Abstract
Primary familial brain calcification (PFBC) is characterized by calcium deposition in the brain, causing progressive movement disorders, psychiatric symptoms, and cognitive decline. PFBC is a heterogeneous disorder currently linked to variants in six different genes, but most patients remain genetically undiagnosed. Here, we identify biallelic NAA60 variants in ten individuals from seven families with autosomal recessive PFBC. The NAA60 variants lead to loss-of-function with lack of protein N-terminal (Nt)-acetylation activity. We show that the phosphate importer SLC20A2 is a substrate of NAA60 in vitro. In cells, loss of NAA60 caused reduced surface levels of SLC20A2 and a reduction in extracellular phosphate uptake. This study establishes NAA60 as a causal gene for PFBC, provides a possible biochemical explanation of its disease-causing mechanisms and underscores NAA60-mediated Nt-acetylation of transmembrane proteins as a fundamental process for healthy neurobiological functioning.
Similar content being viewed by others
Introduction
Primary familial brain calcification (PFBC), previously known as idiopathic basal ganglia calcification (IBGC) or Fahr’s disease, is a genetic condition characterized by calcium deposition in the brain, including the basal ganglia, usually presenting as a combination of movement disorders, psychiatric and cognitive impairment1,2. Population-based genomic analysis indicates that PFBC is underestimated and underdiagnosed3.
To date, pathogenic variants in four genes have been linked to autosomal dominant PFBC, with variants in SLC20A2 (OMIM: 158378)4 and XPR1 (OMIM: 605237)5 encoding phosphate transporters, PDGFB (OMIM: 190040)6 and PDGFRB (OMIM: 173410)7 encoding a growth factor and its main receptor with a critical role at the neurovascular unit. Among these, variants in SLC20A2 account for ~45% of all genetically confirmed PFBC cases from diverse ethnicities8. More recently, biallelic variants in MYORG (OMIM: 618255)9,10 and JAM2 (OMIM: 606870)11,12 have been implicated in the pathogenesis of autosomal recessive PFBC. Currently, ~50% of familial and sporadic cases remain unexplained13 after screening of all PFBC-related genes and other mitochondrial or interferonopathies genes that can present with brain calcifications, such as CMPK2 (OMIM: 611787)14 or ISG15 (OMIM: 616126)15.
NAA60 (NatF) catalyses N-terminal (Nt)-acetylation of several transmembrane proteins with a Met-hydrophobic or Met-amphipathic-type N-terminus16,17,18. NAA60 is unique among the N-terminal acetyltransferases (NATs) for its localization to the Golgi apparatus19, where it resides on the cytoplasmic face of the membrane16 through peripheral binding achieved by two α-helices located at the C-terminal end20. Knockdown of NAA60 results in disruption of the Golgi structure and a reduced Nt-acetylation level of several membrane proteins, most typically proteins with an N-IN topology16. Nevertheless, no studies have established the role that this NAT and its protein-modifying capacity play in membrane protein function and human physiology.
Results
Biallelic NAA60 variants lead to autosomal recessive PFBC
Aiming to identify novel pathogenic variants underlying PFBC, we first screened a cohort at UCL, comprising 78 cases from 53 families with PFBC who were negative for pathogenic variants in genes already linked to PFBC (SLC20A2, PDGFB, PDGFRβ, XPR1, MYORG, JAM2). Previous extensive metabolic and mitochondrial investigations in all families excluded acquired and inherited causes of brain calcifications. We identified NAA60 biallelic variants co-segregating with the disease in one family (F1) through a combination of whole-exome sequencing (WES) and homozygosity mapping. Then we screened for NAA60 variants in WES data from two French brain calcification series, the pan-European SolveRD21 project, unsolved rare disease cohorts from Turkey and Saudi Arabia. Finally, we screened the rare diseases cohort from the 100,000 Genomes Project22 that had whole-genome sequencing (WGS) performed and data filtered as per protocol22. As a result of this extensive screening, we found deleterious biallelic variants in NAA60 associated with PFBC in eight more patients from six unrelated families with autosomal recessive inheritance (F2-F7) (Fig. 1, Supplementary Fig. 1, and Table 1).
Homozygosity mapping was performed in F1-F4 (Supplementary Fig. 2). Variants were filtered by frequency (MAF < 0.001) and potential gene effects (splicing or coding, excluding non-splicing synonymous) and homozygosity coordinates, where available.
In F1, the NAA60 c.321_327del, p.(Arg108Thrfs*3) (NM_001083601) variant segregated with the disease under a fully penetrant autosomal recessive model (Fig. 1a, b and Supplementary Fig. 1). NAA60 c.321_327del is only present twice in the heterozygous state in gnomAD v2.1 and is absent in the homozygous state. The kinship coefficient between the siblings in F1, calculated using Peddy23, did not exceed the expected 0.5 value, and comparing the samples in Automap24 did not reveal a large number of shared runs of homozygosity to support close consanguinity. Although F2 and F3, recruited from France, were not known to be related, we identified the same homozygous truncating variant in NAA60 that fully segregated with the disease in all four affected relatives: NAA60, c.338-1 G > C (Fig. 1a, b and Supplementary Fig. 1). No evidence of close relatedness or shared haplotype blocks surrounding NAA60 was found in F2 and F3 (Supplementary Fig. 2), suggesting that this was a recurrent variant. In vitro RNA analysis of the F2 variant suggested that this splicing variant causes a deletion of 20 nucleotides, leading to a frameshift and premature stop codon (r.338_357del, p.(Gly113Valfs*32), Supplementary Fig. 3a–c)).
In F4, WGS performed as part of 100,000 Genomes Project, revealed the homozygous missense NAA60 variant c.391 C > T, p.(His131Tyr) in the proband, which was heterozygous in the parents (Fig. 1a and Supplementary Fig. 1). In F5, recruited from the Solve-RD project, trio WES revealed a homozygous missense NAA60 variant c.130 C > T, p.(Arg44Cys) in a proband with a developmental disorder, which was present in the heterozygous state in both unaffected parents (Fig. 1a and Supplementary Fig. 1). In F6, recruited from Turkey, and Family 7 recruited from Saudi Arabia, the homozygous c.50 T > G, (p.Leu17Arg) and c.428 A > C, (p.Asn143Thr) respectively were found in probands with brain calcifications and movement abnormalities (Fig. 1a and Supplementary Fig. 1). All these missense variants are absent in the homozygous state and absent or extremely rare in heterozygous state in gnomAD.
Detailed clinical descriptions can be found in Table 1, Supplementary Movie 1 and Supplementary Note 1. Six (out of 10) patients with adult-onset presented in the second and third decades of life, and the remaining four patients had onset in childhood. Those with childhood onset had associated features of global developmental delay affecting motor, learning, and language development. In the adult-onset group, the presenting features were heterogeneous, including unsteadiness (due to cerebellar ataxia and/or parkinsonism with pyramidal syndrome), seizures, and in one case (F1-II-2) acute psychosis. During the disease course, patients developed a combination of movement disorders and motor abnormalities: ataxia in 5/10 patients, parkinsonism in 4/10 patients, pyramidal syndrome in 5/10 patients, and dystonia in 2/10 patients. Half of the cases presenting with parkinsonism were treated with levodopa, which provided only mild benefit early in the disease. Four patients exhibited psychiatric features, including psychosis, severe depression/anxiety, or ADHD, and all cases had either intellectual disability (those with childhood-onset) or developed cognitive impairment (those with adult-onset). The development of cognitive features was observed as early as five years from disease onset, and although the anterior and subcortical functions were most severely affected, the involvement was global. Mild dysmorphic features were present in half of the patients, severe migraines in three cases, seizures in three cases, and tics and stereotypies in one case.
Most NAA60 patients showed extensive brain calcification on brain scans (Table 2) with an average total calcification score (TCS) of 51.75/80 [range 46–64] among Families 1, 2, and 3 carrying homozygous truncating variants. Symmetrical calcifications involved the basal ganglia, depth of multiple cortical sulci, supratentorial white matter, cerebellar hemispheres and vermis in all affected patients from Families 1–3 but also central pontine regions in 3 of the 7 patients with raw images available for the rating (Fig. 1b). The probands from F4, F6 and F7, carrying homozygous missense variants, exhibited smaller amounts of calcifications with bilateral lenticular calcifications (TCS of 5) at 19 years of age (in F4), bilateral hippocampal, left putamen, and periventricular white matter adjacent to the right frontal horn (TCS of 2 at age 12 years, not accounting for hippocampi, in F6) and symmetrical calcification in cerebral hemispheres, basal ganglia, depth of cortical sulci, and cerebellum (in F7). Patient from Family 7 had a CT angiography of the brain at the age 27 years old, which showed multifocal narrowing of the distal intracranial arteries with likely secondary intravascular calcium deposition in the absence of cardiovascular risk factors (Fig. 1b (VIIb)). No conclusive brain calcification imaging was present in the patient from F5 at the age of 12 years. Although calcifications are present in most adults carrying PFBC-causing variants2 the timing of when the first neuroimaging signs of calcifications can be identified is not clear. Despite extensive genetic analysis in this case, we cannot exclude any additional, yet unidentified genetic variants, potentially contributing to some of the magnetic resonance imaging (MRI) features in this case that were absent in the other cases reported here (microcephaly and polymicrogyria).
The in-silico prediction of all reported NAA60 variants is in Supplementary Table 1. NAA60 variants of Families 1, 2, and 3 cause large truncations in the NAA60 protein (Fig. 2a–c). These truncations omit half of the GNAT domain, which forms a recognizable tertiary structure common to all N-acetyltransferases, including NATs25, and are likely to severely affect the binding of both the substrate N-terminus and the acetyl donor acetyl-CoA. For the NAA60 missense variants p.His131Tyr (F4), p.Arg44Cys (F5), p.Leu17Arg (F6), and p.Asn143Thr (F7), sequence alignment of various species showed conservation of His131, Leu17, Asn143 and a somewhat conserved residue of Arg44 (Fig. 2a). Moreover, DynaMut predictions indicated that all reported missense variants have a similar degree of increased intramolecular stability and decreased molecule flexibility (Supplementary Fig. 4).
Our structural predictions showed that the sites affected in F4 and F5 are positioned on the NAA60 protein surface and do not directly contact Ac-CoA or the peptide substrate (Fig. 2d). However, in contrast to WT, NAA60 His131Tyr (F4) does not exhibit hydrogen binding to Ala128 but is rather predicted to interact with Asp92; NAA60 Arg44Cys (F5) shows the same interaction residues as WT, with an additional binding to Asp40, thus strengthening the intramolecular interaction and decreasing the flexibility of this protein variant (Fig. 2e). For the variant from F6, DynaMut prediction showed the Leu17Arg substitution remarkably affects several interacting forces with adjacent residues. While Leu17 shows diverse hydrophobic contacts with Leu55, Gly65, Phe53, and ionic and carbonyl contacts with Ser54, the Arg17 substitution only demonstrates an interacting force with Ser54 (Fig. 2e). The residue affected in F7, Asp143 is conserved in all presented orthologs (Fig. 2a). This is an area shown to be important for substrate-specific acetylation26. Due to large structural differences compared to Asn143, the Thr143 substitution in NAA60 F7 was predicted to have reduced interaction with several residues (Fig. 2e), including lost interactions with Thr142, Val139, and Thr145 as a result of the substitution, while interactions to Leu140, important for substrate recognition and homodimerization26, remained intact.
NAA60 variants lead to loss-of-function with lack of protein N-terminal-acetylation activity
The gene products of all NAA60 variants reported are shown in Fig. 3a. To assess whether the NAA60 variants alter the subcellular distribution and function of this N-alpha-acetyltransferase, we expressed constructs with sequences corresponding to those in affected cases. FLAG-NAA60-F1 was distributed in the cytosol and nucleus (Fig. 2b), like in previously investigated truncations20. Similar results were obtained for the other truncated variants (F2/F3), whereas the missense variants (F4, F5, F6, and F7) exhibited intact subcellular localization (Fig. 3b).
From the experiments in Fig. 3b, it became apparent that there were differences in the degree of expression among the NAA60 variants, with some producing a very low amount of protein, even from a CMV promoter. We hypothesized that this was due to degradation and therefore used the proteasomal inhibitor MG132. Indeed, the variants found in individuals from Families 1, 2, and 3, but not 4 and 5, were stabilized by the proteasomal inhibitor MG132 (Fig. 3c), indicating that these undergo rapid proteasomal degradation in cells.
For the families with available primary cells isolated, we assessed the endogenous NAA60 level using an NAA60 antibody. Primary lymphoblasts from the case in F7 and primary dermal fibroblasts from the two F1 cases and their heterozygous mother were tested alongside matched healthy controls. Noteworthy, the missense mutation Asn143Thr in F7 entailed a dramatically reduced, possibly absent, NAA60 protein (Fig. 3d).
Next, we assessed whether the NAA60 protein variants have the capacity to Nt-acetylate classic NAA60 substrate N-termini. When immunoprecipitated NAA60 variants were incubated with MAPL (Met-Ala-Pro-Leu-) substrate peptide and acetylation buffer mix, NAA60-F1 was completely unable to perform Nt-acetylation of this classical NAA60-type substrate (Fig. 3e). Similarly, albeit less striking, results were obtained for NAA60-F2/3, which appeared to demonstrate some biochemical activity in this pure in vitro assay. Nevertheless, given the cellular instability (Fig. 3c, d), cellular mislocalization (Fig. 3b), and the major GNAT fold truncations (Figs. 2 and 3a), these severely truncated proteins are unlikely to retain any NAT activity in vivo. The NAA60-F4 and -F5 also demonstrated diminished Nt-acetylation capacity in this assay (Fig. 3e). Overall, these results are consistent with the reduced N-terminal acetylation of NAA60 substrates as a cause of PFBC.
The microscopy in Fig. 3b indicated that NAA60 did not perfectly co-localize with the Golgi marker GM130. Therefore, we performed structured illumination microscopy and co-localization analysis, which revealed that FLAG-NAA60-WT was co-distributed with the cis-Golgi marker GM130, as it localized to structures closely associated to, but not completely overlapping with the structures stained by GM130, (Fig. 4a, and Supplementary Movie 2). This likely means that NAA60 prefers another sub-compartment of the Golgi. Nonetheless, we found that GM130 is a valid marker for investigating intact versus disturbed Golgi localization of NAA60 and for assessing Golgi morphology. Previously, using GM130 as a marker, it was shown that knockdown of NAA60 in HeLa cells results in a disruption of the Golgi ribbon architecture16. To determine whether the NAA60 frameshift variants reproduce this phenotype, we performed immunofluorescence microscopy of primary dermal fibroblasts from NAA60−/− cases from F1. However, the Golgi structure appeared intact in all cells from both affected and unaffected individuals (Fig. 4b). We reasoned that this discrepancy with previous findings could be due to cell type differences or that it could be explained by differential effects of knockdown vs knockout. We, therefore, investigated a CRISPR/Cas9-generated NAA60 knockout cell line harboring a frameshift variant at a position close to that of NAA60-PFBC in Families 1, 2 and 3 (Fig. 4c). Of note, these HAP1 NAA60−/− cells also showed an intact Golgi apparatus (Fig. 4d) where NAA80 knockout was used as a positive control for Golgi fragmentation in the HAP1 cell line27. We next extended this investigation by performing the same shRNA knockdown experiment as previously done in HeLa cells, but now in dermal fibroblasts from healthy controls. Here, we observed that NAA60-shRNA-transfected dermal fibroblast controls displayed fragmented Golgi (Fig. 4e), similar to the previous work in HeLa cells16. Thus, we found support for the idea that Golgi fragmentation occurs in RNA silencing experiments but not in cells with permanent NAA60 absence due to an early frameshift in the genomic DNA.
Loss of NAA60 function likely cause PFBC through a Pi homeostasis pathway
NAA60 likely has many substrates16 and all membrane proteins associated with PFBC may be considered potential NAA60 substrates: SLC20A2, XPR1, MYORG, JAM2, and PDGFRβ. Therefore, we tested the ability of NAA60 to Nt-acetylate peptides corresponding to the N-termini of these proteins in vitro (Fig. 5a). Among them, SLC20A2 was the best NAA60 substrate (Fig. 5b), while significant Nt-acetylation was also observed for the MYORG N-terminus. The N-terminus of SLC20A2 is a MAMDE. Since it is possible that this may exist in the iMet-processed variant, two versions of this peptide were tested. The peptide MAMD was again Nt-acetylated to the same degree as the classical NAA60 substrate MAPL, previously found to be acetylated by NAA60 both in cells and in vitro18. In contrast, the iMet-processed variant, AMDE, was not a good in vitro substrate of NAA60, performing similarly to the negative controls normally Nt-acetylated by other NATs in cells (Fig. 5c). Our data indicate that SLC20A2 (MAMD N-terminus) is a potential in vivo substrate of NAA60.
As SLC20A2 was found to be a possible substrate of NAA60, we investigated whether an impaired NAA60 variant affects the presence of SLC20A2 at the dedicated location at the plasma membrane (PM). We isolated PM proteins with surface biotinylation on primary patient fibroblasts obtained from homozygous F1 (Fig. 6a). This revealed a significantly decreased surface level of SLC20A2 in NAA60−/− cells from F1-II-1 and F1-II-2, while cells from a heterozygous carrier had similar surface levels to the unrelated control (Fig. 6b, c).
Next, we investigated whether the reduced surface level of SLC20A2 in cells from NAA60-related PFBC cases may be associated with defects in Pi transport across the cell membrane. We measured the concentration of extracellular Pi in the cell culture medium similar to in previous studies13 (Fig. 6d). Medium from NAA60 F1 cases contained significantly higher Pi levels than medium from age-matched controls and an SLC20A2 missense mutant case associated with impaired function (Fig. 6e). We assessed the cell capacity for Pi depletion and found that there was a lower expenditure of Pi in cell cultures from NAA60 mutant cases (7.9%) compared to SLC20A2 mutant cases (36.1%) and controls (43.3%) (Fig. 6e’). In addition, investigation of fresh peripheral blood mononuclear cells from an affected patient in F2 confirmed a similar effect on cellular Pi homeostasis (Fig. 6f, f’).
NAA60 and SLC20A2 co-expression networks
Given NAA60’s effect on the SLC20A2 surface level and the similar cellular phenotypes of NAA60 and SLC20A2 mutations, we next looked at the tissue distribution profiles of these two genes According to GTEx, both NAA60 and SLC20A are expressed in all tested human tissues, including brain (Figure S5a). We then created co-expression networks that include NAA60 and SLC20A2. This resulted in five co-expression modules containing SLC20A2 across the five brain regions and three modules containing NAA60. This revealed that within three of the regions (cerebellum, nucleus accumbens, and caudate), NAA60 and SLC20A2 genes are found within different modules in each tissue-specific network. However, for the nucleus accumbens network, these two modules are very close (Supplementary Fig. 5d–f). The grey60 module, containing SLC20A2 module was of particular interest as it was significantly enriched for genes associated with human phenotype (HP) terms like basal ganglia calcification, HP:0002135, (P < 3.34 × 10−4) and vascular system, with terms like abnormal vascular morphology (P < 2.97 × 10−5) HP:0025015, and abnormal cerebral vascular morphology, HP:0100659 (P < 2.656E-4). Specific cell marker enrichment analysis of the same module shows enrichment for endothelial (p < 2.945E-44), mural (p < 2.440E-16), and microglial cell markers (p < 8.023E-7). The blue module, which contains the NAA60, is enriched with genes associated with neurodevelopmental delay HP:0012758, (p < 8.90E-12), morphological central nervous system abnormality, HP:0002011 (p < 1.45E-09), abnormality of movement, HP:0100022 (p < 6.80E-07), and abnormal muscle tone, HP:0003808 (p < 4.64E-13). This module is clearly neuronal as it is exclusively and highly enriched with these cell markers (p < 5.72E-37) (Data File 1). Overall, these findings suggest that while the expression pathways of SLC20A2 and NAA60 are distinct, they are closely related, especially in the nucleus accumbens. Furthermore, this data places NAA60 within a network of genes involved in morphological brain structure and neurodevelopment in humans, particularly within the neurons from the caudate and nucleus accumbens of the basal ganglia (Fig. 6g, Supplementary Fig. 5), in keeping with the human NAA60-related phenotype.
Discussion
In this study, we show that biallelic variants in NAA60 lead to recessive PFBC in ten individuals from seven unrelated families. The patients with NAA60-related brain calcification displayed their first clinical signs starting from early childhood to early twenties. We report a variable combination of clinical features, including ataxia, parkinsonism, headache, psychiatric and cognitive deficits with a high intrafamilial phenotypic variability and age at onset. However, as the disease progresses, the phenotype becomes more uniform, with an association of cerebellar, pyramidal, and parkinsonian syndromes with poor response to levodopa, consistent with patients with variants in other PFBC-related genes, especially other autosomal recessive forms1. Of note, the missense variants, F4 and to some degree F5, appeared to result in less severely reduced NAA60 protein function in vitro than truncating, likely complete loss-of-function, high-unstable variants in F1 and F2/3. Interestingly, the proband from F4 exhibited only limited calcifications of both lenticular nuclei at age 19 years. Although this calcification pattern is clearly abnormal at this age28, it was less severe in intensity and in extension than F1 and F2/3, suggesting a putative genetic-radiological correlation. The proband in F5 did not show any calcifications on CT at the age of 12 years. The clinical presentation appeared to be more complex than the other patients that we ascertained. Although the complex clinical presentation raises the possibility of a co-existing diagnosis, exome sequencing did not reveal any additional variant that would explain the other phenotypic features. However, as our data strongly suggests that this NAA60 variant is leading to abnormal NAA60 enzymatic activity combined with the young age at which the CT scan was performed, we have included this variant here, and follow-up of this patient will be important to conclude the presence of abnormal brain calcification during aging. Interestingly, patient from Family 6 exhibited very small calcifications at the age of 12, including two calcified spots in the periventricular white matter and in the left putamen, next to the external capsule. Such a pattern is abnormal in patients of this age. Imaging of both F5 and F6 patients should be followed up to determine whether they will develop typical basal ganglia calcification and even more extensive later or not. The CT scans reported here are some of the youngest FPBC scans reported in the literature. Therefore, young cases from F5 and F6 should be followed up to determine the pattern of progression of calcification on neuroimaging over time.
Gene expression data (GTEx and BRAINEAC, Supplementary Fig. 5) suggest that all brain regions express NAA60, with the highest expression in the putamen, followed by the hippocampus, cerebellum, occipital cortex, and thalamus. Notably, these areas are mirrored in the clinical phenotype and distribution of calcification on neuroimaging assessment in NAA60-related cases. Interestingly, the central pontine calcification identified in 3 of the 7 cases with available imaging was previously reported only in autosomal recessive MYORG- and JAM2-related PFBC9,29 suggesting a regional vulnerability of the pons to this disease pathway. Furthermore, based on in-silico analysis and gene networks and co-expression data in humans, we show that although NAA60 and SLC20A belong to different expression pathways, they work closely in a network of genes already linked with epithelial-mesenchymal transition into osteosarcoma (ARMC8,OMIM:618521), calcium homeostasis and Ca2+ signaling (BAG5,OMIM:619747; RTN3, OMIM:604249), cargo-recognition complex critical for endosome-trans-Golgi trafficking (VPS35, OMIM:601501) and protein ubiquitination and degradation (CUL1, OMIM:603134), which reflect the biological pathways implicated in our NAA60 analysis. Interestingly, the NAA60-SLC20A2 network from the caudate tissue is already linked to genes implicated in Mendelian disorders associated with clinical overlap with the NAA60-related phenotype, such as developmental delay, intellectual disability, variable dysmorphic facial features (NARS,OMIM:108410; USP7,OMIM:616863; CSNK2A1, OMIM:617062), and parkinsonism (VPS35) (Fig. 6g and Supplementary Fig. 5g). This data suggests that within this network there may be other genes involved in neuronal maintenance that could cause a similar disease phenotype to be discovered. It, however remains to be firmly established whether SLC20A2 may be a direct substrate of NAA60-mediated N-terminal acetylation or whether their functional association is indirect or perhaps independent of Nt-acetylation. Since NATs do not typically co-precipitate with their substrates, combined with the limited performance of currently available antibodies, any future studies investigating SLC20A2 as a potential substrate of NAA60 is best done using differential Nt-proteomics on cells expressing or lacking NAA60.
NAA60’s physiological connection with PFBC and the development of calcium deposits likely occurs through its ability to Nt-acetylate membrane proteins. Prior analysis of NAA60-depleted human A-431 cells revealed 23 substrates of NAA60. All identified substrates were transmembrane proteins, and further membrane proteins were predicted as substrates based on the NAA60 preferences revealed16. SLC20A2 has the strongest physiological connection to the development of brain calcifications. Recent in vitro studies have suggested a role for this solute carrier in maintaining phosphate homeostasis in cerebrospinal fluid, indicating that SLC20A2 variants severely impaired phosphate transport in the brain30. The role of abnormal brain phosphate homeostasis in PFBC is further supported by pathological studies in other PFBC cases due to variants in genes such as MYORG, showing that the intracranial precipitates contain calcium phosphate9. Here, we showed that the SLC20A2 N-terminus is acetylated by NAA60 in vitro. Moreover, in cells isolated from NAA60 cases, surface levels of SLC20A2 were reduced along with a reduction in the ability to deplete Pi from culture medium. These findings suggest that SLC20A2 subcellular targeting/function on the PM requires NAA60-catalyzed Nt-acetylation (Fig. 7). Recently, an interplay between SLC20A2 and XPR1 was unveiled, with functional transport activities that appeared to control cellular phosphate homeostasis, although only defects in XPR1 led to increased global phosphate concentrations, which is in contrast to defective PFBC-SLC20A2 variants, which affected neither phosphate and ATP levels nor phosphate efflux31. This is consistent with our results, with variants in NAA60 affecting SLC20A2 PM localization and cellular Pi homeostasis. Moreover, a complex PFBC genotype-phenotype spectrum emerges as cases that involve dose-dependent variants have been associated with a severe clinical and neuroimaging spectrum32. SLC20A2 heterozygous mutations are associated with the adult-onset phenotype, while homozygous SLC20A2 variants resulted in severe phenotype including growth retardation, microcephaly, and convulsion33, similar to some of the NAA60 variants reported here.
NAA60 or NatF is part of a protein family of seven human N-terminal acetyltransferases (NATs). Each human NAT catalyses Nt-acetylation of distinct substrates19,34. While NatA–NatE perform co-translational N-terminal acetylation, NatF and NatH post-translationally Nt-acetylate membrane proteins and actin, respectively. The NATs Nt-acetylate ~80% of the human proteome16,35 with most events driven by NatA, NatB, and NatC16,36,37. The functional impact of Nt-acetylation varies from protein to protein and may involve protein folding, degradation, stabilization, subcellular targeting, and protein complex formation19,34. Recent data strongly suggest that a major function of Nt-acetylation is shielding proteins from proteasomal degradation38,39,40. Interestingly, NatC Nt-acetylates a subset of proteins starting with Met (Met-Leu-, Met-Ile, Met-Phe, Met-Trp, Met-Val, Met-Met, Met-Lys etc.)37,41,42,43, and for many of these proteins, lack of NatC-mediated Nt-acetylation will cause them to be recognized by specific ubiquitin E3 ligases and degraded38 in the N-degron pathway44. NatC and NatF have distinct in vivo substrates since NatC acts co-translationally on a variety of proteins while NatF acts post-translationally on transmembrane proteins, but these two enzymes acetylate similar types of protein N-terminal sequences34. Therefore, it is possible that NatF/NAA60 transmembrane protein substrates with diminished Nt-acetylation are also recognized and degraded by the N-degron pathway. Here, we show that NAA60-related disease mechanisms involve impaired cellular phosphate homeostasis, possibly via SLC20A2.
Variants in five NAT genes have been associated with a human phenotype, NAA10 (OMIM:3000013), NAA15(OMIM:608000), NAA20 (OMIM:610833), NAA30 (OMIM:617989), and NAA80 (OMIM:607073). Variants in NAA10, encoding the catalytic subunit of NatA, were associated with aged appearance, craniofacial anomalies, hypotonia, global developmental delay, cryptorchidism, and cardiac arrhythmias45. Partially overlapping phenotypes were observed in individuals with pathogenic variants in NAT genes, including developmental delay, intellectual disability, congenital heart disease and autism spectrum disorder (NAA10 and NAA15)46,47,48,49,50,51, developmental delay, intellectual disability, and microcephaly (NAA2052,53), developmental delay (NAA30)54, hearing loss, muscle weakness and developmental delay (NAA80, the actin-specific NAT)55,56.
In this work, we present pathogenic NAA60 variants as causative for PFBC with impaired cellular Pi homeostasis, possibly via SLC20A2 (Fig. 7). Moreover, brain calcifications are frequent in the general population and increase with age from ~1% in young adults to ~20% in the elderly28,57. They are also found in a variety of major neurodegenerative conditions. Almost half of Down syndrome cases58, 20% of Parkinson’s disease (PD)59, and 10% of Alzheimer’s disease (AD)60 cases develop brain calcifications with overlapping histological pathogenesis and clinical manifestations58,60. As such, deciphering the genetic basis and molecular mechanisms of brain calcification may facilitate a better understanding of disease processes associated with common neurodegenerative disorders.
Methods
The individuals included in this study were recruited along with unaffected family members with informed consent under ethics-approved research protocols (UCLH: 04/N034; Rouen: RBM-0259 approved by the CPP Ile de France II ethics committee, and CERDE (notification E2023-40, Rouen University Hospital) approved the retrospective analysis of genomic and phenotypic data; Comité de Protection des Personnes ID-RCB/EUDRACT: 2014-A01017-40); Saudi Arabia: KFSHRC IRB (RAC# 2121053)). The 100,000 Genomes Project Protocol has ethical approval from the HRA Committee East of England—Cambridge South (REC Ref 14/EE/1112). The authors affirm that the human research participants’ guardians provided written informed consent for the publication of the video in Supplementary Movie 1. Human research participants/their guardians provided written informed consent for generation of fibroblast cell lines from skin biopsies.
Study participants, phenotype, and clinical measures
Patients with a negative family history or recurrence among siblings and confirmed clinical and radiological diagnosis of PFBC were recruited from multiple centers in the UK (UCL series). In this series, we screened 78 cases from 53 families with PFBC who were negative for pathogenic variants in SLC20A2, PDGFB, PDGFRB, XPR1, MYORG, JAM2, and CMPK2. Secondary causes of brain calcification were excluded in all cases. Neurogenetics specialists performed comprehensive neurological examination and phenotyping.
Following the identification of a family linked to biallelic NAA60 variants in the UCL series, we screened additional cases from two French centers. At the Rouen University Hospital and Inserm U1245 (Rouen, France), we screened exome sequencing data from 102 unrelated probands with no causative variant in any of the seven known PFBC genes. Patients were recruited through the French PFBC study as previously described10. At the laboratory of Neurogenetics and Neuroinflammation, Institut Imagine, Paris, we screened 30 unrelated families with unexplained brain calcifications. Then, we screened the Solve-RD-Connect genomics platform containing shared genome‐phenome datasets from 22,000 individuals with whole-exome sequencing data, including affected participants and relatives, of which 13,676 were affected participants with rare diseases21. Then, we screened WGS data from 75,880 participants in the Rare Disease arm of the 100,000 Genomes Project61. These comprised 35,451 rare disease probands with 6139 affected family members and 13,920 participants (offspring) for whom trio WGS data were available. Finally, we screened two series of unsolved rare disease cases from Centogene and Saudi Arabia. The Saudi Arabia cohort, consisted of ten cases with suspected genetic stroke, which were analyzed using WES that revealed one NAA60 variant, five cases were linked to known disease genes, and the remaining four were submitted for reanalysis.
In cases with biallelic NAA60 variants, the results from additional investigations were retrospectively analyzed based on chart review, where available. Neuroimaging with computed tomography (CT) and brain MRI confirmed the presence of brain calcifications in all reported adult cases (n = 9). Cognitive impairment was assessed by formal psychometry, when available.
We used the term sex (biological attribute) for reporting the findings. Sex was the only information that was collected and was determined on self-report. We reported here only the number of male versus female. No disaggregated sex analysis was performed as the sample size was too low to enable meaningful conclusion. Sex was not considered in the study design. Age was defined by the data reported by patient or their carer. Age information was used to establish disease onset, disease duration, and time to brain imaging. Genotypic information was used to correlate with clinical and brain neuroimaging features. Neurological examination was described including motor features, cognitive features, psychiatric features.
Genome-wide sequencing
DNA was extracted from peripheral blood in all cases. WES was performed in all families except Family 4, which had WGS performed. Illumina HiSeq4000 (in F1, F3, and F7), Illumina HiSeq2500 (in F4), and Illumina HiSeq2000 (in F2, F5, and F6) (Illumina, San Diego, CA, USA) sequencers were used to generate 100 bp or 150-bp paired-end reads. Alignment was performed using BWA62 with GRCh38 as a reference. Variants were called using the GATK63,64,65,66 Unified Genotyper-based pipeline63,64,65 workflow. All variants were annotated using ANNOVAR67 and filtered using custom R scripts. Only novel or very rare variants with a minor allele frequency (MAF) of <0.01 in the genome Aggregation Database v2.1 (gnomAD)68 were included. Variants were filtered for biallelic, highly deleterious, rare variants segregating with the disease in the trios. The WGS and bioinformatic pipelines, as well as the “tiering” framework for variant prioritization for cases included in the 100,000 Genomes Project, have been previously described61. Structural variants detected in 33,924 families with WGS data were prioritized using a MySQL database of variants called by Manta and CANVAS, as described69. For the NAA60 (ENST00000407558, GenBank transcript ID NM_001083601), variant segregation was confirmed in all other family members, and primer sequences are as follows: c.321_327del, forward: gacgtgtgagcctgactttc, reverse: ggaagagactgggtgcagat; c.338-1 G > C, forward:GTGGTGGTGAAGAAAGGCTG, reverse: GTGTTGTTGGTGGTGAGGAC; c.391 C > T, forward: AAGTTTAAAGGATCACATATCAACCA, reverse: TGCTGCTTGAAGTCTCTGTTTT; c.130 C > T, forward: gtggcaggttcacctgagta, reverse: TTGGTCCTGTTCTTAATTTCAGC; c.50 T > G, forward: GTGTGAATGACAGAGGTGGTG, reverse: ACCAGTCGCCACACAGGT; c.428 A > C, forward: TCATCCTTCCTTCCTAACTGCTC, reverse: TTAAGGATATAAAATCGTCCAGGG.
Haplotype analysis
For relatedness analysis, samples from F1, F2, and F3 were realigned to GRCh38, and variants were called using the GATK HaplotypeCaller-based pipeline50,64,65. Shared regions of homozygosity were identified using HomozygosityMapper70. Kinship and relatedness were further inspected with Peddy23 and Automap24.
RNA analysis
To evaluate the c.338-1 G > C variant in intron 5, a region flanking exon 6 was amplified by PCR from the proband from F2 and a control individual with specific primers containing an additional XhoI and BamHI restriction site (forward primer with XhoI restriction site: 5′-aattctcgagATTTTAAACCCAGGCCCATC-3′ and reverse primer with BamHI restriction site: 5′-attggatccGTGCAACTCGATTTACCCAAA-3′) with a modified protocol71,72. After PCR amplification and clean-up, restriction enzyme digestion of the PCR fragment and pSPL3 exon trapping vector was performed prior to ligation between exon A and exon B of the linearized pSPL3 vector. The variant-containing and wild-type vectors were transformed into DH5α competent cells (NEB 5-α, New England Biolabs), plated, and incubated overnight. The wild-type and mutant-containing vector sequences were confirmed by Sanger sequencing.
Vectors containing homozygous and wild-type sequences were transfected into HEK293T cells (ATCC) at a density of 2 × 105 cells per mL. One microgram of the respective pSPL3 vectors was transiently transfected using 6 µl of FuGENE 6 Transfection Reagent (Promega). An empty vector and transfection negative reactions were included as controls. The transfected cells were harvested after 24 hours. Total RNA was prepared using a miRNAeasy Mini Kit (Qiagen). Approximately 1 µg of RNA was reverse transcribed using a High-Capacity RNA-to-cDNA Kit (Applied Biosystems) according to the manufacturer’s protocols. The cDNA was PCR amplified using vector-specific SD6 forward (5′-TCTGAGTCACCTGGACAACC-3′) and exon 6-specific (5′-CATGCAGGTAAATGGCTTTGC-3′) primers. The amplified fragments were visualized on a 1% agarose gel and Sanger sequenced.
Generation of patient-derived cells
Sub-deltoid skin punch biopsies were used to generate primary fibroblast cell lines from cases (F1-II-I, F1-II-2), unaffected relatives(F1-I-1), and healthy controls. The area for biopsy was scrubbed with 70% isopropyl alcohol, and 2% lidocaine local anesthetic was administered prior to removal of a 3 mm diameter skin sample by a sterile punch biopsy instrument. The skin wound was closed with steristrips. Skin punch biopsies were used to generate primary fibroblast cell lines by manual and enzymatic dissociation, followed by growth in culture media.
Construction of plasmids for the expression of NAA60 WT and NAA60 variants
For the generation of the FLAG-tagged NAA60 WT construct, NAA60 cDNA clones were subcloned into SNAP-DHHC3 plasmids [removing SNAP-DHHC3] (NEB, Ipswich, MA, USA) and conjugated to a FLAG tag (Sigma Aldrich, St. Louis, MO, USA). The NAA60 F1 construct, in which a premature stop codon was inserted at amino acid 108, was generated by PCR of WT cDNA. Constructs representing NAA60 variants from F2/3, F4, F5, and F6 were generated from the WT or F1 constructs by mutagenesis (Q5® Site-Directed Mutagenesis Kit, NEB). Constructs representing NAA60 variants from F7 were generated from the WT construct by mutagenesis (GeneArt™ Site-Directed Mutagenesis System, Thermo Fisher Scientific). For purification of NAA60 from E. coli, SUMO-NAA601–184 was used26.
Cell culture and transfection
HeLa cells for NAA60 WT localization experiments were maintained at 37 °C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Grand Island, NY, United States) supplemented with 10% fetal bovine serum (FBS) (Gibco). Plasmid transfections were performed with Fugene HD (Promega, Madison, WI, USA) as recommended by the manufacturer. Transfection of cDNA was performed at a final concentration of 100 µg/ml. Human fibroblasts from patients, carriers, and healthy controls were maintained at 37 °C in 5% CO2 in fibroblast medium DMEM (Sigma, 6546) supplemented with 10% FBS, 1% L-glutamine, 1% antibiotic-antimycotic solution, 0.1% fibroblast growth factor, and 0.1% hydrocortisone (Cell Biologics, Chicago, IL, USA).
RPE-1 cells (CRL-4000, ATCC) used for NAA60 subcellular localization studies of FLAG-NAA60 WT and variants and HEK293T cells (12022001, Sigma) used for immunoprecipitation of the same proteins were cultured in DMEM and high glucose with pyruvate (Sigma, 6546) supplemented with 10% FBS and 1% penicillin/streptomycin and maintained as described above. HAP1 cells were obtained from Horizon Genomics and cultured as recommended. Parental control (C631), NAA60 knockout (HZGHC003172c010), and NAA80 knockout (HZGHC003171c012) HAP1 cells were grown in Iscove’s modified Dulbecco’s medium with 10% FBS and 1% penicillin/streptomycin. Since HAP1 cells possess an originally near-haploid genome but spontaneously switch to a diploid state during normal cultivation, all HAP1 cell lines were passaged until diploidy could be confirmed using flow cytometry recommended in the HAP1 cell culture guidelines by Horizon as well as detailed in a methods article on the procedure27.
Plasmid transfection of RPE-1 and HEK293T cells was performed with XtremeGene 9 (Roche) according to the recommended protocol and using 2 μl transfection reagent per μg plasmid. For microscopy, transfected cells were fixed approximately 18 hours post transfection; for immunoprecipitation, cells were harvested 48 hours post transfection.
Immunofluorescence and fluorescence microscopy
For NAA60 WT imaging experiments, transfected HeLa cells were chemically fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min at room temperature (RT). Cells were then permeabilized in permeabilization buffer (0.3% NP-40, 0.05% Triton-X-100, 0.2% bovine serum albumin (BSA) (IgG free), 1× PBS) for 3 min at RT, washed three times in wash buffer (0.05% NP-40, 0.05% Triton-X-100, 0.2% BSA (IgG free), 1× PBS), and subsequently blocked in blocking buffer (0.05% NP-40, 0.05% Triton-X-100, 5% normal goat serum, 1× PBS) for 1 hour. Primary antibodies were diluted at 1:500 in blocking buffer and added to cells for 1 hr at RT. Next, the cells were washed three times in wash buffer (0.05% NP-40, 0.05% Triton-X-100, 0.2% BSA (IgG free), 1× PBS), incubated with a dilution of a fluorophore-labeled secondary antibody (1:1000) in blocking buffer for 1 hour at RT, washed three times with wash buffer, and twice in PBS. To investigate the distribution of a wild-type NAA60 construct conjugated to a FLAG epitope tag in HeLa cells, we used structured illumination microscopy (SIM). For SIM samples, the cells were mounted with ProLong Gold antifade reagent (Life Technologies, Carlsbad, CA) and 1 mm thick precleaned microscope slides (Thermo Fisher Scientific, Waltham, MA). A final super-resolved image was reconstructed by superimposing several raw images at various diffraction grating orientations.
For imaging comparing the localization of FLAG-NAA60 WT to mutated F1-F5 variants, confocal images were obtained using a Leica TCS SP8 STED 3× confocal laser microscope equipped with an HC PL APO 100 × 1.4 NA oil objective, 1 Airy unit pinhole aperture. Images were acquired as Z-stacks with the Leica Application Suite X software applying the Lightening module, exported, and processed in ImageJ to show Z-projections of merged stacked planes.
The antibodies used for imaging were rabbit anti-GPP130 (Covance, PRB144C), rabbit anti-GM130 [EP892Y] (Abcam, ab52649), and mouse anti-FLAG M2 (Sigma, F1804). All secondary antibodies conjugated to fluorescent dyes were purchased from Molecular Probes (Eugene, OR, USA).
Surface biotinylation and western blot
Patient fibroblasts were grown in T75 flasks to 100% confluency. The fibroblasts were washed twice in PBS and subsequently incubated in 5 ml/flask of a 0.5 mg/ml sulfo-NHS-biotin solution in PBS (ThermoFisher) for 30 min on ice. The cells were then washed in quenching buffer (PBS, 100 mM glycine) and incubated in a 10 ml/flask for 15 min on ice. The cells were washed once with PBS, scraped, incubated in lysis buffer (50 mM HEPES-NaOH, pH 7.4, 100 mM NaCl, 5 mM EDTA, (v/v) Triton-X-100, protease inhibitor cocktail), sonicated, and subjected to pulldown with Neutravidin-agarose (Pierce). Inputs were compared to endogenous actin. Levels of biotinylated surface proteins were estimated based on a ratio of control to patient fibroblasts. The protein concentration in the lysate was monitored by a Bradford assay, in which the total protein concentration was determined at 595 nm according to the manufacturer’s protocol for a standard 1-ml cuvette assay (Bio-Rad, 500-0203, Mississauga, ON). Samples were analyzed by standard Western blot. The antibodies used were rabbit anti-SLC20A2 (Abcam, ab191182) and rabbit anti-actin (Sigma, A2066). As the immunogen used to generate the SLC20A2 antibody maps to a region of SLC20A2 that has some sequence match with SLC20A1, it cannot be excluded that this antibody could also have reactivity towards SLC20A1, which has a very similar molecular weight. Antibodies used for other Western blots were mouse anti-FLAG M2 (Sigma, F1804) used at 1:1000, mouse anti-GAPDH (Santa Cruz Biotechnology, Sc-47724) used at 1:5000, rabbit anti-NAA60 polyclonal (BioGenes custom made Arnesen lab) used at 1:500. Secondary antibodies for western blot were ECL™ Anti-Rabbit IgG HRP Linked Whole antibody (Cytiva Life science, NA934) used at 1:3000 and ECL™ Anti-Mouse IgG HRP Linked Whole antibody (Cytiva Lifescience, NA931V) used at 1:3000.
DTNB in vitro peptide Nt-acetylation assay for NAA60 purified from E. coli
Purification of His-SUMO-hNAA601–184 was performed as previously described73 and detailed here. The plasmid was transformed into E. coli BL21 (Invitrogen) by heat shock. The bacteria were grown in 200 ml of LB at 37 °C until an OD600 of 0.6. The culture was kept on ice for 15 min before His-SUMO-NAA601–184 expression was induced by 200 μM IPTG. After 20 hours of incubation at 17 °C, the bacterial culture was harvested, and the pellet was stored at −20 °C. The bacterial pellet was thawed on ice, and the cells were lysed by sonication in lysis buffer (100 mM HEPES pH 7.5, 300 mM NaCl, 2 mM DTT supplemented with protease inhibitor cocktail EDTA-free (Roche)). Cell debris was removed by centrifugation at 15,000 × g for 30 min. The supernatant was applied to a 5 ml HisTrap column, the column was washed with wash buffer (100 mM HEPES pH 7.5, 200 mM NaCl, 2 mM DTT, 20 mM imidazole), and the protein was eluted by slowly increasing the imidazole concentration to 300 mM. Eluted fractions containing His-SUMO-NAA601–184 were combined and loaded on a Size Exclusion Chromatography column (Superdex 200 16/600, GE Healthcare). The fraction containing monomeric His-SUMO-hNAA601–184 was collected. Protein purity was confirmed by SDS/PAGE and Coomassie staining, and concentration was determined by absorbance measurements at 280 nm. The purified protein was concentrated by using Amicon Ultra Centrifugation filters and frozen in small aliquots at -80 °C.
For the peptide in vitro Nt-acetylation assay, purified SUMO-NAA601–184 (500 nM) was mixed with substrate peptides (300 μM) and Ac-CoA (300 μM) in acetylation buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 1 mM EDTA) to a total reaction volume of 50 μl and incubated at 37 °C for 20 s. Negative controls without enzyme were also prepared. Acetylation was stopped by adding 100 μl quenching buffer (3.2 M guanidin-HCl, 100 mM Na2HPO4 pH 6.8). For negative controls, enzyme (500 nM) was added after quenching. The samples were mixed with 20 μl DTNB buffer (100 mM Na2HPO4 pH 6.8, 10 mM EDTA) prepared with fresh DTNB (10 mg/ml). Then, 150 μl of each sample was transferred to a 96-well plate, and the absorbance was measured at 412 nm74. For each peptide tested, three replicates of positive and negative controls were used. The absorbance of negative controls was averaged and subtracted from the absorbance of the samples. The product concentration was calculated using the Lambert Beer equation and the extinction coefficient of TNB2-(13700/M cm). The following synthetic peptides (>90% purity) were used (all 24-mer oligopeptides from Biogenes): Protein phosphatase 6, O00743, MAPL, verified NAA60/NatF substrate18: [H] MAPLDLDRWGRPVGRRRRPVRVYP [OH]; High mobility group protein A1, P17096, SESS, verified NatA substrate35: [H] SESSSKSRWGRPVGRRRRPVRVYP [OH]; NF-kκB p65, Q04206, MDEL, verified NatB substrate75: [H] MDELFPLRWGRPVGRRRRPVRVYP [OH]; mature β-actin, P60709, DDDI, verified NAA80/NatH substrate56: [H] DDDIAALRWGRPVGRRRRPVRVYP [OH]; SLC20A2, Q08357, MAMD or the potential iMet-processed AMDE: [H] MAMDEYLRWGRPVGRRRRPVRVYP [OH] and [H] AMDEYLRWGRPVGRRRRPVRVYP [OH] and XPR1, Q9UBH6, MKFA:[H]-MKFAEHLRWGRPVGRRRRPVRVYP-[OH]; and from Innovagen: PDGFRB, P09619, MRLP: [H]-LVVTPPGRWGRPVGRRRRPVRVYP-[OH], MYORG, Q6NSJ0, MLQN: H]-MLQNPQERWGRPVGRRRRPVRVYP-[OH], JAM2, P57087, FSAP: H-FSAPKDQRWGRPVGRRRRPVRVYP-[OH].
Immunoprecipitation and [14-C]-Nt-acetylation assay
To obtain NAA60 protein variants for in vitro testing, these were expressed and immunoprecipitated from HEK293T cells. A total of 4 × 106 HEK293T cells/dish were seeded on 10-cm dishes and grown for 24 h before transfection. Forty-eight hours after transfection, the cells were washed in cold PBS, harvested in cold PBS by centrifugation at 17,000 × g for 1 min, and frozen at −80 °C. Pellets were thawed, resuspended in 2× NAA60 acetylation buffer (100 mM Hepes pH 7.5, 200 mM NaCl, 2 mM EDTA, Complete EDTA-free protease inhibitor (Roche)), and 20 μl buffer/mg pellet), and tubes were left on a rotating wheel for 25 min. The lysates were given a short spin (15 sec) on a bench top centrifuge, and 2 μg anti-FLAG (Sigma F1804-20046) was added to the supernatant. The mixture was incubated on a rotating wheel for 3 h before 200 μl prewashed magnetic beads (Invitrogen Dynabeads 10004D) were added and again incubated on a rotating wheel overnight. The beads were washed three times in IPH lysis buffer and one time in 2× acetylation buffer (100 mM HEPES pH 7.5, 200 mM NaCl, 2 mM EDTA). Stability tests showed that transfections with FLAG-NAA60-F1 and FLAG-NAA60-F2/3 produced drastically lower output (Fig. 2c). Therefore, to obtain enough protein for these two variants to be tested in an in vitro activity assay next to the WT, several adjustments were made, including increased plasmid amounts, an increased number of transfected cells, and MG132 treatment for 6 hours prior to harvest (only for F2/3). All mutants were tested strictly in parallel with the WT, and a final adjustment was performed by normalizing enzyme inputs according to parallel Western blots.
For the [14-C]-Nt-acetylation assay, magnetic beads from FLAG-NAA60 IP, [14-C]Ac-CoA (25 μM), and 200 μM substrate peptide MAPL ([H] MAPLDLDRWGRPVGRRRRPVRVYP [OH]) were mixed in acetylation buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 1 mM EDTA) and incubated at 37 °C on a shaker for 2 h. Beads were isolated using a magnet, and 20 μl of the suspension was transferred to P81 phosphocellulose paper. After air-drying, the filters were washed 3× for 5 min in 10 mM HEPES pH 7.4. The filters were again air-dried and transferred to scintillation tubes, and 5 ml scintillation solution was added before counting in a scintillation counter. For each condition, three replicates were performed, with pretests performed to be able to apply equal enzyme inputs.
Quantification of inorganic phosphate
We quantified the extracellular free inorganic phosphate (Pi) in fibroblast cultures from F1 by using the PiPer Phosphate Assay kit (Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. Fibroblast cell lines from affected patients, carriers, and healthy controls were cultured under standard conditions. The culture medium was collected after three days of incubation as previously described76. All assays were performed in triplicate in clear bottom 96-well assay plates (BD Falcon). All plates were incubated at 37 °C in the dark for 15 s and read in an iMarkTM Microplate Absorbance Reader (Bio-Rad Laboratories) at excitation/emission wavelengths of 544/590 nm.
Peripheral blood mononuclear cells (PBMCs) of one patient carrying the NAA60 c.338-1 G > C variant from F2 and one sex- and age-matched control were obtained from fresh blood samples. Phosphate uptake and efflux assays in PBMCs were performed similar as in earlier studies31,77. For uptake measurements, cells were incubated for 30 min at 37 °C in phosphate-free DMEM supplemented with 0.5 μCi/ml 33P (FF-1; Hartmann Analytic GmbH, Germany). Cell lysates were then assayed for radioactivity by scintillation counting and for protein content by the BCA protein assay (Pierce). Phosphate uptake was calculated from the concentration of cold phosphate in the medium multiplied by the ratio of cellular [33P]phosphate to total [33P]phosphate supplemented within a period of 30 s. For the efflux measurements, cells were incubated for 20 min at 37 °C in phosphate-free DMEM supplemented with 0.5 μCi/ml 33P, gently washed three times with phosphate-free medium, and then incubated in DMEM for 30 min at 37 °C in 10 mM phosphate before collection of the supernatant. The amount of 33P in the supernatants and cell lysates was measured by liquid scintillation. Phosphate uptake was calculated from the concentration of cold phosphate in the medium multiplied by the ratio of cellular [33P]phosphate to total [33P]phosphate supplemented (FF-1; Hartmann Analytic GmbH, Bern Switzerland) within a period of 30 s. The percentage of phosphate efflux was calculated as the ratio of released [33P]phosphate to total cellular [33P]phosphate.
Co-expression networks analyses
To identify modules in co-expression networks including NAA60 and SLC20A2, we created a co-expression network by using Weighted Gene Co-expression Network Analyses (WGCNA) on GTEx V6 bundle. Gene modules within co-expression networks represent groups of genes that work together on the corresponding samples and are often enriched in specific pathways or with molecular functions. First, we constructed co-expression networks for NAA60 and SLC20A2 using genes with RPKM values above 0.1 in at least 80% of the samples, within the five relevant brain areas involved in the human phenotype with available data from GTEX (cerebellum, substantia nigra, putamen, nucleus accumbens and the caudate)78. The expression levels of each module were summarized by the first principal component (the so-called module eigengene). The network is programmatically accessible from CoExpGTEx (https://github.com/juanbot/CoExpGTEx) and through the Web at CoExpWeb software tool (https://rytenlab.com/coexp). Briefly, we selected genes based on their expression abundance, using only genes with RPKM values above 0.1 in more than 80% of samples. We corrected for batch effect using ComBat79 and regressed for RNA integrity numbers (RIN), post-mortal interval (PMI), age and gender and used the corresponding residuals to construct the network using CoExpNets R package80, based on the WGCNA R package81. Briefly, we obtained the human phenotype (HP) terms enrichment for blue and grey60 modules (see Results) using gProfileR82. The cell maker enrichment is the original from CoExpGTEx based on a Fisher’s Exact test with the genes in the module and manually curated cell marker gene lists from WGCNA and our group. The module membership (MM) of each gene in its module is calculated using the Pearson correlation of the gene expression values with the 1st eigen vector of the whole module gene expression.
The network diagrams were generated with Cytoscape 3.10 by creating the bottom-up plot of the network context of NAA60 and SCL20A2 taken together for the co-expression network of caudate, based on adjacency values. The algorithm put the two genes in an empty canvas using them as seed genes. Iteratively, it adds to the canvas the most connected gene to NAA60 across the whole network, and the most connected gene to SLC20A2. It then adds the corresponding edges between the two pairs of genes. Therefore, both NAA60 and SCL20A2 receive connections from approximately half of the genes in the diagram, respectively. This operation is repeated n times for each seed gene (in this case n = 7). If a gene selected for addition to the canvas was already added, then a new gene is selected for addition instead. Note that connection between any pair of genes gi and gj is measured as the adjacency between the two genes. Adjacency is a concept used in WGCNA to measure the connectivity of each gene. If two genes show high adjacency, based on Pearson correlation, they are said to be strongly connected. Once the canvas is completed with all genes and links required, the layout of genes is calculated by the edge-weighted spring layout in Cytoscape, based on the Kamada–Kawai algorithm. As a result, genes appearing near to each other, on average, reflect a high adjacency between them. The color of the nodes corresponds to the module name, either blue or gray. Their size reflects the accumulated adjacency for each node (the total sum of adjacencies with the rest of genes in the network). The same approach was applied for NAA60 alone.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
All data generated or analyzed during this study and used to produce the plots are included in this published article (and its supplementary information files). The raw DNA sequencing data from the cases reported here, CT and brain MRI, are protected and are not available due to data privacy laws. Next-generation sequencing (NGS) data can be requested by contacting the corresponding author. Due to ethics restrictions on storing and sharing our patient NGS data, this data will have controlled access and will be limited to individuals who enter a research agreement. Use of this genomic data will be restricted to those named on the agreement, and NGS data will be patient de-identified. Data may be obtained from a third party and are not publicly available. 100,000 Genomes Project data are stored in the National Genomic Research Library (https://doi.org/10.6084/m9.figshare.4530893.v6), and the RD-Connect Data is stored in the European Genome-Phenome Archive (EGA) and the RD-Connect Genome-Phenome Analysis Platform (GPAP) (https://doi.org/10.1038/s41431-021-00859-0). The following databases were used; human reference genomes hg19 and hg38, Gencode human annotation release 40 (GRCh37), dbSNP 132, 1000 Genomes Project, NHLBI Go Exome Sequencing Project, gnomAD, The immunofluorescence and fluorescence microscopy, surface biotinylation, DTNB in vitro peptide Nt-acetylation assay for NAA60, immunoprecipitation and [14-C]-Nt-acetylation assay, quantification of inorganic phosphate and co-expression networks analyses data generated in this study are provided in the Supplementary Information and Source Data file. For clinical, genetic, and neuroimaging enquiries, please contact v.chelban@ucl.ac.uk, and for inquiries regarding the protein functional work, please contact henriette.aksnes@uib.no or thomas.arnesen@uib.no. The expected timeframe for responses 5 days. Source data are provided with this paper.
References
Batla, A. et al. Deconstructing Fahr’s disease/syndrome of brain calcification in the era of new genes. Parkinsonism Relat. Disord. 37, 1–10 (2017).
Balck, A. et al. Genotype-phenotype relations in primary familial brain calcification: systematic MDSGene review. Mov. Disord. 36, 2468–2480 (2021).
Nicolas, G., Charbonnier, C., Campion, D. & Veltman, J. A. Estimation of minimal disease prevalence from population genomic data: Application to primary familial brain calcification. Am. J. Med. Genet. B Neuropsychiatr. Genet. 177, 68–74 (2018).
Wang, C. et al. Mutations in SLC20A2 link familial idiopathic basal ganglia calcification with phosphate homeostasis. Nat. Genet. 44, 254–256 (2012).
Legati, A. et al. Mutations in XPR1 cause primary familial brain calcification associated with altered phosphate export. Nat. Genet. 47, 579–581 (2015).
Keller, A. et al. Mutations in the gene encoding PDGF-B cause brain calcifications in humans and mice. Nat. Genet. 45, 1077–1082 (2013).
Nicolas, G. et al. Mutation of the PDGFRB gene as a cause of idiopathic basal ganglia calcification. Neurology 80, 181–187 (2013).
Westenberger, A. & Klein, C. The genetics of primary familial brain calcifications. Curr. Neurol. Neurosci. Rep. 14, 490 (2014).
Yao, X. P. et al. Biallelic mutations in MYORG cause autosomal recessive primary familial brain calcification. Neuron 98, 1116–1123.e5 (2018).
Grangeon, L. et al. Biallelic MYORG mutation carriers exhibit primary brain calcification with a distinct phenotype. Brain 142, 1573–1586 (2019).
Schottlaender, L. V. et al. Bi-allelic JAM2 variants lead to early-onset recessive primary familial brain calcification. Am. J. Hum. Genet. 106, 412–421 (2020).
Cen, Z. et al. Biallelic loss-of-function mutations in JAM2 cause primary familial brain calcification. Brain 143, 491–502 (2020).
Taglia, I., Bonifati, V., Mignarri, A., Dotti, M. T. & Federico, A. Primary familial brain calcification: update on molecular genetics. Neurol. Sci. 36, 787–794 (2015).
Zhao, M. et al. Loss of function of CMPK2 causes mitochondria deficiency and brain calcification. Cell Discov. 8, 128 (2022).
Wang, C. et al. [Molecular mechanism of idiopathic basal ganglia calcification]. Yi Chuan 37, 731–740 (2015).
Aksnes, H. et al. An organellar nalpha-acetyltransferase, naa60, acetylates cytosolic N termini of transmembrane proteins and maintains Golgi integrity. Cell Rep. 10, 1362–1374 (2015).
Aksnes, H., Marie, M. & Arnesen, T. Holding it together: Naa60 at the golgi. Oncotarget 6, 15726–15727 (2015).
Van Damme, P. et al. NatF contributes to an evolutionary shift in protein N-terminal acetylation and is important for normal chromosome segregation. PLoS Genet. 7, e1002169 (2011).
Aksnes, H., Ree, R. & Arnesen, T. Co-translational, post-translational, and non-catalytic roles of N-terminal acetyltransferases. Mol. Cell 73, 1097–1114 (2019).
Aksnes, H. et al. Molecular determinants of the N-terminal acetyltransferase Naa60 anchoring to the Golgi membrane. J. Biol. Chem. 292, 6821–6837 (2017).
Laurie, S. et al. The RD-connect genome-phenome analysis platform: accelerating diagnosis, research, and gene discovery for rare diseases. Hum. Mutat. 43, 717–733 (2022).
Caulfield, M. et al. The 100,000 Genomes Project Protocol. https://doi.org/10.6084/m9.figshare.4530893.v4. (2017).
Pedersen, B. S. & Quinlan, A. R. Who’s who? Detecting and resolving sample anomalies in human DNA sequencing studies with peddy. Am. J. Hum. Genet. 100, 406–413 (2017).
Quinodoz, M. et al. AutoMap is a high performance homozygosity mapping tool using next-generation sequencing data. Nat. Commun. 12, 518 (2021).
Aksnes, H., Drazic, A., Marie, M. & Arnesen, T. First things first: vital protein marks by N-terminal acetyltransferases. Trends Biochem. Sci. 41, 746–760 (2016).
Støve, S. I. et al. Crystal structure of the golgi-associated human Nα-acetyltransferase 60 reveals the molecular determinants for substrate-specific acetylation. Structure 24, 1044–1056 (2016).
Beigl, T. B., Hellesvik, M., Saraste, J., Arnesen, T. & Aksnes, H. N-terminal acetylation of actin by NAA80 is essential for structural integrity of the Golgi apparatus. Exp. Cell Res. 390, 111961 (2020).
Nicolas, G. et al. Phenotypic spectrum of probable and genetically-confirmed idiopathic basal ganglia calcification. Brain 136, 3395–3407 (2013).
Chelban, V. et al. MYORG-related disease is associated with central pontine calcifications and atypical parkinsonism. Neurol. Genet. 6, e399 (2020).
Jensen, N., Autzen, J. K. & Pedersen, L. Slc20a2 is critical for maintaining a physiologic inorganic phosphate level in cerebrospinal fluid. Neurogenetics 17, 125–130 (2016).
López-Sánchez, U. et al. Interplay between primary familial brain calcification-associated SLC20A2 and XPR1 phosphate transporters requires inositol polyphosphates for control of cellular phosphate homeostasis. J. Biol. Chem. 295, 9366–9378 (2020).
Sun, H. et al. Severe brain calcification and migraine headache caused by SLC20A2 and PDGFRB heterozygous mutations in a five-year-old Chinese girl. Mol. Genet. Genom. Med. 9, e1670 (2021).
Ceylan, A. C. et al. Homozygous SLC20A2 mutations cause congenital CMV infection-like phenotype. Acta Neurol. Belg. 123, 1757–1761 (2022).
Aksnes, H., McTiernan, N. & Arnesen, T. NATs at a glance. J. Cell Sci. 136, jcs260766 (2023).
Arnesen, T. et al. Proteomics analyses reveal the evolutionary conservation and divergence of N-terminal acetyltransferases from yeast and humans. Proc. Natl Acad. Sci. USA 106, 8157–8162 (2009).
Van Damme, P. et al. N-terminal acetylome analyses and functional insights of the N-terminal acetyltransferase NatB. Proc. Natl Acad. Sci. USA 109, 12449–12454 (2012).
Van Damme, P. et al. A role for human N-alpha acetyltransferase 30 (Naa30) in maintaining mitochondrial integrity. Mol. Cell Proteomics 15, 3361–3372 (2016).
Varland, S. et al. N-terminal acetylation shields proteins from degradation and promotes age-dependent motility and longevity. Nat. Commun. 14, 6774 (2023).
Linster, E. et al. Cotranslational N-degron masking by acetylation promotes proteome stability in plants. Nat. Commun. 13, 810 (2022).
Mueller, F. et al. Overlap of NatA and IAP substrates implicates N-terminal acetylation in protein stabilization. Sci. Adv. 7, eabc8590 (2021).
Van Damme, P. et al. Expanded in vivo substrate profile of the yeast N-terminal acetyltransferase NatC. J. Biol. Chem. 299, 102824 (2023).
Starheim, K. K. et al. Knockdown of human N alpha-terminal acetyltransferase complex C leads to p53-dependent apoptosis and aberrant human Arl8b localization. Mol. Cell Biol. 29, 3569–3581 (2009).
Polevoda, B. & Sherman, F. NatC Nalpha-terminal acetyltransferase of yeast contains three subunits, Mak3p, Mak10p, and Mak31p. J. Biol. Chem. 276, 20154–20159 (2001).
Varshavsky, A. N-degron and C-degron pathways of protein degradation. Proc. Natl Acad. Sci. USA 116, 358–366 (2019).
Rope, A. F. et al. Using VAAST to identify an X-linked disorder resulting in lethality in male infants due to N-terminal acetyltransferase deficiency. Am. J. Hum. Genet. 89, 28–43 (2011).
Saunier, C. et al. Expanding the phenotype associated with NAA10-related N-terminal acetylation deficiency. Hum. Mutat. 37, 755–764 (2016).
Cheng, H. et al. Phenotypic and biochemical analysis of an international cohort of individuals with variants in NAA10 and NAA15. Hum. Mol. Genet. 28, 2900–2919 (2019).
Ward, T. et al. Mechanisms of congenital heart disease caused by NAA15 Haploinsufficiency. Circ. Res. 128, 1156–1169 (2021).
Ritter, A. et al. Variants in NAA15 cause pediatric hypertrophic cardiomyopathy. Am. J. Med. Genet. A 185, 228–233 (2021).
McTiernan, N. et al. Biochemical analysis of novel NAA10 variants suggests distinct pathogenic mechanisms involving impaired protein N-terminal acetylation. Hum. Genet. 141, 1355–1369 (2022).
Lyon, G. J. et al. Expanding the phenotypic spectrum of NAA10-related neurodevelopmental syndrome and NAA15-related neurodevelopmental syndrome. Eur. J. Hum. Genet. 31, 824–833 (2023).
Morrison, J. et al. Missense NAA20 variants impairing the NatB protein N-terminal acetyltransferase cause autosomal recessive developmental delay, intellectual disability, and microcephaly. Genet. Med. 23, 2213–2218 (2021).
D’Onofrio, G. et al. Novel biallelic variants expand the phenotype of NAA20-related syndrome. Clin. Genet. 104, 371–376 (2023).
Varland, S., Brønstad, K. M., Skinner, S. J. & Arnesen, T. A nonsense variant in the N-terminal acetyltransferase NAA30 may be associated with global developmental delay and tracheal cleft. Am. J. Med. Genet. A 191, 2402–241 (2023).
Muffels, I. J. J. et al. NAA80 bi-allelic missense variants result in high-frequency hearing loss, muscle weakness and developmental delay. Brain Commun. 3, fcab256 (2021).
Drazic, A. et al. NAA80 is actin’s N-terminal acetyltransferase and regulates cytoskeleton assembly and cell motility. Proc. Natl. Acad. Sci. USA 115, 4399–4404 (2018).
Taglia, I. et al. Primary familial brain calcification: genetic analysis and clinical spectrum. Mov. Disord. 29, 1691–1695 (2014).
Takashima, S. & Becker, L. E. Basal ganglia calcification in Down’s syndrome. J. Neurol. Neurosurg. Psychiatry 48, 61–64 (1985).
Vermersch, P., Leys, D., Pruvo, J. P., Clarisse, J. & Petit, H. Parkinson’s disease and basal ganglia calcifications: prevalence and clinico-radiological correlations. Clin. Neurol. Neurosurg. 94, 213–217 (1992).
Hashimoto, N. et al. Glial fibrillary tangles in diffuse neurofibrillary tangles with calcification. Acta Neuropathol. 106, 150–156 (2003).
Smedley, D. et al. 100,000 genomes pilot on rare-disease diagnosis in health care - preliminary report. N. Engl. J. Med. 385, 1868–1880 (2021).
Li, H. & Durbin, R. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 26, 589–595 (2010).
McKenna, A. et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 20, 1297–1303 (2010).
Van der Auwera, G. A. et al. From FastQ data to high confidence variant calls: the Genome Analysis Toolkit best practices pipeline. Curr. Protoc. Bioinformatics 43, 11.10.1–33 (2013).
DePristo, M. A. et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat. Genet. 43, 491–498 (2011).
Danecek, P. & McCarthy, S. A. BCFtools/csq: haplotype-aware variant consequences. Bioinformatics 33, 2037–2039 (2017).
Yang, H. & Wang, K. Genomic variant annotation and prioritization with ANNOVAR and wANNOVAR. Nat. Protoc. 10, 1556–1566 (2015).
Lek, M. et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature 536, 285–291 (2016).
Yu, J. et al. SVRare: discovering disease-causing structural variants in the 100K Genomes Project. medRxiv, https://www.medrxiv.org/content/10.1101/2021.10.15.21265069v1. (2022).
Seelow, D., Schuelke, M., Hildebrandt, F. & Nürnberg, P. HomozygosityMapper–an interactive approach to homozygosity mapping. Nucleic Acids Res. 37, W593–W599 (2009).
Tompson, S. W. & Young, T. L. Assaying the effects of splice site variants by exon trapping in a mammalian cell line. Bio Protoc. 7, e2281 (2017).
van der Knoop, M. M. et al. Biallelic ADAM22 pathogenic variants cause progressive encephalopathy and infantile-onset refractory epilepsy. Brain 145, 2301–2312 (2022).
Stove, S. I. et al. Crystal structure of the golgi-associated human nalpha-acetyltransferase 60 reveals the molecular determinants for substrate-specific acetylation. Structure 24, 1044–1056 (2016).
Foyn, H., Thompson, P. R. & Arnesen, T. DTNB-based quantification of in vitro enzymatic N-terminal acetyltransferase activity. Methods Mol. Biol. 1574, 9–15 (2017).
Starheim, K. K. et al. Identification of the human N(alpha)-acetyltransferase complex B (hNatB): a complex important for cell-cycle progression. Biochem. J. 415, 325–331 (2008).
Taglia, I. et al. Primary familial brain calcification with a novel SLC20A2 mutation: analysis of PiT-2 expression and localization. J. Cell Physiol. 233, 2324–2331 (2018).
Cassinari, K. et al. Haploinsufficiency of the primary familial brain calcification gene SLC20A2 mediated by disruption of a regulatory element. Mov. Disord. 35, 1336–1345 (2020).
Human genomics. The genotype-tissue expression (GTEx) pilot analysis: multitissue gene regulation in humans. Science 348, 648–660 (2015).
Johnson, W. E., Li, C. & Rabinovic, A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics 8, 118–127 (2007).
Botia, J. A. et al. An additional k-means clustering step improves the biological features of WGCNA gene co-expression networks. BMC Syst. Biol. 11, 47 (2017).
Langfelder, P. & Horvath, S. WGCNA: an R package for weighted correlation network analysis. BMC Bioinformatics 9, 559 (2008).
Reimand, J., Kull, M., Peterson, H., Hansen, J. & Vilo, J. g:Profiler–a web-based toolset for functional profiling of gene lists from large-scale experiments. Nucleic Acids Res. 35, W193–W200 (2007).
Acknowledgements
The authors would like to thank the participants and their families for their essential help with this work. This research was made possible through access to the data and findings generated by the 100,000 Genomes Project. The 100,000 Genomes Project is managed by Genomics England Limited (a wholly owned company of the Department of Health and Social Care). The 100,000 Genomes Project is funded by the National Institute for Health and Care Research and NHS England. The Wellcome Trust, Cancer Research UK, and the Medical Research Council have also funded the research infrastructure. The 100,000 Genomes Project uses data provided by patients and collected by the National Health Service as part of their care and support. The Solve-RD project has received funding from the European Union’s Horizon 2020 research and innovation program under Grant Agreement No 779257. H.H. was supported by the MRC (MR/S01165X/1, MR/S005021/1, MRC ICGNMD), Wellcome Trust (221951/Z/20/Z), GP2 ASAP, Michael J Fox Foundation (MJFF), The National Institute for Health Research University College London Hospitals Biomedical Research Center, Rosetree Trust, MSA Trust, MSA Coalition, Brain Research UK, Sparks GOSH Charity, Muscular Dystrophy UK (MDUK). V.C. was supported by the Association of British Neurologists’ Academic Clinical Training Research Fellowship (grant ABN 540868) and The Guarantors of Brain (grant 565908). Members of the Arnesen lab are acknowledged for helpful inputs to this study. T.A. acknowledges support from the Research Council of Norway (Project 249843), the Norwegian Health Authorities of Western Norway (Project F-12540), the Norwegian Cancer Society (Project 171752—PR-2009-0222), and the European Research Council (ERC) under the European Union Horizon 2020 Research and Innovation Program under Grant 772039. Microscopy using a Leica TCS SP8 STED 3x confocal microscope was performed at the Molecular Imaging Center (MIC), Department of Biomedicine, University of Bergen. R.H. is a Wellcome Trust Investigator (109915/Z/15/Z), who receives support from the Medical Research Council (UK) (MR/N025431/1 and MR/V009346/1), the European Research Council (309548), the Newton Fund (UK/Turkey, MR/N027302/1), the Addenbrookes Charitable Trust (G100142), the Evelyn Trust, the Stoneygate Trust, the Lily Foundation and an MRC strategic award to establish an International Center for Genomic Medicine in Neuromuscular Diseases (ICGNMD) MR/S005021/1, the NIHR Cambridge Biomedical Research Center (BRC-1215-20014). G.N. acknowledges support from the French National Research Agency (CALCIPHOS, ANR-17-CE14–0008–02), Conseil Régional de Haute-Normandie (APERC 2014 no. 2014–19 in the context of Appel d’Offres Jeunes Chercheurs, CHU de Rouen), Région Normandie and the European Union (Recherche Innovation Normandie - RIN 2018; Europe is involved in Normandie with the European Regional Development Fund (ERDF)). Part of this work is a collaboration between CEA-DRF-Jacob-CNRGH-CHU de Rouen. J.F.D. acknowledges support for France Génomique National infrastructure, funded as part of the “Investissements d’Avenir” program managed by the AgenceNationale pour la Recherche (contract ANR-10-INBS-09). J.L.B was supported by the French National Research Agency (CALCIPHOS, ANR-17-CE14–0008–01). Y.J.C. acknowledges a state subsidy managed by the National Research Agency (France) under the “Investments for the Future” (ANR-10-IAHU-01) and funding from the MRC (Grant code: MC_UU_00035/11). B.V. acknowledges support from the Deutsche Forschungsgemeinschaft (DFG) through the Multiscale Bioimaging Cluster of Excellence (MBExC) and DFG VO 2138/7‐1 grant 469177153. BV is a member of the European Reference Network on Rare Congenital Malformations and Rare Intellectual Disability (ERN-ITHACA) (EU Framework Partnership Agreement ID: 3HP-HP-FPA ERN-01-2016/739516). NIH R35 GM142433 to A.M.E. The views expressed are those of the authors and not necessarily those of the NIHR or the Department of Health and Social Care.
Author information
Authors and Affiliations
Consortia
Contributions
V.C. conceived the study. V.C., H.A., T.A. and H.H. jointly designed the study. V.C., H.A., L.C.L., L.S., P.D., R.M., J.V., D.M., N.M.Z., A-C.R., O.Q., A.B., R.K., V.S., S.E., A.Sc., L.V.S., H.M., A.T., A.T.P., A.P., A.Si., L.S.K., K.M.B., A.K.B., A.C., N.G., AM. DL., R.I., P.B., G.Z., F.S.A., F.Al., H.E.S., F.Ab., JL. B., S.T., A.B., R.O., JF.D., M.A., B.C., B.V., S.G., S.H.K., H.L., S.I. D, K.A.F., N.W.W., R.H., A.M.E., M.M., Y.J.C., G.N. L.G.P., J.B. performed the experiments. V.C., H.A., L.C.L., L.S., P.D., R. M, J.V., D.M. N.M.Z., A-C.R., O.Q., A.B., R.K., V.S., S.E., L.V.S., H.M., A.T., A.T.P., A.P., L.S.K., K.M.B., A.K.B., A.C., N.G., AM. DL., A.Si., R.I., P.B., G.Z., F.S.A., F.Al., H.E.S., F.Ab., JL.B., S.T., A.B., R.O., JF.D., M.A., B.C., B.V., S.G., S.H.K., H.L., S.I. D, K.A.F., N.W.W., R.H., A.M.E., M.M., Y.J.C., G.N. L.G.P., J.B. collected and analyzed data. V.C., H.A., prepared the original manuscript draft. V.C., H.A., L.C.L., L.S., P.D., R. M, J.V., D.M. A-C.R., O.Q., A.B., N.M.Z., R.K., V.S., S.E., L.V.S., A.Si., H.M., A.Sc., A.T., A.T.P., A.P., L.S.K., K.M.B., N.G., JL. B., S.T., A.B., R.O., JF.D., M.A., H.E.S., B.C., B.V., S.G., S.H.K., H.L., S.I. D, K.A.F., N.W.W., R.H., A.M.E., J.E.R., M.M., Y.J.C., F.S.A, G.N., T.A., H.H. reviewed and provided editing advised on the final manuscript. All authors discussed the results and implications and commented on the manuscript at all stages.
Corresponding authors
Ethics declarations
Competing interests
P.D. is an orator and scientific board member for Gilead and an orator for Novartis. All other authors declare no competing interests.
Peer review
Peer review information
Nature Communications thanks Andrea Legati, João Ricardo de Oliveira and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Source data
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Chelban, V., Aksnes, H., Maroofian, R. et al. Biallelic NAA60 variants with impaired n-terminal acetylation capacity cause autosomal recessive primary familial brain calcifications. Nat Commun 15, 2269 (2024). https://doi.org/10.1038/s41467-024-46354-0
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-024-46354-0
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.