Amyloid beta 42 alters cardiac metabolism and impairs cardiac function in male mice with obesity

Hall, Liam G.; Czeczor, Juliane K.; Connor, Timothy; Botella, Javier; De Jong, Kirstie A.; Renton, Mark C.; Genders, Amanda J.; Venardos, Kylie; Martin, Sheree D.; Bond, Simon T.; Aston-Mourney, Kathryn; Howlett, Kirsten F.; Campbell, James A.; Collier, Greg R.; Walder, Ken R.; McKenzie, Matthew; Ziemann, Mark; McGee, Sean L.

doi:10.1038/s41467-023-44520-4

Download PDF

Article
Open access
Published: 15 January 2024

Amyloid beta 42 alters cardiac metabolism and impairs cardiac function in male mice with obesity

Nature Communications volume 15, Article number: 258 (2024) Cite this article

2628 Accesses
40 Altmetric
Metrics details

Subjects

Abstract

There are epidemiological associations between obesity and type 2 diabetes, cardiovascular disease and Alzheimer’s disease. The role of amyloid beta 42 (Aβ₄₂) in these diverse chronic diseases is obscure. Here we show that adipose tissue releases Aβ₄₂, which is increased from adipose tissue of male mice with obesity and is associated with higher plasma Aβ₄₂. Increasing circulating Aβ₄₂ levels in male mice without obesity has no effect on systemic glucose homeostasis but has obesity-like effects on the heart, including reduced cardiac glucose clearance and impaired cardiac function. The closely related Aβ₄₀ isoform does not have these same effects on the heart. Administration of an Aβ-neutralising antibody prevents obesity-induced cardiac dysfunction and hypertrophy. Furthermore, Aβ-neutralising antibody administration in established obesity prevents further deterioration of cardiac function. Multi-contrast transcriptomic analyses reveal that Aβ₄₂ impacts pathways of mitochondrial metabolism and exposure of cardiomyocytes to Aβ₄₂ inhibits mitochondrial complex I. These data reveal a role for systemic Aβ₄₂ in the development of cardiac disease in obesity and suggest that therapeutics designed for Alzheimer’s disease could be effective in combating obesity-induced heart failure.

Dysregulation of amyloid precursor protein impairs adipose tissue mitochondrial function and promotes obesity

Article 13 December 2019

High-fat diet-induced diabetes couples to Alzheimer’s disease through inflammation-activated C/EBPβ/AEP pathway

Article 11 May 2022

E4orf1 improves adipose tissue-specific metabolic risk factors and indicators of cognition function in a mouse model of Alzheimer’s disease

Article Open access 12 August 2023

Introduction

Epidemiological evidence has identified associations between obesity, Alzheimer’s disease (AD) and cardiovascular disease^1,2,3. Common underlying aetiological factors such as inflammation, hypertension and hormonal alterations have all been implicated, however, the exact mechanisms involved remain largely unexplored. Another potential molecular link are amyloid beta peptides (Aβ), a putative pathogenic driver of AD⁴. Aβ peptides, ranging from 36-44 amino acids in length, are derived by proteolytic processing of the trans-membrane amyloid precursor protein (APP)⁵. Initial cleavage by either α- or β-secretases commits APP to the non-amyloidogenic or amyloidogenic pathways, respectively⁵. Following cleavage by the β-secretase BACE1, the remaining β-C-terminal fragment of APP can be cleaved by γ-secretase, which produces Aβ peptides that are released into the extracellular space via exocytosis⁵. Aβ peptides of 40 and 42 amino acids (Aβ₄₀ and Aβ₄₂) are the most common and Aβ₄₂ has a particular propensity to aggregate and form oligomers⁴. The oligomerisation state of Aβ₄₂, which is highly dynamic and stochastic, impacts its function and ability to interact with numerous cell surface receptors^6,7,8. Extracellular Aβ₄₂ can also be internalised and interact with organelles, intracellular signalling molecules and enzymes, disrupting normal cellular function⁹.

Accumulation of Aβ₄₂ in the central nervous system is linked with alterations in metabolism, including impairments in glucose uptake^10,11, glucose utilisation¹² and aspects of mitochondrial function^13,14,15,16 in several different cell types. APP and its proteolytic processing pathways are expressed in peripheral tissues and Aβ peptides are found in plasma¹⁷. The expression of APP is increased in adipose tissue of humans affected by obesity¹⁸ and APP overexpression in adipose tissue of mice causes adiposity and insulin resistance due to impaired adipocyte mitochondrial function¹⁹. Circulating concentrations of Aβ₄₂ correlate with fat mass, however whether circulating Aβ₄₂ regulates peripheral metabolism, particularly in the context of obesity, remains largely unexplored. This study aimed to determine whether Aβ₄₂ is released by adipose tissue and whether this is increased in obesity. Finally, this study also sought to determine the metabolic consequences of persistently increased circulating levels of Aβ₄₂. Here we show that adipose tissue releases Aβ₄₂, which is increased in obesity and associates with higher plasma Aβ₄₂. We also show that increases in plasma Aβ₄₂ negatively impact cardiac metabolism and function and that Aβ₄₂ accumulates in cardiac mitochondria and inhibits complex I of the respiratory chain. Antagonising Aβ₄₂ with a neutralising antibody prevents obesity-induced defects in cardiac function and prevents further decline of cardiac function in established obesity. These findings enhance our understanding of the impact of obesity on the heart and provide a rationale for the repurposing of AD therapies for the treatment of heart failure.

Results

Aβ₄₂ is released from adipose tissue, which is increased in obesity

To better understand the proteolytic processing of APP in the periphery in obesity, the expression and activity of APP and components of the amyloidogenic pathway were assessed in tissues from control and diet-induced obese mice, which had increased total fat mass and increased mass of individual fat pads (Supplementary Fig. 1a, b). The expression of App was increased in adipose tissue of obese mice, but not in the liver or skeletal muscle (Fig. 1a). Similarly, Bace1 (Fig. 1b) and Psen1 (Fig. 1c), which encodes the presenilin 1 subunit of γ-secretase, were also increased in adipose tissue of obese mice, but not in the liver or skeletal muscle. The activity of BACE1 was increased in adipose tissue and reduced in the liver of obese mice (Fig. 1d). Adipose tissue explants were found to release both Aβ₄₀ and Aβ₄₂ but this was not different between control and obese mice when expressed relative to explant mass (Fig. 1e). However, when accounting for total fat pad mass, adipose tissue of obese mice released more Aβ₄₀ and Aβ₄₂ (Fig. 1f). Release of Aβ₄₂ was inhibited by incubation of explants with Brefeldin A (BFA; Supplementary Fig. 1c), an inhibitor of exocytosis²⁰, indicating that adipose tissue actively secretes Aβ isoforms. The plasma concentration of Aβ₄₂, but not Aβ₄₀, was elevated in obese mice (Fig. 1g). Similar to findings in humans²¹, plasma Aβ₄₂ was significantly correlated with fat mass (Supplementary Fig. 1d) but not with lean mass (Supplementary Fig. 1e). Together these data show that Aβ isoforms are released from adipose tissue, which is associated with elevated circulating Aβ₄₂ in obesity.

**Fig. 1: Ab₄₂ is released from adipose tissue, which is increased in obesity.**

Aβ₄₂ administration reprograms cardiac glucose metabolism

To examine the effect of increased circulating Aβ₄₂ on systemic metabolism, mice were administered Aβ₄₂ or a peptide corresponding to a scrambled Aβ₄₂ sequence (ScrAβ₄₂; 1μg/day i.p.) for 4 weeks (Fig. 2a). Recombinant human Aβ₄₂ was used as it has a greater propensity to aggregate than the mouse sequence and is more likely to reveal any pathological effects of raised Aβ₄₂ concentrations²². These Aβ₄₂ peptides appeared as monomers and low molecular weight aggregates by SDS-PAGE (Supplementary Fig. 2a). This administration regimen increased plasma Aβ₄₂ ~ 4-fold (Fig. 2b) but had no effect on body weight (Fig. 2c) or composition (Supplementary Fig. 2b, c). Similarly, Aβ₄₂ administration had no effect on blood glucose during both insulin (Fig. 2d) and glucose tolerance tests (GTT; Fig. 2e), or on glucose-stimulated insulin secretion (Supplementary Fig. 2d). However, further analysis of glucose fate throughout the GTT using both 2-²H-deoxyglucose and 1-¹⁴C-glucose tracers revealed that glucose clearance by the heart was reduced in mice administered Aβ₄₂ (Fig. 2f). In contrast, there were no differences in glucose clearance by skeletal muscle or adipose tissue (Supplementary Fig. 2e). Furthermore, in mice administered Aβ₄₂ glucose incorporation into lipids was increased (Fig. 2g), which was associated with a trend (p = 0.0830) towards increased cardiac triglycerides (TG; Supplementary Fig. 2f). These alterations in cardiac metabolism in mice administered Aβ₄₂ were independent of changes in plasma free fatty acids and lipids (Supplementary Fig. 2g–j). These data show that increasing systemic Aβ₄₂ alters cardiac glucose metabolism.

**Fig. 2: Aβ₄₂ administration reprograms cardiac metabolism.**

Aβ₄₂ administration induces cardiac dysfunction

Obesity results in reprogramming of cardiac metabolism that includes impaired glucose uptake and oxidation for a given insulin concentration²³. These alterations in cardiac metabolism have been linked to impairments in cardiac relaxation and left ventricular (LV) filling²⁴. Although increased filling pressures can overcome this diastolic dysfunction in early phases of the disease²⁵, longer-term consequences include LV hypertrophy and eventual heart failure²⁵. This form of heart failure most commonly manifests as heart failure with preserved ejection fraction (HFpEF)^25,26. Hence, obesity-induced alteration of cardiac metabolism is a precipitating event leading to obesity-induced heart failure^24,25. Given the effect of Aβ₄₂ on cardiac metabolism, the effect of Aβ₄₂ on cardiac function was examined by echocardiography (Supplementary Fig. 3a). Administration of Aβ₄₂ had wide-ranging effects on cardiac function, including impaired diastolic function, represented by increased deceleration time (Fig. 3a) and reduced E:A ratio (Fig. 3b), indicating impairments in cardiac relaxation. Furthermore, mice administered Aβ₄₂ displayed evidence of impaired systolic function, including reduced ejection fraction (Fig. 3c) and fractional shortening (Fig. 3d). Mice administered Aβ₄₂ had largely normal cardiac morphology when compared with mice administered ScrAβ₄₂ (Supplementary Table 1). To better understand how Aβ₄₂ impairs cardiac function, profiling of genes that are differentially expressed in human heart failure specifically in the major cell types of the heart²⁷ was performed. In hearts of mice administered Aβ₄₂, there was a significant increase in the expression of Nppa (Fig. 3e), which encodes natriuretic peptide A, and is increased in cardiomyocytes in human heart failure²⁷. In contrast, there were no changes in the expression of Fap, Itga1, Rora and Fgfr1, which are increased in heart failure in cardiac fibroblasts, pericytes, smooth myocytes and endothelial cells, respectively²⁷. Together, these data indicate that Aβ₄₂ impairs cardiac function, likely through effects on cardiomyocytes.

In the context of AD, Aβ₄₂ is considered the most pathogenic of the Aβ peptides because of its propensity to aggregate²⁸. However, Aβ₄₀ is also found in plasma^17,29. To determine whether Aβ₄₀ also has deleterious effects on the heart, mice were administered Aβ₄₀ (1μg/day i.p.) for 4 weeks followed by echocardiographic assessment of cardiac function and morphology, as was performed for Aβ₄₂. Administration of Aβ₄₀ markedly increased the circulating concentration of Aβ₄₀ (Supplementary Fig. 3b) but had no effect on body weight and composition (Supplementary Fig. 3c–e), and had no effect on any index of cardiac function or morphology (Supplementary Table 2 and Supplementary Fig. 3f). Together with our previous findings, these data suggest that circulating Aβ₄₂, but not Aβ₄₀, has deleterious effects on the heart.

An Aβ neutralising antibody prevents obesity-induced impairment of cardiac relaxation

Having established that Aβ₄₂ release from adipose tissue is increased in obesity and that raising systemic concentrations of Aβ₄₂ negatively impacts cardiac metabolism and function, we next sought to determine whether Aβ₄₂ impairs cardiac relaxation in obesity, which is the initial defect in cardiac function that ultimately leads to heart failure³⁰. We and others have previously established that deletion of App or components of the APP proteolytic machinery in mice increases energy expenditure and confers resistance to obesity^31,32. Hence, these genetic models cannot be used to assess the role of Aβ₄₂ on cardiac function in obesity. Instead, the mouse-specific Aβ neutralising antibody 3D6 was employed to address this question. The binding of 3D6 to Aβ₄₂ prevents Aβ₄₂ interacting with receptors and the cellular internalisation of Aβ₄₂³³. The humanised version of 3D6, bapineuzumab, reached phase III trials for AD³⁴. Although it had excellent target engagement and an acceptable safety profile, it failed to produce meaningful improvements in cognition in AD patients³⁴. Cardiovascular conditions were exclusion criteria for this and other AD trials, meaning that data on any potential cardiovascular effects are not available. Therefore, to determine whether Aβ₄₂ mediates the adverse effects of obesity on cardiac function, mice were fed a high-fat diet and were simultaneously administered 3D6 or a control antibody (0.75 mg/kg, i.p. once weekly) for a period of 4 months. Cardiac function and morphology were assessed by echocardiography at the beginning and conclusion of the experiment (Fig. 4a, Supplementary Fig. 4a). The initiating event in the development of obesity-induced cardiac dysfunction and eventual heart failure is impaired cardiac relaxation, which is characterised by increased deceleration time^35,36,37. We have previously observed impairments in deceleration time in this model between 3-4 months of high-fat feeding³⁸. Consistent with previous studies³⁹, 3D6 administration did not reduce total plasma Aβ₄₂ concentration (Fig. 4b) but did reduce the plasma concentration of free Aβ₄₂ that was unbound by antibodies (Fig. 4c). Administration of 3D6 had no effect on body weight (Fig. 4d), body composition or systemic metabolism (Supplementary Fig. 4b–f). In mice administered control antibody, deceleration time increased over the course of the high-fat feeding period (Fig. 4e). In contrast, deceleration time was not increased in mice administered 3D6 (Fig. 4e). The same result was observed when deceleration time was normalised as a percentage of the cardiac cycle (Supplementary Fig. 4g). Although initial estimated LV mass was not matched (but was not statistically different) between groups, LV mass was increased throughout the study in mice administered control antibody but was unchanged in mice administered 3D6 (Fig. 4f). A similar finding in left ventricular posterior wall thickness at diastole (LVPWd; Supplementary Table 3), an alternate index of LV mass⁴⁰, was observed. These data suggest that systemic Aβ₄₂ contributes to the obesity-induced impairment in cardiac relaxation and increase in LV mass.

**Fig. 4: An Aβ₄₂ neutralising antibody prevents obesity-induced impairment of cardiac relaxation.**

An Aβ neutralising antibody prevents further impairment of cardiac relaxation in established obesity

The finding that Aβ₄₂ antagonism prevents obesity-induced impairment of cardiac relaxation raises the possibility that targeting Aβ₄₂ could be an effective treatment for established obesity-induced cardiac dysfunction. To test this hypothesis, mice were fed either standard chow or a high fat diet for 4 months and were administered 3D6 or control antibodies for the final 4 weeks of the experiment. Echocardiography to assess cardiac function and morphology was performed at the beginning of the experiment (baseline), prior to antibody treatment (pre-treatment) and at the conclusion of the study (post-treatment; Fig. 5a, Supplementary Fig 5a). Mice fed a high-fat diet had increased body weight (Fig. 5b), fat mass and fasting plasma insulin compared with chow-fed mice; however, 3D6 administration had no effect on these parameters (Supplementary Fig. 5b–e). There was no change in deceleration time in chow fed mice administered control antibody throughout the experiment (Fig. 5c). Mice fed high fat diet and administered control antibody had an increase in deceleration time from baseline to pre-treatment, which increased further from pre-treatment to post-treatment (Fig. 5c). Mice fed high fat diet and administered 3D6 antibody had an increase in deceleration time from baseline to pre-treatment, however unlike mice administered control antibody, there was no further increase in deceleration time from pre-treatment to post-treatment (Fig. 5c). These findings were consistent when deceleration time was expressed as a percentage of the cardiac cycle (Supplementary Fig. 5f). Short term administration of 3D6 in established obesity did not alter any index of LV mass (Supplementary Table 4) but tended to increase cardiac glucose clearance (Fig. 5d and Supplementary Fig. 5g) and normalised cardiac TG concentrations (Fig. 5e). These data suggest that Aβ₄₂ antagonism halts further deterioration of cardiac relaxation in established obesity.

**Fig. 5: An Aβ₄₂ neutralising antibody prevents further impairment of cardiac relaxation in established obesity.**

Aβ₄₂ reduces mitochondrial transcriptional programs and accumulates in cardiac mitochondria in obesity

In the context of AD, Aβ₄₂ has highly complex cellular effects through a myriad of mechanisms depending on the target cell type and its aggregation state⁴¹. To gain unbiased insights into the deleterious effects that Aβ₄₂ has on the heart, a multidimensional transcriptomic approach was employed. The transcriptomic profile of hearts obtained in Aβ₄₂ administration studies (Fig. 2a) were compared with the profile of hearts obtained in the 3D6 administration study (Fig. 4a) and pathways reciprocally regulated were identified using MITCH⁴². It was reasoned that reciprocally regulated pathways from these experiments represent geneset changes that are fundamental to the effects of Aβ₄₂ on the heart. Global gene expression across experiments was evenly distributed (Supplementary Fig. 6a and b). Multi-contrast enrichment analysis identified the TCA cycle, pyruvate metabolism and mitochondrial biogenesis pathways with the largest effect sizes that were reduced by Aβ₄₂ administration and increased by 3D6 administration (Fig. 6a and Supplementary Table 5). These pathways are dysregulated in obesity-induced cardiac dysfunction and have been linked with disrupted energetics that impair cardiac relaxation^24,43,44,45. The transcriptional reprogramming of the TCA cycle included altered regulation of genes encoding TCA cycle enzymes (Fig. 6b), while transcriptional regulation of pyruvate metabolism included subunits of pyruvate dehydrogenase (PDH) and PDH kinases (PDKs; Fig. 6c). Regulated genes in the mitochondrial biogenesis pathway were mainly of nuclear transcription factors controlling the mitochondrial biogenesis process (Fig. 6d). Interestingly, several receptor pathways were increased by Aβ₄₂ administration and reduced by 3D6 administration (Fig. 6a and Supplementary Table 5). The widespread transcriptional reprogramming of mitochondrial pathways likely indicates a secondary response to the effects of Aβ₄₂ on mitochondria. Aβ₄₂ can be taken up by mitochondria, where it can impact numerous aspects of mitochondrial biology^15,46,47. To examine whether Aβ₄₂ accumulates in mitochondria of the heart in obesity, enriched mitochondrial fractions were isolated from control and obese mice (Fig. 6e). Cardiac mitochondria from obese mice were found to have elevated concentrations of Aβ₄₂ (Fig. 6f). Interestingly, mitochondrial Aβ₄₂ was also increased in the skeletal muscle of obese mice, but not in adipose tissue or in the liver (Supplementary Fig. 6c), suggesting that striated muscle specifically has a propensity to accumulate Aβ₄₂ in obesity. Furthermore, Aβ₄₂ concentrations were reduced in cardiac mitochondria in obese mice that were administered 3D6 antibodies (Fig.6g), consistent with reports that this antibody enhances tissue Aβ clearance⁴⁸.

**Fig. 6: Aβ₄₂ impairs mitochondrial transcriptional programs and accumulates in cardiac mitochondria in obesity.**

Aβ₄₂ inhibits mitochondrial complex I in cardiomyocytes

Identification of the mitochondrial target of Aβ₄₂ was further explored. Upon cellular uptake and mitochondrial import, Aβ₄₂ is known to physically interact with and inhibit complex I of the respiratory chain⁴⁹. Complex I is a candidate target for Aβ₄₂ in the context of obesity, which is characterised by reduced complex I function in the heart^43,50,51. As gene expression profiling suggested that the effects of Aβ₄₂ on mitochondria were specific for cardiomyocytes (Fig. 2l), a primary neonatal ventricular cardiomyocyte model system was used to examine whether Aβ₄₂ inhibits complex I in cardiomyocytes. Exposure of cardiomyocytes to increasing concentrations of Aβ₄₂ for 48hrs reduced cardiomyocyte oxygen consumption rate (OCR; Fig. 7a) as well as maximal respiratory capacity (Fig. 7b). This was not explained by a loss of cell viability (Supplementary Fig. 7a) and indicate that Aβ₄₂ has direct effects on cardiomyocytes. Exposure of Aβ₄₂ to FAO hepatocytes did not have any effect on basal respiration (Supplementary Fig. 7b), suggesting cell type-specific effects of Aβ₄₂. Sensitivity to the complex I inhibitor rotenone (Fig. 7c), but not the unrelated ATP synthase inhibitor oligomycin (Supplementary Fig 7c), was altered following exposure of cardiomyocytes to Aβ₄₂ and was associated with reduced complex I-mediated respiration (Fig. 7d). To dissect whether the effects of Aβ₄₂ on complex I could be explained by the reduction in respiratory capacity, complex I-mediated respiration was expressed relative to maximal respiratory capacity and was reduced by exposure to Aβ₄₂ (Fig. 7e). This provides further evidence that Aβ₄₂ inhibits complex I of the respiratory chain as well as reducing mitochondrial capacity in cardiomyocytes, both of which have been observed in heart failure^43,51,52,53. These findings suggest that systemic Aβ₄₂ is internalised and taken up by mitochondria in cardiomyocytes, where it can impair mitochondrial respiratory function.

Discussion

Our findings have revealed an unexpected role for Aβ₄₂ in the aetiology of obesity-induced cardiac dysfunction (Fig. 7f). Factors such as increased adiposity, myocardial lipid accumulation and cardiomyocyte mitochondrial dysfunction have all been implicated in the development of diastolic dysfunction in obesity. Data generated in the present study indicates that Aβ₄₂ is a unifying link between all of these factors and is supported by a recent study, published while the current manuscript was in preparation, proving the association between circulating Aβ and heart failure in the general population⁵⁴. Our data advances our understanding of the impact of obesity on the heart and identify an actionable target for therapeutic intervention in obesity-induced heart failure.

In humans, both total fat mass and visceral fat mass are associated with impaired myocardial energetics and diastolic dysfunction²⁴. Although increased free fatty acid availability that leads to myocardial lipid accumulation is one potential mechanism describing this association, diastolic dysfunction in humans occurs with moderate visceral adiposity before the appearance of myocardial lipid accumulation²⁴. One interpretation of these data is that factors released by adipose tissue other than fatty acids, such as Aβ₄₂, are more important contributors to obesity-induced diastolic dysfunction. While adipose tissue could be a major source of Aβ₄₂ in obesity, the exact cell types involved remain obscure. In addition to adipocytes, vascular endothelial cells and immune cells, which infiltrate adipose tissue in obesity, are all candidate cell types that express high levels of APP and the APP processing machinery and could release Aβ peptides, particularly under metabolic conditions associated with obesity^55,56,57.

Increasing systemic Aβ₄₂ reprogrammed cardiac glucose metabolism, including reduced glucose clearance and increasing glucose incorporation into lipids. It is well established that impairments in cardiac glucose metabolism are associated with impairments in cardiac function^58,59,60,61. Consistent with these findings, administration of Aβ₄₂ to normal mice resulted in wide-ranging defects in both diastolic and systolic function. However, the early stages of obesity, in both mice and humans, are generally not associated with systolic dysfunction, despite elevated circulating Aβ₄₂. This discrepancy is likely due to whole-body metabolic and hormonal alterations in obesity that minimise the impact of Aβ₄₂ on the heart, restricting its effects to relaxation defects that manifest as diastolic dysfunction.

While preparing this manuscript, it was reported that plasma concentrations of both Aβ₄₂ and Aβ₄₀ are associated with heart failure in the general population, particularly in males⁵⁴. While the association was stronger for Aβ₄₀, this could be due to the greater propensity for Aβ₄₂ to leave the circulation and accumulate in vascular beds and in tissues⁶². Indeed, in our administration studies, the delivery of equal amounts of Aβ₄₀ and Aβ₄₂ resulted in a greater plasma excursion of Aβ₄₀ (Fig. 2b and Supplementary Fig. 3b). Our findings are also consistent with associative observations in patients with AD, whereby Aβ₄₂ accumulates in the heart and is associated with diastolic dysfunction⁶³.

The accumulation of Aβ₄₂ in cardiac mitochondria and the Aβ₄₂-mediated reduction in complex I-associated respiration in cardiomyocytes phenocopies aspects of Aβ₄₂ biology in AD. A recent study suggests that other aspects of mitochondrial function are also impacted by Aβ₄₂ in cardiomyocytes⁶⁴. The extent to which the effects of Aβ₄₂ on complex I account for the metabolic and contractile impairments that occur in cardiomyocytes in obesity in vivo remains to be determined. However, we hypothesise that complex I is a major site of metabolic impairment in the heart in obesity and could explain the defects in glucose oxidation that are observed in heart failure. Complete oxidation of glucose primarily generates NADH as the intermediate electron carrier, which is oxidise by complex I of the respiratory chain. In contrast, beta-oxidation of fatty acids generates substantial FADH₂ that is oxidised by complex II of the respiratory chain and complex I inhibition increases fatty acid oxidation in a variety of cell types^65,66,67. A limitation of the current study is that the effect of Aβ₄₂ on mitochondria was examined in neonatal cardiomyocytes. This model was used rather than adult cardiomyocytes, as the latter are prone to extensive cell death and alterations in cellular identity in the first 24-48 hr of culturing⁶⁸, which could confound the effects of Aβ₄₂. It is well established that neonatal cardiomyocytes oxidise proportionally more glucose and less fatty acids than adult cardiomyocytes⁶⁹. Therefore, further studies examining how Aβ₄₂ impacts mitochondrial substrate utilisation are warranted. As adult primary cardiomyocytes quickly de-differentiate and reprogram mitochondrial capacity accordingly⁷⁰, sophisticated studies in vivo will be required to properly dissect the metabolic effects of Aβ₄₂ on cardiomyocytes and the heart.

This study supports the idea that therapies originally designed for AD that reduce or antagonise Aβ₄₂ could be repurposed to treat and/or prevent obesity-induced heart failure⁷¹, particularly those with HFpEF, for which treatment options are limited²⁵. This is an urgent unmet need as this patient group has a 5-year mortality rate of up to 75% and currently affects up to 8% of people in certain populations³⁰. Furthermore, the prevalence of HFpEF is predicted to rise in parallel with rising rates of obesity³⁰. A suite of biologics and small molecules has been developed for AD that antagonise or reduce Aβ₄₂, many with well-established safety and tolerability profiles in humans. These diverse therapies with distinct mechanisms of action could therefore be rapidly assessed as new treatments for heart failure in obesity.

In conclusion, this study has identified a link between adiposity, Aβ₄₂ release from adipose tissue and impairments in cardiac metabolism and function. The data generated highlight mechanistic similarities in the development of obesity-induced cardiac dysfunction and AD and support the idea that repurposing drugs originally developed for AD could be an approach to treat and manage heart failure.

Methods

Animal studies

Male C57BL6J mice were used for all mouse experiments and were obtained from the Animal Resources Centre (Perth, WA, Australia) and were group housed with four to five mice per cage with a 12 h light/dark cycle at 22 °C with humidity 20–60%. Animals had ad libitum access to food (12.8 kJ/g, 6% fat, 20% protein; Barastoc Mouse Maintenance Cube, Ridley AgriProducts) and water. All procedures involving animals were approved by The Deakin University Animal Welfare Committee (A58-2010, G07-2013, G15-2017 and G08-2020), which is subject to the Australian Code for the Responsible Conduct of Research.

High-fat feeding

At 12 weeks of age, mice were randomly assigned to regular chow or high-fat diet (HFD; 43% digestible energy from fat, 20% from sucrose; SF04-001 Specialty Feeds). Throughout the diet period, mice were weighed weekly. After three months of the diet period, mice underwent body composition assessment using EchoMRI. Two days later, mice were fasted for 5 hrs before being humanely killed by cervical dislocation. Epididymal and inguinal adipose tissues were carefully excised and weighed and were either immediately frozen and stored at −80 °C for later analysis or were used for ex vivo adipose explant experiments.

Aβ peptide administration

Lyophilised recombinant Aβ₄₂ (#AG912, Millipore) and scrambled control peptide (ScrAβ₄₂; #AG916, Millipore) were resuspended in 1% NH₄OH and aliquoted at 200 ng/ml in H₂O and stored at −80 °C for no longer than 4 weeks. Peptide administration began when mice were 10-12 weeks of age and involved a daily i.p. injection of 1μg of peptide. Throughout the peptide administration period, body weight was measured daily and food intake was measured twice weekly, and body composition was measured weekly by EchoMRI. After two weeks, plasma Aβ₄₂ was determined from samples collected 5 hr after recombinant ScrAβ₄₂ or Aβ₄₂ administration. After 3 weeks, an insulin tolerance test (ITT; i.p. 0.75U/kg) was performed following a 5 hr fast and 5 hr after peptide administration. Blood glucose was measured at baseline and after 20, 40, 60, 90 and 120 min after glucose administration. One week later, a glucose tolerance test (GTT; i.p 2 g/kg with 5μCi ³H-2-deoxyglucose and 5μCi ¹⁴C-glucose) was performed after a 5 hr fast and 5 hr after peptide administration. Blood glucose was measured at baseline and after 15, 30, 45, 60 and 90 min after glucose administration. Plasma was obtained at 0, 15, 30, 60 and 90 min for insulin determination and the measurement of tracer-specific activity. Mice were humanely killed by cervical dislocation immediately after the GTT. Blood was collected for plasma and tissues were dissected, rapidly frozen and stored at −80 °C for later analysis. Another cohort of mice were administered ScrAβ₄₂ or Aβ₄₂ for four weeks, as described above. After four weeks of peptide administration, mice were anaesthetised by isoflurane inhalation before undergoing echocardiography. Two days later, mice were humanely killed by cervical dislocation and blood was obtained for plasma and tissues were dissected, rapidly frozen and stored at −80 °C for later analysis. Another cohort of mice were administered ScrAβ₄₀ or Aβ₄₀ (Millipore) for four weeks, as described above. After four weeks of peptide administration, mice were anaesthetised by isoflurane inhalation before undergoing echocardiography. Two days later, mice were humanely killed by cervical dislocation and blood was obtained for plasma and tissues were dissected, rapidly frozen and stored at −80 °C for later analysis.

3D6 administration

For the 3D6 prevention study, 12-week-old mice were assessed for baseline cardiac structure and function by echocardiography and were assigned to one of two groups such that deceleration time was matched. One week later, mice were fed HFD (as described above) and then received control antibody (IgG2a isotype antibody, #BE-0085 BioXCell) or 3D6 antibody (#TAB-0809CLV, Creative Biolabs) weekly via i.p. injection (0.75 mg/kg). Body weight was measured twice per week, while body composition was measured every two weeks throughout the study. After 10 weeks of high-fat feeding, mice underwent an ITT and then a GTT after 11 weeks of high-fat feeding. After 12 weeks of high-fat feeding mice underwent echocardiography and two weeks later were humanely killed by cervical dislocation following a 5 hr fast. Blood was collected for plasma and tissues were dissected, rapidly frozen and stored at −80 °C for later analysis. In the 3D6 reversal study, 12-week-old mice were assessed for baseline cardiac structure and function by echocardiography and were assigned to one of three groups such that deceleration time was matched. One week later, one group of mice remained on standard chow, while the other two groups were fed a high-fat diet. Body weight was measured twice per week throughout the study. After 13 weeks of high-fat feeding, mice underwent echocardiography for pre-treatment assessment of cardiac function and morphology. Mice were then administered control antibody or 3D6 antibody weekly via i.p. injection (0.75 mg/kg) for the remainder of the study. Four weeks later, mice underwent post-treatment assessment of cardiac function and morphology, followed by assessment of body composition by EchoMRI two days later. One week later, mice were humanely killed by cervical dislocation following a 5 h fast. Blood was collected for plasma and tissues were dissected, rapidly frozen and stored at −80 °C for later analysis.

Echocardiography

Echocardiography was performed using a Phillips HD15 diagnostic ultrasound system with 15 MHz linear-array transducer^38,72,73. In line with published recommendations⁷⁴, depth of anaesthesia was modulated to maintain heart rate between 400 and 650 bpm. Images were not quantified when heart rate was ≤ 350 bpm. Transmitral Doppler imaging was used to assess LV filling velocity and deceleration time was determined from the slope of the E-wave. Only E-waves where there was sufficient separation from the A-wave to allow slope determination were quantified. Aortic valve Doppler imaging was used to assess aortic flow and ejection times. Ejection fraction and fractional shortening (FS) were derived from M-Mode measurements as indicators of LV systolic and contractile function and chamber morphology was also determined from M-mode measures. Echo images were analysed using the HD15 system in a blinded manner. The average value of each index from 2-4 cardiac cycles was used.

Adipose tissue explants

Prior to the ex vivo incubation protocol, all consumables such as 12-well plates, tips, and tubes were blocked in 5% bovine serum albumin (BSA) to minimise binding of Aβ₄₂ to plasticware⁷⁵. Tests with recombinant Aβ₄₂ revealed recovery of ~95% of Aβ₄₂ using this method. Upon collection of inguinal adipose tissue samples, four ~10–15 mg tissue portions were isolated and each of them was placed in a well with 500 uL of DMEM media supplemented with 10% BSA. Three samples were incubated in vehicle (0.1% DMSO), while one incubated in 10μM Brefeldin A. Each tissue was individually weighed, the starting time of the incubation recorded, and the plate was placed at 37 °C in 10% CO₂ for 24 h. Following the 24 h period, both media and the tissue were rapidly collected, and subsequently snap-frozen, for further analyses. High-sensitivity ELISA kits were used to quantify Aβ₄₀ (#294-62501 human/rat/mouse, FUJIFILM Wako) and Aβ₄₂ (#292-64501 human/rat/mouse high sensitivity, FUJIFILM Wako) and the protocol was followed as per the manufacturer’s protocol. In brief, samples were brought to room temperature, vortexed, and 100 μl of sample was placed in each well, together with the respective internal controls for each plate. Each plate was then sealed and refrigerated overnight. Following this, the solutions were discarded, and each well was washed 5 times before addition of 100 μl of HRP-conjugated antibody. Following 1 hour of incubation, the solution was discarded and the washing step was repeated, with subsequent addition of 100 μl TMB solution to initiate the HRP reaction at room temperature in the dark. Following 30 minutes, 100 μl of Stop-solution was added to terminate the reaction and the absorbance (at 450 nm) was subsequently measured to determine the protein levels.

Glucose clearance and fate

The LV of the heart, quadriceps skeletal muscle and epididymal adipose tissue (15-25 mg) were used to determine 2-²H-deoxyglucose clearance as we have previously described⁷³. To determine 1-¹⁴C-glucose incorporation into glycogen, ~10-15 mg of LV tissue was digested in 1 M KOH at 70 °C for 20 min and glycogen was precipitated with saturated Na₂SO₄, washed twice with 95% ethanol and resuspended in acetate buffer (0.84% sodium acetate, 0.46% acetic acid, pH 4.75) containing 0.3 mg/mL amyloglucosidase (Sigma). Glycogen was allowed to digest overnight at 37 °C before being assayed for glucose content using the glucose oxidase method⁷⁶. Digested glycogen was also assessed for ¹⁴C-glucose incorporation by scintillation counting. To determine 1-¹⁴C glucose incorporation into lipids, 5–10 mg of LV tissue was homogenised in chloroform/methanol (2:1) and mixed overnight at room temperature. Organic and inorganic phases were separated by addition of 0.6% NaCl and the lower organic phase was collected and evaporated under N₂ at 45 °C. The dried extract was resuspended in absolute ethanol and TG content was assayed using TG GPO-PAP reagent (Roche) and ¹⁴C-glucose incorporation by scintillation counting.

Gene expression and analysis

Bulk RNA was isolated from LV tissue by homogenisation using a hand-held homogeniser in Trizol and RNA was isolated using RNeasy kits (Qiagen), according to manufacturer’s instructions. Sequencing libraries were generated from 0.5 µg of total RNA using TruSeq Stranded Total RNA preparation kit (Illumina) as per manufacturer’s instructions. Transcriptome-wide mRNA levels were measured using the NovaSeq 6000 Sequencing System (Illumina). Sequence Fastq files underwent quality trimming and mapping to the mouse reference transcriptome with Salmon. The reference transcriptome sequence was obtained from Gencode (version vM24). Counts were read into R (version 4.0.2)⁷⁷. Differential expression analysis was performed separately for two contrasts (ScrAβ₄₂ vs. Aβ₄₂ and Control vs 3D6). Genes with fewer than 10 reads per sample on average were discarded. Differential analysis was performed with DESeq2 (version1.28.1). Multi-contrast enrichment analysis was performed with mitch (version 1.0.6) using default settings, which implements an ANOVA on ranks approach⁴². Human Reactome pathways were downloaded (19^th May 2020) and gene names were converted to mouse using Ensembl ortholog mapping. Gene sets with false discovery rate <0.05 were considered significant. Genesets that were significantly regulated in both contrasts were presented. The expression of App, Bace1 and Psen1 were quantified in epididymal adipose tissue, quadriceps skeletal muscle and the liver of control and obese mice by real time RT-PCR using the following primer pairs (App Fwd CTTGCACGACTATGGCATGC, rev GTCATCCTCCTCTGCATCCG; Bace1 Fwd GGAGCCCTTCTTTGACTCCC, rev CCCGTG TATAGCGAGTGGTC; Psen1 Fwd TTCAAGAAAGCGTTGCCAGC, rev AGGGCTGCACA AGGTAATCC).

Plasma and biochemical analyses

BACE-1 activity was assessed using a fluorescent assay kit (Merck), while plasma glycerol and plasma HDL-C were determined using colorimetric kits (Sigma), all according to manufacturer’s instructions. High-sensitivity ELISAs were used to measure plasma Aβ₄₀ and Aβ₄₂ (FUJIFILM Wako), as described above, and plasma insulin (ALPCO), according to manufacturer’s instructions. Plasma TG concentration was assayed using TG GPO-PAP reagent (Roche) and plasma NEFA was determined using a colorimetric kit (FUJIFILM Wako). To quantify free plasma Aβ₄₂, 100μL of plasma was added to 150μL of 10 mM Tris pH 7.5 and incubated with protein G magnetic beads, for 2 hours at 4 °C on a rotating wheel, before being spun in a centrifuge at 5,000 g for 5 min at 4 °C. The supernatant was collected and 100 μL was used to quantify Aβ₄₂ using a high-sensitivity ELISA, as described above. Protein G beads were blocked with 0.2% BSA in 10 mM Tris pH 7.5 overnight at 4 °C on a rotating wheel prior to the assay.

Isolation of enriched mitochondrial fractions

Approximately 50 mg of left ventricular tissue was homogenised with a handheld homogeniser at low speed for two 10 sec bursts while on ice in 500μL of mitochondrial isolation buffer (70 mM sucrose, 220 mM mannitol, 5 mM KH₂PO₄, 5 mM MgCl₂, 2 mM HEPES, 1 mM EGTA, 0.2% BSA). The homogenate was spun in a centrifuge at 800 g for 10 min at 4 °C. The supernatant was collected and spun in a centrifuge at 12,000 g for 10 min at 4 °C. The resulting pellet was resuspended in lysis buffer (50 mM Tris pH 7.5, 1 mM EDTA, 1 mM EGTA, 10% glycerol, 1% triton X-100, 50 mM NaF, 5 mM Na₄P₂O₇, 1 mM Na₃VO₄, 1 mM DTT) and mitochondrial protein concentration was determined by the BCA method. Quantification of Aβ₄₂ was performed from 200μg of mitochondrial protein.

Western blotting

For western blotting, 10 µg of protein were denatured in SDS reducing buffer and incubated at 37 °C for 5 min before being subjected to SDS-PAGE⁷⁸. Proteins were transferred onto polyvinylidine diflouride (PVDF) membranes, which were blocked in 1% bovine serum albumin in Tris-buffered saline and 0.05% Tween (TBST) for 1 hour at RT before being exposed to primary antibodies against pyruvate dehydrogenase (PDH) E1a subunit (Cell Signalling Technology #2784), cytochrome c oxidase subunit 4 (CoxIV; Cell Signalling Technology #4844), succinate dehydrogenase subunit A (SDHa; Cell Signalling Technology #11998), histone 4 (H4; Cell Signalling Technology #2592) p38 mitogen activate protein kinase (MAPK; Cell Signalling Technology #9212), troponin (Cell Signalling Technology #4002), amyloid beta (Moab2, Abcam ab126649) and α-tubulin (Sigma-Aldrich T6074). All antibodies were diluted in 1xTBST at a concentration of 1:1000. Membranes were washed in TBST and exposed to appropriate anti-species horseradish peroxidase (HRP) conjugated secondary antibodies for 1 hr at RT, before final washes. Protein bands were detected using ECL Chemiluminescent Substrate Reagent Kit (Invitrogen) and visualized on a Chemidoc XRS System and Analysis Software (Bio-Rad Laboratories).

Primary cardiomyocytes

Neonatal ventricular cardiomyocytes were isolated from mixed sex, two-day-old C57BL6J mice⁷⁹. Cells were seeded into Seahorse V7 assay plates at 60,000 cells/well. Prior to assays, cells were exposed to Aβ₄₂ at 0, 200 and 300pM and co-incubated with ScrAβ₄₂ at 300, 100 and 0pM, respectively, such that all cells were exposed to 300pM of total peptide for 48 hr, with media replenished every 24 hr. These supraphysiological Aβ₄₂ concentrations were used as we measured Aβ₄₂ levels in FBS containing media at ~20pM. Cells were washed and incubated in 600 µL assay running media (unbuffered DMEM, Invitrogen; supplemented with 25 mM glucose, 1 mM pyruvate, pH 7.4) in a non-CO₂ incubator at 37 °C for 1 h before commencing the assay. Mitochondrial function was analysed by performing three baseline oxygen consumption rate (OCR) measurements, before subsequent measurements following injections of oligomycin (1 mM final concentration), carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP; 1 μM final concentration), rotenone (1 μM final concentration) and Antimycin A (1 μM final concentration). Each measurement cycle consisted of the following: 3 min mix, 3 min wait, 3 min measure. Basal OCR was calculated by subtracting the mean value of the OCR measurements following Antimycin A injection from the mean of the baseline measurements. Maximal OCR was calculated by subtracting the mean value of the OCR measurements following Antimycin A injection from the mean value of the OCR measurements following FCCP injection⁸⁰. Complex I-mediated respiration was designated as the difference between basal and rotenone (1μM)-suppressed respiration, which was also normalised by the maximal respiratory rate under FCCP stimulated conditions to determine flux as a percentage of maximal capacity. Cell viability was assessed by measuring extracellular and intracellular lactate dehydrogenase (LDH) following exposure of cardiomyocytes to 300pM of ScrAβ₄₂ or Aβ₄₂ for 48 hrs. LDH was measured using the CytoTox 96® Non-Radioactive Cytotoxicity Assay kit (Promega) as per manufacturer’s instructions. Viability was expressed as LDH in the media normalised to total LDH from the media and cell lysate⁷⁶.

Statistical analyses

All data are presented as mean ± SEM. Individual data points identified as greater than two standard deviations away from the mean were designated as outliers and removed. Data were assessed for normality using a Shapiro-Wilks test. Normally distributed data were analysed by independent samples t-test, one-way ANOVA, two-way ANOVA, two-way repeated measures ANOVA or mixed effects model, as described for statistically significant data in relevant figure legends. Data not normally distributed were analysed by Mann-Whitney test or Kruskal-Wallis test, as described for statistically significant data in relevant figure legends. All statistical analyses were performed using GraphPad Prism 9, with p values < 0.05 considered significant.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

RNA-seq data generated in this study can be found at Gene Expression Omnibus, submission GSE213708. All other data generated during this study are provided in the Source Data file. No previously published datasets were used in this work. Source data are provided with this paper.

Code availability

Scripts used for differential gene expression, enrichment analysis and mitch, as well as specific instructions for how to reproduce our data, are provided at the following link (https://github.com/markziemann/2dpw4liam). Code is also accessible and citable at https://doi.org/10.5281/zenodo.10203716.

References

Gustafson, D., Rothenberg, E., Blennow, K., Steen, B. & Skoog, I. An 18-year follow-up of overweight and risk of Alzheimer disease. Arch. Internal Med. 163, 1524–1528 (2003).
Article Google Scholar
Stampfer, M. J. Cardiovascular disease and Alzheimer’s disease: common links. J. Internal Med. 260, 211–223 (2006).
Article CAS PubMed Google Scholar
Powell-Wiley, T. M. et al. Obesity and Cardiovascular Disease: A Scientific Statement From the American Heart Association. Circulat. 143, e984–e1010 (2021).
Article Google Scholar
Vignini, A. et al. Alzheimer’s disease and diabetes: new insights and unifying therapies. Curr Diabet. Rev. 9, 218–227 (2013).
Article Google Scholar
O’Brien, R. J. & Wong, P. C. Amyloid precursor protein processing and Alzheimer’s disease. Annu. Rev. Neurosci. 34, 185–204 (2011).
Article PubMed PubMed Central Google Scholar
Chaney, M. O. et al. RAGE and amyloid beta interactions: atomic force microscopy and molecular modeling. Biochim. et Biophys. Acta 1741, 199–205 (2005).
Article CAS Google Scholar
Tran, L., Basdevant, N., Prevost, C. & Ha-Duong, T. Structure of ring-shaped Abeta(4)(2) oligomers determined by conformational selection. Sci. Rep. 6, 21429 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Xue, C. et al. Abeta42 fibril formation from predominantly oligomeric samples suggests a link between oligomer heterogeneity and fibril polymorphism. R. Soc. Open Sci. 6, 190179 (2019).
Article ADS CAS PubMed PubMed Central Google Scholar
Bharadwaj, P. et al. Role of the cell membrane interface in modulating production and uptake of Alzheimer’s beta amyloid protein. Biochim. Biophys. Acta Biomembr. 1860, 1639–1651 (2018).
Article CAS PubMed Google Scholar
Mark, R. J., Pang, Z., Geddes, J. W., Uchida, K. & Mattson, M. P. Amyloid beta-peptide impairs glucose transport in hippocampal and cortical neurons: involvement of membrane lipid peroxidation. J. Neurosci. 17, 1046–1054 (1997).
Article CAS PubMed PubMed Central Google Scholar
Prapong, T. et al. Amyloid beta-peptide decreases neuronal glucose uptake despite causing increase in GLUT3 mRNA transcription and GLUT3 translocation to the plasma membrane. Exp. Neurol. 174, 253–258 (2002).
Article CAS PubMed Google Scholar
Malkov, A. et al. Abeta initiates brain hypometabolism, network dysfunction and behavioral abnormalities via NOX2-induced oxidative stress in mice. Commun. Biol. 4, 1054 (2021).
Article CAS PubMed PubMed Central Google Scholar
Casley, C. S., Canevari, L., Land, J. M., Clark, J. B. & Sharpe, M. A. Beta-amyloid inhibits integrated mitochondrial respiration and key enzyme activities. J. Neurochem. 80, 91–100 (2002).
Article CAS PubMed Google Scholar
Moreira, P. I., Santos, M. S., Moreno, A. & Oliveira, C. Amyloid beta-peptide promotes permeability transition pore in brain mitochondria. Biosci. Rep. 21, 789–800 (2001).
Article CAS PubMed Google Scholar
Mossmann, D. et al. Amyloid-beta peptide induces mitochondrial dysfunction by inhibition of preprotein maturation. Cell Metabol. 20, 662–669 (2014).
Article CAS Google Scholar
Tillement, L., Lecanu, L. & Papadopoulos, V. Further evidence on mitochondrial targeting of beta-amyloid and specificity of beta-amyloid-induced mitotoxicity in neurons. Neurodegener. Dis. 8, 331–344 (2011).
Article CAS PubMed Google Scholar
Roher, A. E. et al. Amyloid beta peptides in human plasma and tissues and their significance for Alzheimer’s disease. Alzheimer’s Dement. J. Alzheimer’s Associat. 5, 18–29 (2009).
Article CAS Google Scholar
Lee, Y. H. et al. Amyloid precursor protein expression is upregulated in adipocytes in obesity. Obesity (Silver Spring) 16, 1493–1500 (2008).
Article ADS CAS PubMed Google Scholar
An, Y. A. et al. Dysregulation of Amyloid Precursor Protein Impairs Adipose Tissue Mitochondrial Function and Promotes Obesity. Nat. Metab. 1, 1243–1257 (2019).
Article CAS PubMed PubMed Central Google Scholar
Fujiwara, T., Oda, K., Yokota, S., Takatsuki, A. & Ikehara, Y. Brefeldin A causes disassembly of the Golgi complex and accumulation of secretory proteins in the endoplasmic reticulum. J. Biol. Chem. 263, 18545–18552 (1988).
Article CAS PubMed Google Scholar
Balakrishnan, K. et al. Plasma Abeta42 correlates positively with increased body fat in healthy individuals. J. Alzheimer’s Dis. JAD 8, 269–282 (2005).
Article CAS PubMed Google Scholar
Fung, J., Frost, D., Chakrabartty, A. & McLaurin, J. Interaction of human and mouse Abeta peptides. J. Neurochem. 91, 1398–1403 (2004).
Article CAS PubMed Google Scholar
Lopaschuk, G. D., Folmes, C. D. & Stanley, W. C. Cardiac energy metabolism in obesity. Circulat. Res. 101, 335–347 (2007).
Article CAS PubMed Google Scholar
Rayner, J. J. et al. The relative contribution of metabolic and structural abnormalities to diastolic dysfunction in obesity. Int J. Obes. 42, 441–447 (2018).
Article CAS Google Scholar
Borlaug, B. A. et al. Obesity and heart failure with preserved ejection fraction: new insights and pathophysiologic targets. Cardiovasc. Res. (2022).
Obokata, M., Reddy, Y. N. V., Pislaru, S. V., Melenovsky, V. & Borlaug, B. A. Evidence Supporting the Existence of a Distinct Obese Phenotype of Heart Failure With Preserved Ejection Fraction. Circulation 136, 6–19 (2017).
Article CAS PubMed PubMed Central Google Scholar
Koenig, A. L. et al. Single-cell transcriptomics reveals cell-type specific diversification in human heart failure. Nat. Cardiovasc. Res. 1, 263–280 (2022).
Article PubMed PubMed Central Google Scholar
Yan, Y. & Wang, C. Abeta42 is more rigid than Abeta40 at the C terminus: implications for Abeta aggregation and toxicity. J. Mol. Biol. 364, 853–862 (2006).
Article CAS PubMed Google Scholar
Hoglund, K. et al. Plasma levels of beta-amyloid(1-40), beta-amyloid(1-42), and total beta-amyloid remain unaffected in adult patients with hypercholesterolemia after treatment with statins. Arch. Neurol. 61, 333–337 (2004).
Article PubMed Google Scholar
Dunlay, S. M., Roger, V. L. & Redfield, M. M. Epidemiology of heart failure with preserved ejection fraction. Nat. Rev. Cardiol. 14, 591–602 (2017).
Article PubMed Google Scholar
Czeczor, J. K. et al. APP deficiency results in resistance to obesity but impairs glucose tolerance upon high fat feeding. J. Endocrinol. 237, 311–322 (2018).
Article CAS PubMed Google Scholar
Meakin, P. J. et al. Reduction in BACE1 decreases body weight, protects against diet-induced obesity and enhances insulin sensitivity in mice. Biochem. J. 441, 285–296 (2012).
Article CAS PubMed Google Scholar
Zago, W. et al. Neutralization of soluble, synaptotoxic amyloid beta species by antibodies is epitope specific. J. Neurosci. 32, 2696–2702 (2012).
Article CAS PubMed PubMed Central Google Scholar
Salloway, S. et al. Two phase 3 trials of bapineuzumab in mild-to-moderate Alzheimer’s disease. New Engl J. Med. 370, 322–333 (2014).
Article CAS PubMed Google Scholar
Mureddu, G. F., de Simone, G., Greco, R., Rosato, G. F. & Contaldo, F. Left ventricular filling pattern in uncomplicated obesity. Am. J. Cardiol. 77, 509–514 (1996).
Article CAS PubMed Google Scholar
Aljaroudi, W. et al. Impact of body mass index on diastolic function in patients with normal left ventricular ejection fraction. Nutr. Diabetes 2, e39 (2012).
Article CAS PubMed PubMed Central Google Scholar
Ingul, C. B., Tjonna, A. E., Stolen, T. O., Stoylen, A. & Wisloff, U. Impaired cardiac function among obese adolescents: effect of aerobic interval training. Arch. Pediatr. Adolesc. Med. 164, 852–859 (2010).
Article PubMed Google Scholar
Gaur, V. et al. Scriptaid enhances skeletal muscle insulin action and cardiac function in obese mice. Diab. Obes. Metabol. 19, 936–943 (2017).
Article CAS Google Scholar
Demattos, R. B. et al. A plaque-specific antibody clears existing beta-amyloid plaques in Alzheimer’s disease mice. Neuron 76, 908–920 (2012).
Article CAS PubMed Google Scholar
McFarland, T. M., Alam, M., Goldstein, S., Pickard, S. D. & Stein, P. D. Echocardiographic diagnosis of left ventricular hypertrophy. Circulation 57, 1140–1144 (1978).
Article CAS PubMed Google Scholar
Hampel, H. et al. The Amyloid-beta Pathway in Alzheimer’s Disease. Mol. Psychiatry 26, 5481–5503 (2021).
Article CAS PubMed PubMed Central Google Scholar
Kaspi, A. & Ziemann, M. mitch: multi-contrast pathway enrichment for multi-omics and single-cell profiling data. BMC Genom. 21, 447 (2020).
Article Google Scholar
Boudina, S. et al. Reduced mitochondrial oxidative capacity and increased mitochondrial uncoupling impair myocardial energetics in obesity. Circulation 112, 2686–2695 (2005).
Article PubMed Google Scholar
Chatham, J. C. & Seymour, A. M. Cardiac carbohydrate metabolism in Zucker diabetic fatty rats. Cardiovasc. Res. 55, 104–112 (2002).
Article CAS PubMed Google Scholar
Lewis, A. J., Neubauer, S., Tyler, D. J. & Rider, O. J. Pyruvate dehydrogenase as a therapeutic target for obesity cardiomyopathy. Expert. Opin. Ther. Targets 20, 755–766 (2016).
Article CAS PubMed Google Scholar
Lustbader, J. W. et al. ABAD directly links Abeta to mitochondrial toxicity in Alzheimer’s disease. Science 304, 448–452 (2004).
Article ADS CAS PubMed Google Scholar
Caspersen, C. et al. Mitochondrial Abeta: a potential focal point for neuronal metabolic dysfunction in Alzheimer’s disease. FASEB J 19, 2040–2041 (2005).
Article CAS PubMed Google Scholar
Schroeter, S. et al. Immunotherapy reduces vascular amyloid-beta in PDAPP mice. J. Neurosci. 28, 6787–6793 (2008).
Article CAS PubMed PubMed Central Google Scholar
Bobba, A. et al. Mitochondrial respiratory chain Complexes I and IV are impaired by beta-amyloid via direct interaction and through Complex I-dependent ROS production, respectively. Mitochondrion 13, 298–311 (2013).
Article CAS PubMed Google Scholar
Niemann, B. et al. Obesity induces signs of premature cardiac aging in younger patients: the role of mitochondria. J. Am. Coll. Cardiol. 57, 577–585 (2011).
Article CAS PubMed Google Scholar
Montaigne, D. et al. Myocardial contractile dysfunction is associated with impaired mitochondrial function and dynamics in type 2 diabetic but not in obese patients. Circulation 130, 554–564 (2014).
Article CAS PubMed Google Scholar
Ide, T. et al. Mitochondrial electron transport complex I is a potential source of oxygen free radicals in the failing myocardium. Circulation Research 85, 357–363 (1999).
Article CAS PubMed Google Scholar
Sheeran, F. L. & Pepe, S. Posttranslational modifications and dysfunction of mitochondrial enzymes in human heart failure. Am. J. Physiol. Endocrinol. Metabol. 311, E449–E460 (2016).
Article Google Scholar
Zhu, F. et al. Plasma Amyloid-beta in Relation to Cardiac Function and Risk of Heart Failure in General Population. JACC Heart Fail. 11, 93–102 (2023).
Article CAS PubMed Google Scholar
Meakin, P. J. et al. Elevated circulating amyloid concentrations in obesity and diabetes promote vascular dysfunction. J. Clin. Invest. 130, 4104–4117 (2020).
CAS PubMed PubMed Central Google Scholar
Puig, K. L. et al. Amyloid precursor protein modulates macrophage phenotype and diet-dependent weight gain. Sci. Rep. 7, 43725 (2017).
Article ADS PubMed PubMed Central Google Scholar
Weaver, D. F. Amyloid beta is an early responder cytokine and immunopeptide of the innate immune system. Alzheimers Dement (N Y) 6, e12100 (2020).
Article PubMed Google Scholar
Gopal, K. et al. Cardiac-Specific Deletion of Pyruvate Dehydrogenase Impairs Glucose Oxidation Rates and Induces Diastolic Dysfunction. Front. Cardiovasc. Med. 5, 17 (2018).
Article ADS PubMed PubMed Central Google Scholar
Sidhu, S. et al. Tissue-specific pyruvate dehydrogenase complex deficiency causes cardiac hypertrophy and sudden death of weaned male mice. Am. J. Physiol. Heart Circulat. Physiol 295, H946–H952 (2008).
Article CAS Google Scholar
Dai, C. et al. Lactate Dehydrogenase A Governs Cardiac Hypertrophic Growth in Response to Hemodynamic Stress. Cell Rep. 32, 108087 (2020).
Article CAS PubMed PubMed Central Google Scholar
Cluntun, A. A. et al. The pyruvate-lactate axis modulates cardiac hypertrophy and heart failure. Cell Metabol. 33, 629–648.e610 (2021).
Article CAS Google Scholar
Lewis, H. et al. Quantification of Alzheimer pathology in ageing and dementia: age-related accumulation of amyloid-beta(42) peptide in vascular dementia. Neuropathol. Appl. Neurobiol. 32, 103–118 (2006).
Article CAS PubMed Google Scholar
Troncone, L. et al. Abeta Amyloid Pathology Affects the Hearts of Patients With Alzheimer’s Disease: Mind the Heart. J. Am. Coll. Cardiol. 68, 2395–2407 (2016).
Article CAS PubMed PubMed Central Google Scholar
Jang, S., Chapa-Dubocq, X. R., Parodi-Rullan, R. M., Fossati, S. & Javadov, S. Beta-Amyloid Instigates Dysfunction of Mitochondria in Cardiac Cells. Cells 11 (2022).
Worth, A. J., Basu, S. S., Snyder, N. W., Mesaros, C. & Blair, I. A. Inhibition of neuronal cell mitochondrial complex I with rotenone increases lipid beta-oxidation, supporting acetyl-coenzyme A levels. J. Biol. Chem. 289, 26895–26903 (2014).
Article CAS PubMed PubMed Central Google Scholar
Vazquez, E. J. et al. Mitochondrial complex I defect and increased fatty acid oxidation enhance protein lysine acetylation in the diabetic heart. Cardiovasc. Res. 107, 453–465 (2015).
Article CAS PubMed PubMed Central Google Scholar
Gonzalez-Barroso, M. M. et al. Fatty acids revert the inhibition of respiration caused by the antidiabetic drug metformin to facilitate their mitochondrial beta-oxidation. Biochim. Biophys. Acta 1817, 1768–1775 (2012).
Article CAS PubMed Google Scholar
Louch, W. E., Sheehan, K. A. & Wolska, B. M. Methods in cardiomyocyte isolation, culture, and gene transfer. J. Mol. Cell. Cardiol 51, 288–298 (2011).
Article CAS PubMed PubMed Central Google Scholar
Piquereau, J. & Ventura-Clapier, R. Maturation of Cardiac Energy Metabolism During Perinatal Development. Front. Physiol 9, 959 (2018).
Article PubMed PubMed Central Google Scholar
Liu, B. et al. Comparative study on isolation and mitochondrial function of adult mouse and rat cardiomyocytes. J. Mol. Cell. Cardiol 136, 64–71 (2019).
Article CAS PubMed Google Scholar
Peikert, A. & Cunningham, J. W. Amyloid-beta and the Risk of Heart Failure: Cause or Only Association? JACC Heart Fail. 11, 103–105 (2023).
Article PubMed Google Scholar
Venardos, K., De Jong, K. A., Elkamie, M., Connor, T. & McGee, S. L. The PKD Inhibitor CID755673 Enhances Cardiac Function in Diabetic db/db Mice. PLoS One 10, e0120934 (2015).
Article PubMed PubMed Central Google Scholar
De Jong, K. A. et al. Loss of protein kinase D activity demonstrates redundancy in cardiac glucose metabolism and preserves cardiac function in obesity. Mol. Metabol 42, 101105 (2020).
Article Google Scholar
Lindsey, M. L., Kassiri, Z., Virag, J. A. I., de Castro Bras, L. E. & Scherrer-Crosbie, M. Guidelines for measuring cardiac physiology in mice. Am. J. Physiol. Heart Circulat Physiol 314, H733–H752 (2018).
Article Google Scholar
Esparza, T. J. et al. Soluble Amyloid-beta Aggregates from Human Alzheimer’s Disease Brains. Sci. Rep. 6, 38187 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Martin, S. D., Morrison, S., Konstantopoulos, N. & McGee, S. L. Mitochondrial dysfunction has divergent, cell type-dependent effects on insulin action. Mol. Metabol 3, 408–418 (2014).
Article CAS Google Scholar
Wu, W. et al. Activation of Hippo signaling pathway mediates mitochondria dysfunction and dilated cardiomyopathy in mice. Theranostics 11, 8993–9008 (2021).
Article CAS PubMed PubMed Central Google Scholar
Gaur, V. et al. Disruption of the Class IIa HDAC Corepressor Complex Increases Energy Expenditure and Lipid Oxidation. Cell Rep. 16, 2802–2810 (2016).
Article CAS PubMed Google Scholar
Williams, D. et al. Abnormal mitochondrial L-arginine transport contributes to the pathogenesis of heart failure and rexoygenation injury. PLoS One 9, e104643 (2014).
Article ADS PubMed PubMed Central Google Scholar
Martin, S. D. & McGee, S. L. A systematic flux analysis approach to identify metabolic vulnerabilities in human breast cancer cell lines. Cancer Metabol. 7, 12 (2019).
Article Google Scholar

Download references

Acknowledgements

The authors wish to thank Dr Tom Gumley, Assoc. Prof. John Amerena, Prof. Mark Hargreaves, Dr Sophie Hussey and Professor Roberto Cappai for their assistance with this study and helpful discussions. The authors also wish to thank members of the Metabolic Research Unit for helpful discussions and Dr Richard Woolley for his assistance with echocardiography. The authors would also like to thank the Deakin University Animal Services team for their assistance throughout this study. Aspects of this work were funded by grants from the National Health and Medical Research Council (GNT1027226), the Diabetes Australia Research Program (Y17G-MCGS), the Ramaciotti Foundation and Ambetex Pty Ltd to SLM.

Author information

These authors contributed equally: Liam G. Hall, Juliane K. Czeczor.

Authors and Affiliations

Institute for Mental and Physical Health and Clinical Translation, Metabolic Research Unit, School of Medicine, Deakin University, Geelong, Australia
Liam G. Hall, Juliane K. Czeczor, Timothy Connor, Javier Botella, Kirstie A. De Jong, Amanda J. Genders, Kylie Venardos, Sheree D. Martin, Simon T. Bond, Kathryn Aston-Mourney, Ken R. Walder & Sean L. McGee
Department of Cellular and Physiological Sciences, Faculty of Medicine, The University of British Columbia, Vancouver, Canada
Liam G. Hall
Becton Dickinson GmbH, Medical Affairs, 69126, Heidelberg, Germany
Juliane K. Czeczor
Institute of Experimental Cardiovascular Research, University Medical Centre Hamburg-Eppendorf, Hamburg, Germany
Kirstie A. De Jong
Institute for Physical Activity and Nutrition, School of Exercise and Nutrition Sciences, Deakin University, Geelong, Australia
Mark C. Renton & Kirsten F. Howlett
Department of Nutrition, Dietetics and Food, School of Clinical Sciences and Victorian Heart Institute, Monash University, Melbourne, Australia
Amanda J. Genders
Baker Heart and Diabetes Institute, Melbourne, Australia
Simon T. Bond
Ambetex Pty Ltd, Geelong, Australia
James A. Campbell, Greg R. Collier & Sean L. McGee
School of Life and Environmental Science, Deakin University, Geelong, Australia
Matthew McKenzie & Mark Ziemann

Authors

Liam G. Hall
View author publications
You can also search for this author in PubMed Google Scholar
Juliane K. Czeczor
View author publications
You can also search for this author in PubMed Google Scholar
Timothy Connor
View author publications
You can also search for this author in PubMed Google Scholar
Javier Botella
View author publications
You can also search for this author in PubMed Google Scholar
Kirstie A. De Jong
View author publications
You can also search for this author in PubMed Google Scholar
Mark C. Renton
View author publications
You can also search for this author in PubMed Google Scholar
Amanda J. Genders
View author publications
You can also search for this author in PubMed Google Scholar
Kylie Venardos
View author publications
You can also search for this author in PubMed Google Scholar
Sheree D. Martin
View author publications
You can also search for this author in PubMed Google Scholar
Simon T. Bond
View author publications
You can also search for this author in PubMed Google Scholar
Kathryn Aston-Mourney
View author publications
You can also search for this author in PubMed Google Scholar
Kirsten F. Howlett
View author publications
You can also search for this author in PubMed Google Scholar
James A. Campbell
View author publications
You can also search for this author in PubMed Google Scholar
Greg R. Collier
View author publications
You can also search for this author in PubMed Google Scholar
Ken R. Walder
View author publications
You can also search for this author in PubMed Google Scholar
Matthew McKenzie
View author publications
You can also search for this author in PubMed Google Scholar
Mark Ziemann
View author publications
You can also search for this author in PubMed Google Scholar
Sean L. McGee
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization, L.G.H., J.K.C. and S.L.M.; Methodology, L.G.H., J.K.C., T.C., J.B., K.A.D.J., M.C.R., A.J.G., K.V., S.D.M., S.T.B., K.A.M., K.F.H., M.M., M.Z. and S.L.M.; Resources, K.F.H., J.A.C., G.R.C., K.W., M.M., M.Z. and S.L.M.; Writing – original draft, S.L.M.; Writing – review and editing, all authors; Funding acquisition, S.L.M.

Corresponding author

Correspondence to Sean L. McGee.

Ethics declarations

Competing interests

Ambetex Pty Ltd has submitted patents containing aspects of this work (PCT/AU2020/051254; PCT/AU2020/051348; PCT/AU2020/051350; PCT/AU2020/051353). LGH, JKC, JAC, GRC and SLM own equity in Ambetex Pty Ltd. The remaining authors declare no conflict of interests.

Peer review

Peer review information

Nature Communications thanks the anonymous, reviewers for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Peer Review File

Reporting Summary

Source data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Hall, L.G., Czeczor, J.K., Connor, T. et al. Amyloid beta 42 alters cardiac metabolism and impairs cardiac function in male mice with obesity. Nat Commun 15, 258 (2024). https://doi.org/10.1038/s41467-023-44520-4

Download citation

Received: 18 October 2023
Accepted: 15 December 2023
Published: 15 January 2024
DOI: https://doi.org/10.1038/s41467-023-44520-4

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.