, branch length, and rate parameters were optimized according to a published protocol⁵¹. Phylogenetic trees were visualized with FigTree (version: 1.4.3; http://tree.bio.ed.ac.uk/software/figtree/, last accessed on 2 June 2023) and edited with Inkscape (version: 1.0.0.0; https://inkscape.org/de/, accessed on 2 June 2023).

RNA-seq

RNA was extracted from HI toes of two wildtype frogs and two hoxc13-KO frogs and separately from HI toes of genetically distinct hindlimbs of a mosaic mutant frog. In one leg of the mosaic mutant Hoxc13 R80M, considered equivalent to WT, was expressed, whereas expression of Hoxc13 was abrogated by frame-shift mutations in both hoxc13 alleles in the other leg (Supplementary Fig. 3). The RNA was subjected to RNA-seq analysis according to a published protocol⁵² with modifications. The detailed experimental procedure and the differential gene expression analysis is documented in the supplement.

Statistics

For the comparison of gene expression levels in 3 wildtype tissues, samples from 4 X. tropicalis frogs were investigated (Fig. 2c–e). Protein abundance in tissues (Fig. 2f–h) was determined by MS-based proteomics in samples from 3 frogs for each tissue. Statistical significance of differences was tested by one-way ANOVA using GraphPad Prism 8 (version 8.0.1) (Fig. 2c–h). For the comparison of gene expression levels in HI toes of wildtype and hoxc13 knockout frogs, 4 samples per genotype were investigated (Fig. 4h, i), and the statistical significance of differences was tested by an unpaired two-tailed t-test using GraphPad Prism 8 (version 8.0.1). The luciferase reporter assay (Fig. 3f, g) was repeated four times with three technical replicates each. The statistical significance of differences was determined by one-way ANOVA.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The mass spectrometry-based proteomic data generated in this study have been deposited into the ProteomeXchange Consortium via the PRIDE⁵³ partner repository (https://www.ebi.ac.uk/pride/) under accession code PXD041765. The RNA-seq data generated in this study have been deposited on NCBI under accession code PRJNA1055414. Accession codes/sources for publicly available original sequence data used in this study are provided in the Supplementary Information. All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Unique biological materials that support the findings of this study are readily available from the corresponding authors upon request. The multiple sequence alignments for phylogeny generated in this study are provided in the Source Data file. The X. tropicalis reference genome UCB_Xtro_10.0 used as reference database for the RNA-seq analysis is available on NCBI under accession number GCA_000004195.4. Source data are provided with this paper.

References

Wu, P. et al. Evo Devo of amniote integuments and appendages. Int. J. Dev. Biol. 48, 249–270 (2004).
Article CAS PubMed PubMed Central Google Scholar
Wagner, G. P. “Homology, Genes and Evolutionary Innovation” (Princeton University Press, Princeton, NJ, 2014).
Matsui, T. & Amagai, M. Dissecting the formation, structure and barrier function of the stratum corneum. Int. Immunol. 27, 269–280 (2015).
Article CAS PubMed Google Scholar
Langbein, L. & Schweizer, J. Keratins of the human hair follicle. Int. Rev. Cytol. 243, 1–78 (2005).
Article CAS PubMed Google Scholar
Eckhart, L. & Ehrlich, F. Evolution of trichocyte keratins. Adv. Exp. Med. Biol. 1054, 33–45 (2018).
Article CAS PubMed Google Scholar
Eckhart, L. et al. Identification of reptilian genes encoding hair keratin-like proteins suggests a new scenario for the evolutionary origin of hair. Proc. Natl. Acad. Sci. USA. 105, 18419–18423 (2008).
Article ADS CAS PubMed PubMed Central Google Scholar
Vandebergh, W. & Bossuyt, F. Radiation and functional diversification of alpha keratins during early vertebrate evolution. Mol. Biol. Evol. 29, 995–1004 (2012).
Article CAS PubMed Google Scholar
Suzuki, K. T. et al. Clustered Xenopus keratin genes: a genomic, transcriptomic, and proteomic analysis. Dev. Biol. 426, 384–392 (2017).
Article CAS PubMed Google Scholar
Ehrlich, F., Lachner, J., Hermann, M., Tschachler, E. & Eckhart, L. Convergent evolution of cysteine-rich keratins in hard skin appendages of terrestrial vertebrates. Mol. Biol. Evol. 37, 982–993 (2020).
Article CAS PubMed Google Scholar
Vandebergh, W., Maex, M., Bossuyt, F. & Van Bocxlaer, I. Recurrent functional divergence of early tetrapod keratins in amphibian toe pads and mammalian hair. Biol. Lett. 9, 20130051 (2013).
Article PubMed PubMed Central Google Scholar
Maddin, H. C., Eckhart, L., Jaeger, K., Russell, A. P. & Ghannadan, M. The anatomy and development of the claws of Xenopus laevis (Lissamphibia: Anura) reveal alternate pathways of structural evolution in the integument of tetrapods. J. Anat. 214, 607–619 (2009).
Article PubMed PubMed Central Google Scholar
Maddin, H. C., Musat-Marcu, S. & Reisz, R. R. Histological microstructure of the claws of the African clawed frog, Xenopus laevis (Anura: Pipidae): implications for the evolution of claws in tetrapods. J. Exp. Zool. B. Mol. Dev. Evol. 308, 259–268 (2007).
Article PubMed Google Scholar
Shim, J. et al. Comparative spatial transcriptomic and single-cell analyses of human nail units and hair follicles show transcriptional similarities between the onychodermis and follicular dermal papilla. J. Invest. Dermatol. 142, 3146–3157 (2022).
Article CAS PubMed Google Scholar
Jave-Suarez, L. F., Winter, H., Langbein, L., Rogers, M. A. & Schweizer, J. HOXC13 is involved in the regulation of human hair keratin gene expression. J. Biol. Chem. 277, 3718–3726 (2002).
Article CAS PubMed Google Scholar
Lin, Z. et al. Loss-of-function mutations in HOXC13 cause pure hair and nail ectodermal dysplasia. Am. J. Hum. Genet. 91, 906–911 (2012).
Article CAS PubMed PubMed Central Google Scholar
Farooq, M. et al. A homozygous frameshift mutation in the HOXC13 gene underlies pure hair and nail ectodermal dysplasia in a Syrian family. Hum. Mutat. 34, 578–581 (2013).
CAS PubMed Google Scholar
Godwin, A. R. & Capecchi, M. R. Hoxc13 mutant mice lack external hair. Genes Dev. 12, 11–20 (1998).
Article CAS PubMed PubMed Central Google Scholar
Han, K. et al. Generation of Hoxc13 knockout pigs recapitulates human ectodermal dysplasia-9. Hum. Mol. Genet. 26, 184–191 (2017).
CAS PubMed Google Scholar
Deng, J. et al. The disrupted balance between hair follicles and sebaceous glands in Hoxc13-ablated rabbits. FASEB J. 33, 1226–1234 (2019).
Article CAS PubMed Google Scholar
Kmita, M. & Duboule, D. Organizing axes in time and space; 25 years of colinear tinkering. Science. 301, 331–333 (2003).
Article ADS CAS PubMed Google Scholar
Schneider, I. et al. Appendage expression driven by the Hoxd global control region is an ancient gnathostome feature. Proc. Natl. Acad. Sci. USA. 108, 12782–12786 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Duboule, D. Vertebrate hox gene regulation: clustering and/or colinearity? Curr. Opin. Genet. Dev. 8, 514–518 (1998).
Article CAS PubMed Google Scholar
Thummel, R., Li, L., Tanase, C., Sarras, M. P. Jr & Godwin, A. R. Differences in expression pattern and function between zebrafish hoxc13 orthologs: recruitment of Hoxc13b into an early embryonic role. Dev. Biol. 274, 318–33 (2004).
Article CAS PubMed Google Scholar
Meyer, A. et al. Giant lungfish genome elucidates the conquest of land by vertebrates. Nature 590, 284–289 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Fernandez-Guerrero, M. et al. Mammalian-specific ectodermal enhancers control the expression of Hoxc genes in developing nails and hair follicles. Proc. Natl. Acad. Sci. USA. 117, 30509–30519 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Dalla Valle, L. et al. Deleterious mutations of a claw keratin in multiple taxa of reptiles. J. Mol. Evol. 72, 265–273 (2011).
Article ADS CAS PubMed Google Scholar
Naert, T. et al. CRISPR/Cas9 mediated knockout of rb1 and rbl1 leads to rapid and penetrant retinoblastoma development in Xenopus tropicalis. Sci. Rep. 6, 35264 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Woltering, J. M. et al. Sarcopterygian fin ontogeny elucidates the origin of hands with digits. Sci. Adv. 6, eabc3510 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Dhouailly, D. A new scenario for the evolutionary origin of hair, feather, and avian scales. J. Anat. 214, 587–606 (2009).
Article PubMed PubMed Central Google Scholar
Chuong, C. M., Patel, N., Lin, J., Jung, H. S. & Widelitz, R. B. Sonic hedgehog signaling pathway in vertebrate epithelial appendage morphogenesis: perspectives in development and evolution. Cell. Mol. Life Sci. 57, 1672–1681 (2000).
Article CAS PubMed PubMed Central Google Scholar
Cooper, R. L. & Milinkovitch, M. C. Transient agonism of the sonic hedgehog pathway triggers a permanent transition of skin appendage fate in the chicken embryo. Sci. Adv. 9, eadg9619 (2023).
Article CAS PubMed PubMed Central Google Scholar
Lee, J. & Tumbar, T. Hairy tale of signaling in hair follicle development and cycling. Semin. Cell. Dev. Biol. 23, 906–916 (2012).
Article CAS PubMed PubMed Central Google Scholar
Stopper, G. F., Richards-Hrdlicka, K. L. & Wagner, G. P. Hedgehog inhibition causes complete loss of limb outgrowth and transformation of digit identity in Xenopus tropicalis. J. Exp. Zool. B Mol. Dev. Evol. 326, 110–124 (2016).
Article CAS PubMed Google Scholar
Strnad, P. et al. Unique amino acid signatures that are evolutionarily conserved distinguish simple-type, epidermal and hair keratins. J. Cell Sci. 124, 4221–4232 (2011).
Article CAS PubMed PubMed Central Google Scholar
Strasser, B. et al. Evolutionary origin and diversification of epidermal barrier proteins in amniotes. Mol. Biol. Evol. 31, 3194–3205 (2014).
Article CAS PubMed PubMed Central Google Scholar
Sawyer, R. H. & Knapp, L. W. Avian skin development and the evolutionary origin of feathers. J. Exp. Zool. B. Mol. Dev. Evol. 298, 57–72 (2003).
Article PubMed Google Scholar
Maderson, P. F. A. When? Why? and How? Some speculations on the evolution of the vertebrate integument. Am. Zool. 12, 159–171 (1972).
Article Google Scholar
Elias, H. & Bortner, S. On the phylogeny of hair. Am. Mus. Nat. Hist. Novitates. 1820, 1–15 (1957). Available online: http://hdl.handle.net/2246/4703 (accessed on 15 June 2023).
Naert, T. & Vleminckx, K. Methods for CRISPR/Cas9 Xenopus tropicalis tissue-specific Multiplex genome engineering. Methods Mol. Biol. 1865, 33–54 (2018).
Article CAS PubMed Google Scholar
Naert, T. & Vleminckx, K. Genotyping of CRISPR/Cas9 genome edited Xenopus tropicalis. Methods Mol. Biol. 1865, 67–82 (2018).
Article CAS PubMed Google Scholar
Boel, A. et al. BATCH-GE: batch analysis of next-generation sequencing data for genome editing assessment. Sci. Rep. 6, 30330 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Clement, K. et al. CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat. Biotechnol. 37, 224–226 (2019).
Article CAS PubMed PubMed Central Google Scholar
Mlitz, V., Hussain, T., Tschachler, E. & Eckhart, L. Filaggrin has evolved from an “S100 fused-type protein” (SFTP) gene present in a common ancestor of amphibians and mammals. Exp. Dermatol. 26, 955–957 (2017).
Article CAS PubMed Google Scholar
Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45 (2001).
Article CAS PubMed PubMed Central Google Scholar
Turner, D. L. & Weintraub, H. Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal cells to a neural fate. Genes Dev. 8, 1434–1437 (1994).
Article CAS PubMed Google Scholar
Larsson, A. AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 30, 3276–3278 (2014).
Article CAS PubMed PubMed Central Google Scholar
Abascal, F., Zardoya, R. & Posada, D. ProtTest: selection of best-fit models of protein evolution. Bioinformatics 21, 2104–2105 (2005).
Article CAS PubMed Google Scholar
Darriba, D., Taboada, G. L., Doallo, R. & Posada, D. ProtTest 3: fast selection of best-fit models of protein evolution. Bioinformatics 27, 1164–1165 (2011).
Article CAS PubMed Google Scholar
Akaike, H. Information theory and an extension of the maximum likelihood principle. in Selected Papers of Hirotugu Akaike (eds Parzen, E. et al.) 199–213 (Springer, 1998).
Le, S. Q. & Gascuel, O. An improved general amino acid replacement matrix. Mol. Biol. Evol. 25, 1307–1320 (2008).
Article CAS PubMed Google Scholar
Guindon, S. & Gascuel, O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704 (2003).
Article PubMed Google Scholar
Lachner, J. et al. An in vitro model of avian skin reveals evolutionarily conserved transcriptional regulation of epidermal barrier formation. J. Invest. Dermatol. 141, 2829–2837 (2021).
Article CAS PubMed Google Scholar
Perez-Riverol, Y. et al. The PRIDE database resources in 2022: a Hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 50, D543–D552 (2022).
Article CAS PubMed Google Scholar
Kumar, S. et al. TimeTree 5: an expanded resource for species divergence times. Mol. Biol. Evol. 39, msac174 (2022).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

This research was supported by the Core Facility Genomics of the Medical University of Vienna, a member of Vienna Life-Science Instruments (VLSI), and by the VetCore Facility (Proteomics) of the University of Veterinary Medicine Vienna. We thank Florian Gruber, Medical University of Vienna, for helpful discussions and Prof. Elly Tanaka, Research Institute of Molecular Pathology (IMP), Vienna BioCenter, for providing axolotls. This research was funded in part by the Austrian Science Fund (FWF): grant-DOI: 10.55776/P32777, grant-DOI: 10.55776/P36596 received by L.E. For open access purposes, the authors have applied a CC BY public copyright license to any author accepted manuscript version arising from this submission. M.C. received a PhD fellowship from the Research Foundation—Flanders (FWO-Vlaanderen). Research was supported by the Concerted Research Actions from Ghent University (BOF15/GOA/011 and BOF20/GOA/023) received by K.V. and E.D.B.

Author information

These authors contributed equally: Marjolein Carron, Attila Placido Sachslehner.

Authors and Affiliations

Department of Biomedical Molecular Biology, Ghent University, 9000, Ghent, Belgium
Marjolein Carron, Munevver Burcu Cicekdal, Inge Bruggeman, Suzan Demuynck, Wim Declercq & Kris Vleminckx
Department of Biomolecular Medicine, Ghent University and Center for Medical Genetics, Ghent University Hospital, 9000, Ghent, Belgium
Marjolein Carron, Munevver Burcu Cicekdal & Elfride De Baere
Department of Dermatology, Medical University of Vienna, 1090, Vienna, Austria
Attila Placido Sachslehner, Bahar Golabi, Erwin Tschachler & Leopold Eckhart
VIB-Ugent Center for Inflammation Research, 9000, Ghent, Belgium
Inge Bruggeman & Wim Declercq

Authors

Marjolein Carron
View author publications
You can also search for this author in PubMed Google Scholar
Attila Placido Sachslehner
View author publications
You can also search for this author in PubMed Google Scholar
Munevver Burcu Cicekdal
View author publications
You can also search for this author in PubMed Google Scholar
Inge Bruggeman
View author publications
You can also search for this author in PubMed Google Scholar
Suzan Demuynck
View author publications
You can also search for this author in PubMed Google Scholar
Bahar Golabi
View author publications
You can also search for this author in PubMed Google Scholar
Elfride De Baere
View author publications
You can also search for this author in PubMed Google Scholar
Wim Declercq
View author publications
You can also search for this author in PubMed Google Scholar
Erwin Tschachler
View author publications
You can also search for this author in PubMed Google Scholar
Kris Vleminckx
View author publications
You can also search for this author in PubMed Google Scholar
Leopold Eckhart
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

M.C., A.P.S., E.D.B., W.D., E.T., K.V. and L.E. designed research; A.P.S. and L.E. performed comparative genomics and molecular phylogenetic analyses; A.P.S. performed transcriptomic and proteomic; A.P.S. performed in situ hybridization; A.P.S. and B.G. performed histological analyses; A.P.S. and L.E. identified Hoxc13 binding motifs; M.C., I.B., W.D. and K.V. performed promoter activation assays; M.C., S.D. and K.V. generated and bred hoxc13 knockout frogs; M.C., M.B.C., I.B. and K.V. investigated the interaction of Hoxc13 with predicted binding sites; M.C., A.P.S., M.B.C., W.D., K.V. and L.E. analyzed data; and M.C., A.P.S., K.V. and L.E. wrote the first draft of the manuscript; all authors contributed to the revision of the manuscript; K.V. and L.E. supervised the study and share last-authorship.

Corresponding authors

Correspondence to Kris Vleminckx or Leopold Eckhart.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Marie Manceau and the other, anonymous, reviewers for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Reporting Summary

Peer Review File

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Carron, M., Sachslehner, A.P., Cicekdal, M.B. et al. Evolutionary origin of Hoxc13-dependent skin appendages in amphibians. Nat Commun 15, 2328 (2024). https://doi.org/10.1038/s41467-024-46373-x

Download citation

Received: 02 July 2023
Accepted: 26 February 2024
Published: 18 March 2024
DOI: https://doi.org/10.1038/s41467-024-46373-x

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.