A plant cell death-inducing protein from litchi interacts with Peronophythora litchii pectate lyase and enhances plant resistance

Li, Wen; Li, Peng; Deng, Yizhen; Situ, Junjian; He, Zhuoyuan; Zhou, Wenzhe; Li, Minhui; Xi, Pinggen; Liang, Xiangxiu; Kong, Guanghui; Jiang, Zide

doi:10.1038/s41467-023-44356-y

Download PDF

Article
Open access
Published: 02 January 2024

A plant cell death-inducing protein from litchi interacts with Peronophythora litchii pectate lyase and enhances plant resistance

Nature Communications volume 15, Article number: 22 (2024) Cite this article

3832 Accesses
1 Citations
20 Altmetric
Metrics details

Subjects

Abstract

Cell wall degrading enzymes, including pectate lyases (PeLs), released by plant pathogens, break down protective barriers and/or activate host immunity. The direct interactions between PeLs and plant immune-related proteins remain unclear. We identify two PeLs, PlPeL1 and PlPeL1-like, critical for full virulence of Peronophythora litchii on litchi (Litchi chinensis). These proteins enhance plant susceptibility to oomycete pathogens in a PeL enzymatic activity-dependent manner. However, LcPIP1, a plant immune regulator secreted by litchi, binds to PlPeL1/PlPeL1-like, and attenuates PlPeL1/PlPeL1-like induced plant susceptibility to Phytophthora capsici. LcPIP1 also induces cell death and various immune responses in Nicotiana benthamiana. Conserved in plants, LcPIP1 homologs bear a conserved “VDMASG” motif and exhibit immunity-inducing activity. Furthermore, SERK3 interacts with LcPIP1 and is required for LcPIP1-induced cell death. NbPIP1 participates in immune responses triggered by the PAMP protein INF1. In summary, our study reveals the dual roles of PlPeL1/PlPeL1-like in plant-pathogen interactions: enhancing pathogen virulence through PeL enzymatic activity while also being targeted by LcPIP1, thus enhancing plant immunity.

DNA glycosylases provide antiviral defence in prokaryotes

Article Open access 17 April 2024

Streptomyces umbrella toxin particles block hyphal growth of competing species

Article Open access 17 April 2024

A plant NLR receptor employs ABA central regulator PP2C-SnRK2 to activate antiviral immunity

Article Open access 13 April 2024

Introduction

Plant cell walls are one of the major barriers that protect host against invading pathogens¹. Accordingly, plant pathogens including bacteria, oomycetes, fungi, and nematodes secrete a variety of cell wall-degrading enzymes (CWDEs) in the process of infecting host plants^2,3. CWDEs, as virulence factors, contribute to pathogenesis by destroying wax, cuticle, and cell walls, and by obtaining nutrients for supporting microbial growth, reproduction, and proliferation in the host⁴. Previous studies have revealed that silencing or deleting CWDE-encoding genes, e.g., endoxylanase genes from Magnaporthe oryzae, pectin methylesterase gene from Botrytis cinerea (Bcpme1), polygalacturonase genes from Xanthomonas campestris (pghAxc and pghBxc), or polygalacturonase gene from Phytophthora capsici (pcipg2), significantly reduced microbial pathogenicity^5,6,7,8. However, plant cells can sense the alteration of cell wall integrity during biotic stress, and recognize CWDEs as pathogen-associated molecular patterns (PAMPs) or sense fragments of plant cell walls such as those degraded by CWDEs as danger-associated molecular patterns (DAMPs)⁹. Plant defense responses are thus triggered including transcriptional reprogramming, production of reactive oxygen species (ROS), cell wall fortification, and programmed cell death (PCD)¹⁰.

Pectin is one of the major components of plant cell walls and is a structurally and functionally complex polysaccharide¹¹. Pectate lyase (PeL) (EC 4.2.2.2) is widely distributed in plant pathogens, and is a type of pectinase. PeLs cleave β(1–4) links between galacturonosyl residues by β-elimination, resulting in 4,5-unsaturated double bonded oligogalacturonates¹². This enzymatic action results in the rapid disintegration of pectin, leading to irreparable damage to plant tissues. The fungal PeL gene was firstly cloned from Aspergillus nidulans¹³, after which the functions of PeLs from many plant pathogens were characterized. For example, the PeL gene pecCl1 is an important factor in the aggressiveness of Colletotrichum lindemuthianum¹⁴. VdPEL1 of Verticillium dahliae induces cell death and plant resistance, and VdPEL1 deletion strains are severely compromised in virulence, indicating that VdPEL1 is also a virulence factor¹⁵. Similarly, PcPL1, PcPL16, and PcPL20 induce cell death and contribute to the virulence of Ph. capsici¹⁶. PeLs act as virulence factors in pathogens and also induce host defense responses¹⁷. However, the molecular mechanisms of fungal PeL-induced plant cell death or resistance are still largely unknown.

Litchi (Litchi chinensis Sonn.) is a tropical and subtropical fruit with appealing color, distinct sweet taste, and abundant nutrients¹⁸. Downy blight caused by Peronophythora litchii is one of the most destructive diseases of litchi, causing enormous commercial losses¹⁹. Numerous CWDE genes have been reported in species of Phytophthora and Pythium^2,20, and the number of CWDEs in P. litchii is lower than those in some Phytophthora species²¹. At present, only the function of pectin acetylesterase PAE5, which is associated with the virulence of P. litchii, has been reported²², and an understanding of the function of PeLs in P. litchii is still lacking.

Programmed cell death (PCD) plays a key role in development, cellular homeostasis, and immunity of plants²³. In plant-microbe interactions, pathogens may trigger rapid, localized plant cell death at the site of primary infection, which is known as hypersensitive response (HR). HR blocks the nutrient absorption and spread of pathogens²⁴. The reactive oxygen species (ROS) burst usually erupts at the early stage of defense response and is usually important for initiation of HR with accumulation of salicylic acid (SA), jasmonic acid (JA), and ethylene (ET)^25,26. In previous studies, many plant components involved in PCD and resistance in N. benthamiana leaves have been identified, such as the class-II ethylene-responsive element binding factor NbCD1, a small orphan protein Xa7, mitogen activated protein kinase kinase NbMKK1, hypersensitive induced reaction proteins HIRs, hypersensitive response-like lesion inducing protein 4 (NbHRLI4), and a variety of transcription factors^{27,28,29,30,31,32,33}. SERK3, which was once named BRASSINOSTEROID INSENSITIVE 1-associated receptor kinase 1 (BAK1), is an essential co-receptor of multiple receptor complexes. SERK3 is indispensable for regulation of defense-related PCD^34,35,36.

In this study, we investigated the biological roles of the PeL gene family in P. litchii and found that PlPeL1 and PlPeL1-like were required for the full pathogenicity of P. litchii. Furthermore, a litchi cell death-inducing protein, LcPIP1 was identified to interact with PlPeL1/PlPeL1. LcPIP1 induced plant immune responses in a SERK3-dependent manner, and attenuated the PlPeL1/PlPeL1-like- induced plant susceptibility to Ph. capsici. These results provide insights into plant-oomycete interactions mediated by pathogen PeLs and the mechanism of plant immunity.

Results

PlPeL1 and PlPeL1-like contribute to P. litchii virulence

We identified 19 PeL encoding genes in the P. litchii genome based on bioinformatic analysis. We were particularly interested in a pair of PeLs arranged in a head-to-head reversed complement fashion in the genome (Supplementary Fig. 1a), which shared high (94%) amino acid identity (Supplementary Fig. 1b). We named these two PeL encoding genes as PlPeL1 and PlPeL1-like. Both PlPeL1 and PlPeL1-like have a secretion signal peptide (SP) and an Amb_all domain (SM00656) (Supplementary Fig. 1b). The function of the SP of PlPeL1/PlPeL1-like was evaluated using yeast secretion assay³⁷ (Fig. 1a). In addition, PlPeL1 and PlPeL1-like were expressed in N. benthamiana and could be detected in the plant apoplastic fluid (AF) (Fig. 1b), indicating that PlPeL1 and PlPeL1-like were secreted proteins. We next analyzed the expression patterns of PlPeL1/PlPeL1-like genes by qRT-PCR, and the results showed that PlPeL1/PlPeL1-like were up-regulated at infection stages (Supplementary Fig. 1c, d). In addition, we conducted a comparative analysis of the expression levels of PlPeL1 and PlPeL1-like (Supplementary Fig. 1e).

**Fig. 1: Functional analysis of PlPeL1/PlPeL1-like signal peptide and their role as virulence factors in *Peronophythora litchii*.**

To assess the potential contribution of PlPeL1 and PlPeL1-like to P. litchii virulence, CRISPR/Cas9-mediated genome editing technology^38,39 was used to create individual knockout strains for PlPeL1 and PlPeL1-like in P. litchii wild-type (WT) strain SHS3 (Supplementary Fig. 2a, b). We also generated ΔΔplpel1/plpel1-like (PlPeL1 and PlPeL1-like double deletion mutants) (Supplementary Fig. 2c). Successful deletion mutants were verified by PCR amplification (Supplementary Fig. 2d) and sequencing analysis (Supplementary Fig. 2a–c). Knockout of PlPeL1 and PlPeL1-like, individually or together, did not affect mycelial growth or morphology of P. litchii on CJA medium (Supplementary Fig. 3).

To determine the role of these two PlPeLs toward P. litchii pathogenicity, the abaxial surface of tender litchi leaves were inoculated with zoospore suspensions of WT or knockout mutants, and kept at 25 °C in the dark. We measured the lesion area at 2 days post-inoculation (dpi) and found that the lesions caused by ΔΔplpel1/plpel1-like mutants were significantly smaller than those caused by WT (Fig. 1c, d). However, no significant differences were observed in lesions caused by Δplpel1 or Δplpel1-like mutant, compared to WT (Fig. 1c, d). We examined the expression levels of PlPeL1 and PlPeL1-like in Δplpel1, plpel1-like and WT strains at 12 hpi. PlPeL1-like was significantly up-regulated in Δplpel1 mutants compared to WT, while similarly, PlPeL1 was significantly up-regulated in Δplpel1-like mutants compared to WT (Supplementary Fig. 4). We deduced that the up-regulation of PlPeL1 or PlPeL1-like in single-gene knockout mutants may serve to compensate for observed virulence defects. Together, these results indicated that PlPeL1 and PlPeL1-like contributed to the virulence of P. litchii.

The enzymatic activity of PlPeL1 and PlPeL1-like is required for virulence

Calcium ion (Ca²⁺) is known to be an essential co-factor for PeL enzymatic activity, and conserved aspartic (D) residues are believed to be the catalytic site of Ca²⁺ binding¹⁵. Through alignment of 10 PlPeLs proteins from P. litchii and homologous proteins of PlPeL1/PlPeL1-like across 15 oomycete species, we identified that both PlPeL1 and PlPeL1-like contained seven conserved aspartic (D) residues (Supplementary Fig. 5, Supplementary Data 1 and Data 2). To probe the functional importance of these conserved D residues, we created mutants PlPeL1^M1 or PlPeL1-like^M1 (both containing SP) by converting them to alanine (A) residues. Following agroinfiltration, we confirmed protein expression through western blot analysis (Supplementary Fig. 6a). We assessed the pectate lyase activity of PlPeL1, PlPeL1-like, and mutants by determining the levels of reducing oligogalacturonic acid using polygalacturonic acid as substrate⁴⁰, with RFP as a negative control. These assays demonstrated that the pectate lyase activity of PlPeL1^M1 or PlPeL1-like^M1 was significantly lower than that of PlPeL1 or PlPeL1-like (Fig. 1e).

Next, we expressed PlPeL1, PlPeL1-like and mutants in N. benthamiana leaves using agroinfiltration. The infiltrated regions were inoculated with mycelia plugs of Ph. capsici at 24 h post-agroinfiltration (hpa). At 2 dpi, we measured the lesion diameter caused by Ph. capsici and observed that lesions on leaves expressing PlPeL1 and PlPeL1-like were significantly larger than those on leaves expressing RFP (Fig. 1f, g). In contrast, PlPeL1^M1 or PlPeL1-like^M1 did not significantly affect the infection of Ph. capsici on N. benthamiana (Fig. 1f, g), suggesting that two mutants lost the ability to promote N. benthamiana susceptibility. These results suggested that the enzymatic activity was essential for the virulence function of both PlPeL1 and PlPel1-like.

PlPeL1 and PlPeL1-like interact with LcPIP1

We screened interacting proteins of PlPeL1/PlPeL1-like by the yeast two-hybrid (Y2H) system using the PlPeL1/PlPeL1-like proteins without SP. By screening the litchi cDNA library, we identified a PlPeL1-interacting protein named PlPeL1-interacting protein 1 (LcPIP1). LcPIP1 is composed of 91 amino acid and possesses a 16 aa SP, but no domain with known function was predicted. Furthermore, the interaction analysis between PlPeL1-like and LcPIP1 revealed that LcPIP1 interacted with both PlPeL1 and PlPeL1-like within the Y2H system (Fig. 2a).

We tested the interaction between PlPeL1/PlPeL1-like and LcPIP1/NbPIP1 by Co-IP assays in planta, and the results showed that PlPeL1-HA or PlPeL1-like-HA was co-immunoprecipitated with LcPIP1-RFP or NbPIP1-RFP, but not with RFP (Fig. 2b). Furthermore, we performed an in vitro glutathione S-transferase (GST) pull-down assay using proteins produced in Escherichia coli strain BL21 strain and found that PlPeL1 or PlPeL1-like interacted with LcPIP1 and NbPIP1 (Fig. 2c). The above results supported the interaction of PlPeL1 and PlPeL1-like with both LcPIP1 and NbPIP1 in vivo and in vitro. Notably, the PlPeL1^M1 or PlPeL1-like^M1 also interacted with LcPIP1 (Supplementary Fig. 6b, c).

LcPIP1 and its homologs contribute to plant resistance and attenuate the susceptibility induced by PlPeL1/PlPeL1-like

Then, to determine the role of PIP1s in plant immunity to Ph. capsici, LcPIP1 was expressed and NbPIP1 was overexpressed in N. benthamiana leaves using agroinfiltration, with RFP as control. The expression of LcPIP1 effectively enhanced the N. benthamiana resistance to Ph. capsici, and so did NbPIP1 (Fig. 3a–c). Next, we silenced NbPIP1 in N. benthamiana using virus-induced gene silencing (VIGS). The transcript level of NbPIP1 was significantly reduced compared to the control (Fig. 3d). After inoculation with Ph. capsici, the lesions in NbPIP1-silenced leaves were similar to that in the control (Fig. 3e, f). Furthermore, we generated atpip1 mutants in Arabidopsis thaliana using CRISPR/Cas9-mediated genome editing⁴¹. Single nucleotide insertions or a 10-nucleotide deletion in AtPIP1 exons resulted in premature stop codons, leading to loss of AtPIP1 function (Supplementary Fig. 7a). The atpip1 mutants did not show remarkable morphology alterations compared with the Col-0 (Supplementary Fig. 7b), but they were more susceptible to Ph. capsici compared to the control (Col-0) (Fig. 3g–i). In addition, AtPIP1 exhibited up-regulation in the Col-0 plants during Ph. capsici infection (Supplementary Fig. 7c). These results suggested that LcPIP1 and its homologs contributed to plant immunity to Ph. capsici.

**Fig. 3: LcPIP1 and homologs enhance plants resistance and attenuate susceptibility induced by PlPeL1/PlPeL1-like.**

To study the interaction between PlPeL1/PlPeL1-like and PIP1s in planta, LcPIP1 was co-expressed with PlPeL1, PlPeL1-like or RFP in N. benthamiana leaves. When PlPeL1 was co-expressed with LcPIP1, the N. benthamiana leaves showed significantly smaller disease lesions than those lesion on leaves co-expressing PlPeL1 and RFP (Fig. 3a–c). Furthermore, N. benthamiana leaves co-expressing LcPIP1 and PlPeL1 showed similar resistance to Ph. capsici compared with leaves co-expressing LcPIP1 and RFP. The co-expression of PlPeL1-like and LcPIP1 also had similar results (Fig. 3a–c). Western blot analysis confirmed the expression of the above proteins in N. benthamiana (Supplementary Fig. 8a). The co-expression of LcPIP1 with PlPeL1 or PlPeL1-like did not interfere with the pectate lyase activity of PlPeL1 and PlPeL1-like (Supplementary Fig. 8b). Next, we analyzed the function of PlPeL1/PlPeL1-like in NbPIP1-silenced plants; PlPeL1, PlPeL1-like, and RFP were expressed in TRV-NbPIP1 plants through agroinfiltration, which were then inoculated with Ph. capsici. The lesions of Ph. capsici on PlPeL1-expressing NbPIP1-silenced leaves were larger than the lesions in the control plants. However, no differences in lesion diameter were found between TRV-NbPIP1 and TRV-GUS plants which expressed PlPeL1-like and RFP (Fig. 3j, k). The above results confirmed that PIP1s attenuated the susceptibility of N. benthamiana induced by PlPeL1 and PlPeL1-like.

LcPIP1 activates various immune responses in N. benthamiana and its homologs are widely present in land plants

The expression profile of the LcPIP1 was determined by qRT-PCR. LcPIP1 was up-regulated during P. litchii infection, especially at 6, 12, and 24 hpi (Fig. 4a), suggesting that LcPIP1 expression is responsive to P. litchii. Next, we compared the transcription levels of LcPIP1 in litchi infected with the WT strain to that in the knockout mutants (M6, M301, M34, and M43). In comparison to WT-infected litchi, the transcription levels of LcPIP1 were less up-regulated at 6 and 12 hpi than in litchi inoculated with double knockout mutants-infected (Fig. 4b). These results indicated that LcPIP1 expression might be indirectly regulated by PlPeL1 and PlPeL1-like in litchi. Furthermore, LcPIP1 exhibited ubiquitous expression in various litchi tissues, including leaves, branches shoots, panicles, flowers, and fruitlets (Supplementary Fig. 9a).

**Fig. 4: LcPIP1 induces plant immunity responses in *Nicotiana benthamiana*.**

To further investigate the mechanisms underlying PIP1-mediated resistance, we expressed LcPIP1 and evaluated its role in inducing cell death. Interestingly, LcPIP1 induced cell death at 3 dpa, accompanied by ROS accumulation and callose deposition at 36 hpa in N. benthamiana, while the negative control RFP did not (Fig. 4c, d; Supplementary Fig. 9b, c). Moreover, co-expressing PlPeL1^M1/PlPeL1-like^M1 with LcPIP1 resulted in increased electrolyte leakage in the injection area compared to the control (co-expression of RFP and LcPIP1) (Fig. 4e), suggesting that PlPeL1^M1/PlPeL1-like^M1 could enhance LcPIP1-induced cell death. Western blot analysis showed that all the proteins were expressed in N. benthamiana (Supplementary Fig. 9d). Furthermore, we examined the expression levels of genes related to salicylic acid (SA), jasmonic acid (JA), and the ethylene signaling pathway, and defense-related genes NbRbohb, in LcPIP1- or RFP-expressing leaves at different time points (24, 36, and 48 h). We found that NbPR1, NbPR2, NbNDR1, NbLOX, and NbRbohb were significantly up-regulated in the LcPIP1-expressing leaves from 24 to 48 h, compared with the control. NbERF1 was up-regulated at 24 h after expression of LcPIP1 (Fig. 4f). Therefore, LcPIP1 may induce a N. benthamiana immune response by activating SA- and JA- mediated defense pathways. In addition, we examined the expression levels of some PTI marker genes and the results showed that NbPTI5, NbAcre31, NbWRKY7, and NbWRKY8 were significantly up-regulated in the LcPIP1-expressing leaves. NbCYP71D20 was up-regulated at 24 hpa, and subsequently down-regulated at 36–48 hpa (Fig. 4g). Overall, these results suggested that LcPIP1 can activate diverse defense responses in N. benthamiana.

To assess the presence of LcPIP1 homologs in plants, we conducted a BLASTP search to obtain the homologs of LcPIP1 from 23 different land plant species (Supplementary Data 3). Additionally, litchi possesses a paralogous protein of LcPIP1, named LcPIP1PP, with 46% identity. All these proteins carry an SP and possess a conserved “VDMASG” motif. However, the homologous protein PpPIP1 in Prunus persica contains a slightly different motif, “VDMGSG” (Supplementary Data 3 and Supplementary Fig. 10a). Phylogenetic analysis indicated that LcPIP1 was most closely related to homologs from Sapindaceae, consistent with the established evolutionary relationships among these plant species (Fig. 5a). We expressed LcPIP1 and 11 homologs of LcPIP1 in N. benthamiana, and confirmed their expression through western blot analysis (Supplementary Fig. 10b). Interestingly, expression of the all tested LcPIP1 homologs from different groups, induced visible cell death at 4 dpa (Fig. 5b). These data indicated that sequence homogeneity of PIP1s is conserved in land plants, along with the cell-death-inducing function.

**Fig. 5: LcPIP1 homologs are widely present in land plants and the VDMASG motif is critical for cell death-inducing activity.**

Signal peptide and the VDMASG motif are critical for LcPIP1 cell death-inducing activity

The function of the SP of LcPIP1 was evaluated using a yeast secretion assay³⁷ (Supplementary Fig. 11a). After agroinfiltration, the LcPIP1 protein was detected in the apoplastic fluid (AF) and total tissue extracts (TE) (Fig. 5c). Furthermore, we expressed LcPIP1 and two mutants, LcPIP1^ΔSP (lacking its SP) and PR1^SP-LcPIP1^ΔSP (the SP of pathogenesis-related protein 1 (NbPR1) fused with LcPIP1^ΔSP), in N. benthamiana. Western blot analysis showed that all the proteins were expressed in N. benthamiana (Supplementary Fig. 11b). Notably, expression of LcPIP1 or PR1^SP-LcPIP1^ΔSP induced cell death at 3 dpa, while LcPIP1^ΔSP and the negative control RFP could not induce cell death in N. benthamiana (Fig. 5d). In addition, the previous studies indicated that PsXEG1 targeted to the extracellular space of N. benthamiana tissue induces cell death⁴². Expression of LcPIP1^SP-PsXEG1^ΔSP also induced cell death, while PsXEG1^ΔSP and LcPIP1^SP-RFP did not (Supplementary Fig. 11c). Western blot analysis confirmed the expression of all proteins in N. benthamiana (Supplementary Fig. 11d). All the above results demonstrated that the signal peptide possessed secretion function and was required for LcPIP1-inducing cell death.

To identify the key residues required for LcPIP1-inducing cell death, six truncated or site-directed mutants were constructed and expressed in N. benthamiana leaves (Fig. 5e). Western blot analysis showed that all the proteins were expressed in N. benthamiana (Supplementary Fig. 11e). The truncated protein M1 (LcPIP1^{1-75 aa}) induced cell death like the full-length LcPIP1 protein. Truncated proteins M2 and M4 (LcPIP1^{1-69 aa} and LcPIP1^{1-38 aa}) induced cell death and ROS accumulation in N. benthamiana to a much slighter degree than that triggered by the full-length LcPIP1 (Fig. 5e). Significantly, M5 (LcPIP1^{1-34 aa}) completely lost the ability to trigger cell death, while M6 (LcPIP1^{1-34&VDMASG aa}), which was fused M5 the “VDMASG” motif, induced cell death and ROS accumulation in N. benthamiana (Fig. 5e). Moreover, site-directed mutant M3, in which the conserved “VDMASG” motif was changed to six alanine residues, induced weak cell death (Fig. 5e). These findings suggested that the C-terminal “VDMASG” motif was important for the cell death-inducing activity of LcPIP1.

SERK3 is required for LcPIP1-induced cell death

To dissect the immune response mechanism induced by LcPIP1, we conducted VIGS-mediated silencing of key components in the plant innate immunity signaling pathway in N. benthamiana. These genes included SERK3A/B, SOBIR1, EDS1, NDR1, NPR1, WRKY1, WRKY3, SGT1, MEK2, MAPK3α, SIPK, and RAR1. The relative expression of these genes was verified by qRT-PCR (Supplementary Fig. 12a). Subsequently, cell death was assessed following LcPIP1 expression in these silenced plants. LcPIP1-induced cell death was greatly compromised in NbSERK3-silenced plants compared to GUS-silenced (Supplementary Fig. 12b, c). Western blot analysis confirmed that LcPIP1 was successfully expressed in NbSERK3-silenced plants (Supplementary Fig. 12d). Furthermore, the cell death proportion in the other gene-silenced plants was comparable to the control, but slightly attenuated in plants silenced for MEK1 (Supplementary Fig. 12b, c). Furthermore, compared with TRV-GUS plants, silencing of NbSERK3 compromised LcPIP1-induced transcript abundance of NbNDR1, NbWRKY7, and NbWRKY8 (Supplementary Fig. 12e). Transcript abundance of the three genes was not different in NbSERK3- or GUS- silenced plants expressing RFP (Supplementary Fig. 12e).

The receptor-like kinase SERK3 (also known as BAK1) is the central regulator of innate immunity in plants³⁴. To further validate that the significance of NbSERK3 in mediating LcPIP1-triggered immune responses in N. benthamiana, we expressed LcPIP1 or INF1 in the BAK1-knockout N. benthamiana^43,44. INF1 and its homologs exhibit high conservation in oomycete-specific, making them well-characterized canonical ELI-1 elicitors capable of inducing cell death^43,45. The extent of cell death was measured by monitoring electrolyte leakage. Compared with the wild-type control, LcPIP1 or INF1 induced cell death was reduced in BAK1-knockout lines at 2 dpa (Fig. 6a, b). Western blot analysis confirmed that proteins were successfully expressed (Fig. 6c). Next, we analyzed the susceptibility of BAK1-knockout and the wild-type N. benthamiana expressing LcPIP1 or GFP. In the wild-type, LcPIP1 expression resulted in smaller lesions caused by Ph. capsici. However, in the BAK1-knockout plants, the expression of LcPIP1 did not enhance resistance against Ph. capsici (Fig. 6d–f). Overall, these results demonstrated that NbSERK3 (BAK1) was a key regulator in LcPIP1-triggered immune responses in N. benthamiana.

**Fig. 6: SERK3 is required for LcPIP1-induced cell death.**

LcPIP1 interacts with SERK3 proteins

We successfully cloned four NbSERK3 (BAK1) homologs based on NbSERK3 sequences from NCBI and the Sol Genomics Network database, including NbSERK3A (Niben101Scf11779g01002.1), NbSERK3B (Niben101Scf00279g02022.1), NbBAK1a (Niben101Scf02128g00022.1), and NbBAK1b (Niben101Scf02513g11004.1). Co-IP assays analyzed the interaction between LcPIP1 and four NbSERK3s in vivo. LcPIP1-Flag co-immunoprecipitated with NbSERK3A-RFP, NbSERK3B-RFP, NbBAK1a-RFP, and NbBAK1b-RFP, but not RFP (Fig. 7a). To further validate the relationship between LcPIP1 and SERK3 of litchi, LcSERK3 (LITCHI011582), the gene encoding the protein homologous to NbSERK3A, was cloned from litchi cDNA and subsequently constructed into plasmids pBinRFP and pGEX-6P-1 for Co-IP and GST pull-down assays. Both Co-IP and GST pull-down assays confirmed that LcPIP1 interacted with LcSERK3 (Fig. 7b and Supplementary Fig. 13a). In addition, we independently validated the interactions between NbPIP1 and NbSERK3A/B, as well as AtPIP1 and AtBAK1 using Co-IP assays (Fig. 7c and Supplementary Fig. 13b).

**Fig. 7: PIP1s interact with SERK3 (BAK1), and PlPeL1/PlPeL1-like do not disrupt the LcPIP1-LcSERK3 interaction.**

LcSERK3 possesses both an extracellular domain (ECD) and a cytoplasmic domain (CD) (Fig. 7d). We performed Co-IP assays to investigate the interaction between LcPIP1 and LcSERK3 and identify the domain responsible for their association. LcPIP1-HA was co-expressed with LcSERK3-RFP, LcSERK3^ECD-RFP, LcSERK3^CD-RFP, or RFP in N. benthamiana. Co-IP assays showed that the extracellular domain of LcSERK3 interacted with LcPIP1, but the cytoplasmic domain did not (Fig. 7e).

We next tested whether the LcPIP1-LcSERK3 complex could be disrupted by PlPeL1 or PlPeL1-like. Co-IP assays between LcPIP1-Flag and LcSERK3-RFP were performed in N. benthamiana leaves expressing PlPeL1-HA or HA. We observed that LcPIP1-LcSERK3 interactions were not affected by the presence of PlPeL1 (Fig. 7f). The co-expression of PlPeL1-like, LcPIP1, and LcSERK3 also had similar results (Fig. 7g). These results suggested that PlPeL1 or PlPeL1-like did not disrupt the LcPIP1-LcSERK3 interaction. In addition, the LcPIP1^M3 with “VDMASG” motif changed to “AAAAAA” and with compromised cell death-inducing capacity, also could interact with LcSERK3 as shown by the Co-IP assay, to a comparable level as the full-length LcPIP1 protein (Supplementary Fig. 14).

Silencing of NbPIP1 in N. benthamiana compromises INF1-triggered cell death

Cell death triggered by INF1 requires NbSERK3⁴⁶, so we tested whether NbPIP1 was associated with INF1-induced cell death. The experimental results showed that silencing of NbPIP1 or NbSERK3 delayed INF1-mediated HR development. INF1-induced cell death was strong in the TRV-GUS plants at 48 h after transient expression of INF1, but only slight in NbPIP1-silenced plants (Fig. 8a–c). The expression of INF1 was analyzed by western blot which revealed that delayed cell death was not caused by different protein levels (Fig. 8a). We examined some defense-related genes and PTI marker genes in TRV-GUS and TRV-NbPIP1 plants after INF1 expression. The transcription leaves of nine marker genes other than WRKY8 were lower in TRV-NbPIP1 compared to the control (Fig. 8d). Moreover, NbPIP1 was significantly up-regulated in the INF1-expressing leaves from 24 to 36 h compared with the control (Fig. 8e), again indicating that NbPIP1 was involved in the INF1-mediated response. However, upon flg22 treatment, the expression of FRK and WRKY33 in the NbPIP1-silenced plants was comparable to that in the control plant (Supplementary Fig. 15). These results indicated that NbPIP1 positively regulated N. benthamiana PTI responses induced by INF1, but not by flg22.

Taken together, LcPIP1 was found to be a cell death-inducing protein which positively regulated plant defense (Fig. 8f). PIP1 induced SERK3- or other proteins-dependent cell death, ROS, and callose deposition, promoted the expression of marker genes of SA or JA signaling pathway and NbRbohb, contributing to plants defense against pathogens. PlPeL1/PlPeL1-like enhanced pathogen virulence via their pectate lyase activity, which involves the degradation of plant cell wall components. Meanwhile, PlPeL1/PlPeL1-like were targeted by LcPIP1, potentially amplifying LcPIP1-induced plant cell death.

Discussion

Plant cell walls serve as a crucial battleground in plant-pathogen interactions. Pathogens release a multitude of CWDEs, such as PeLs, to breach the cell wall barrier. Meanwhile, plants produce receptors and various CWDE inhibitors to trigger plant immunity and protect against damage¹⁰. However, the mechanisms by which plants respond to PeLs to mount defense responses remains broadly understudied.

In this study, two PeLs proteins, PlPeL1 and PlPeL1-like, coordinately contributed to the virulence of P. litchii. A growing number of studies support the critical role of PeLs in pathogenesis of plant pathogens^15,17. However, many studies have shown that deleting or silencing one or more PeL-encoding genes does not significantly impact pathogenicity^16,47. It appears that the loss of function in one PeL gene can be compensated for by other PeLs⁴⁸. In this study, individual deletions of PlPeL1 or PlPeL1-like did not affect the pathogenicity of P. litchii, but deletion of both genes drastically reduced virulence (Fig. 1c). We deduced that the up-regulation of PlPeL1 or PlPeL1-like in single-gene knockout mutants compensates for virulence defects (Supplementary Fig. 4). The structural arrangement of PlPeL1 and PlPeL1-like as a bidirectional gene pair, head-to-head genes, implies the possibility of sharing regulatory elements, such as transcription factors, promoters, and enhancers⁴⁹. Bidirectional promoters regulate the coordinated expression of gene pairs⁵⁰. PlPeL1 and PlPeL1-like exhibited similar expression patterns, implying a correlation in their expression. However, they displayed opposite transcription between 6-12 hpi (Supplementary Fig. 1e), which is consistent with the idea that there might be other mechanisms involved in the transcription regulation of bidirectional promoters⁵¹.

We found that PlPeL1/PlPeL1-like interacted with LcPIP1 (Fig. 2), independent of their key enzymatic activity sites (Supplementary Fig. 6). LcPIP1 induced cell death in N. benthamiana leaves, but without any functionally known domain. PIP1s contributed to the defense of N. benthamiana and A. thaliana against Ph. capsici. As a positive immune regulator, PIP1 interacted with SERK3, which is a central membrane-localized receptor-like kinase (RLK) and plays a crucial role in countering pathogen invasion. PIP1s activated defense pathways that attenuated PlPeL1/PlPeL1-like induced N. benthamiana’s susceptibility to Ph. capsici, and PlPeL1^M1/PlPeL1-like^M1 could enhance LcPIP1-induced cell death (Figs. 3 and 4e). Notably, PlPeL1/PlPeL1-like relied on enzymatic activity to facilitate pathogen invasion, which may involve cell wall degradation. Consequently, the mere expression of LcPIP1/NbPIP1 may not consistently suffice to fully counteract the virulence potential of PlPeL1/PlPeL1-like under natural conditions, resulting in an incomplete elimination of the virulence impact of PlPeL1/PlPeL1-like in P. litchii. Consequently, the pathogenicity of ΔΔplpel1/plpel1-like mutants was reduced. Additionally, it is possible that other effectors secreted by P. litchii inhibited the LcPIP1-induced response. A similar relationship exists between other pectinases and their interacting plant resistance proteins. For instance, plant polygalacturonase-inhibiting (PGIP) was inactivated by Sclerotinia sclerotiorum PGIP-inactivating Effector 1 (SsPINE1)⁵². Multiple CWDEs are essential virulence factors for pathogens, and also induce plant immune responses^42,53. These findings emphasize the intricate dynamics and competitive interactions between plants and pathogens.

In this study, we observed a significant up-regulation of LcPIP1, AtPIP1, and NbPIP1 when plants were exposed to biotic stress conditions, including infections by P. litchii, Ph. capsici, or A. tumefaciens (Figs. 4a, 8e, and Supplementary Fig. 7c). These results provide evidence for the involvement of PIP1s in plant responses to biotic challenges. Notably, the expression of either LcPIP1 or NbPIP1 significantly enhanced N. benthamiana’s resistance to Ph. capsici, but the NbPIP1-silenced plant did not exhibit significant susceptibility to Ph. capsici (Fig. 3). In addition, the atpip1 mutants displayed enhanced susceptibility to Ph. capsici infection. One possible explanation is that silencing of NbPIP1 using VIGS led to reduced expression, not complete elimination (Fig. 3d). With the complex network of plant defense responses in mind, another possibility is that the effects of NbPIP1 silencing may be partially compensated by other proteins within the intricate defense network of the plant. Additionally, the absence of homologous proteins of PlPeL1 and PlPeL1-like in Ph. capsici could potentially contribute to the observed lack of a significant difference in resistance to Ph. capsici between NbPIP1-silenced plants and the control. Furthermore, silencing of NbPIP1 in N. benthamiana resulted in an increased susceptibility to Ph. capsici induction by PlPeL1, while no significant impact was observed with PlPeL1-like (Fig. 3j, k). Notably, LcPIP1 had a stronger effect in dampening susceptibility induced by PlPeL1 compared to its effect on PlPeL1-like (Fig. 3c). PlPeL1 showed a greater than 20-fold increase in relative expression compared to PlPeL1-like at 24 hpi (Supplementary Fig. 1e), suggesting that the plant may require stronger activity to inhibit PlPeL1-mediated virulence. Nonetheless, these underlying mechanisms remain elusive and necessitate further comprehensive investigation.

The receptor-like kinase SERK3 forms complexes with PAMP receptors and is the central regulator of innate immunity in plants³⁴. SERK3 is involved in the regulation of various types of PCD⁵⁴. SERK3 may function as a co-receptor or signaling regulator for a variety of receptor kinases and PRRs. For example, SERK3 forms complexes with BRI1 to activate BR signaling⁵⁵, with FLS2 or EFR to regulate a PTI pathway⁵⁶, and interacts with BON1 and CNGC20 in modulation of cell death^57,58. In this study, we found that SERK3s interacted with PIP1s and were required for LcPIP1-induced cell death (Figs. 6 and 7). We speculate that LcPIP1 interacts with NbSERK3 to achieve signal transduction and activate the downstream immune response to trigger cell death in N. benthamiana. However, whether litchi can trigger immunity mediated by LcPIP1 and LcSERK3 by recognizing extracellular pathogen PeLs remains to be demonstrated. Moreover, LcPIP1-inducing cell death and plant immunity did not disappear completely in NbSERK3-silenced plants or BAK1-knockout lines (Fig. 6 and Supplementary Fig. 12). We speculate that LcPIP1-inducing cell death also depended on other plant receptors or signaling pathways. The interaction of LcPIP1^M3, the “VDMASG” motif-mutant, with LcSERK3 also provides evidence for this speculation (Supplementary Fig. 14). More research into the mechanism of LcPIP1-induced cell death is required.

HR triggered by INF1 has been shown to require the respiratory burst oxidase NbRbohb, MAPK kinase⁵⁹, and up-regulation of a large amount of genes transcription, such as PR (pathogenesis-related) protein genes, ET or JA-related genes⁶⁰. NbSERK3 regulates the immune responses triggered by INF1⁴⁶. In this study, silencing of NbPIP1 also delayed elicitin INF1-induced HR (Fig. 8a–c). Expression of NbPIP1 was induced by INF1 (Fig. 8e). We speculate that NbPIP1, interacting with NbSERK3, is a component of the protein complex responsible for INF1 perception and signal transduction. Notably, INF1-induced transcription levels of WRKY8 showed no difference between NbPIP1- and GUS- silenced plants (Fig. 8d). WRKY7, WRKY8, WRKY9, and WRKY11 have all been identified as crucial components in INF1-mediated PTI ROS bursts⁶¹. Moreover, these WRKY proteins, including WRKY8, are known to redundantly contribute to the transactivation of RBOHB upon INF1 treatment^61,62. In the NbPIP1-silenced plants, there was an observed delay in INF1-induced cell death, rather than complete inhibition. These findings could potentially explain the absence of transcriptional differences in WRKY8 between NbPIP1 and GUS-silenced plants. Further investigations are warranted to unravel the precise regulatory mechanisms governing WRKY8 expression and its potential interaction with NbPIP1 in the context of the immune response.

In this study, NbPR1, NbPR2, and NbNDR1 were significantly up-regulated in the LcPIP1-expressing leaves which are the marker genes of SA signaling pathway³¹. Moreover, NbEDS1 and NPR1 are two key components of the SA pathway^31,63. Salicylic acid (SA) plays an essential role in hemi-biotrophic pathogen resistance and immune signaling via PRR^64,65. Besides that, previous research has shown that high levels of SA facilitate programmed cell death⁶⁶. We investigated whether the above SA-related genes function in LcPIP1-induced cell death. However, cell death induced by LcPIP1 was not significantly affected in silenced leaves of NbEDS1, NbNDR1, and NbNPR1 (Supplementary Fig. 12). We hypothesize that the tested genes were not involved in LcPIP1-induced cell death.

In summary, our study unveils the dual roles of PlPeL1/PlPeL1-like in plant-pathogen interactions. PlPeL1/PlPeL1-like enhance pathogen virulence through pectate lyase activity while also being targeted by LcPIP1. LcPIP1/NbPIP1’s role in attenuating PlPeL1/PlPeL1-like induced N. benthamiana’s susceptibility to Ph. capsici may have resulted from immune activation following their interactions. PIP1 acts as a positive regulator of plant resistance, inducing cell death and up-regulating resistance-related genes in N. benthamiana, likely through direct interaction with an established co-receptor NbSERK3. The interactions of PlPeL1/PlPeL1-like and PIP1s in N. benthamiana may induce a stronger immune response. To our knowledge, this is the first report on plants directly targeting plant pathogen PeLs to trigger immune response via a positive immune regulator, providing mechanistic insights into plant-oomycete interaction.

Methods

Plant and microbe cultivation

Litchi trees were cultivated in an orchard located at the South China Agricultural University in Guangzhou, China. Nicotiana benthamiana used in this study included wild-type (WT) and BAK1-knockout lines^43,44. N. benthamiana was grown in the greenhouse at 16 h light per day of 21–25 °C. The Arabidopsis (Arabidopsis thaliana) Col-0 and knockout mutants were cultivated at 10–13 h light per day of 21–23 °C. Peronophythora litchii wild-type strain SHS3²¹, Δplpel mutants, and Phytophthora capsici strain LT263 were cultured on carrot juice agar (CJA) medium at 25 °C in the dark. For P. litchii sporangia production, five 9 mm diameter mycelial plugs were flushed with 2 mL sterilized water. The subsequent suspension was filtered using a 100 µm mesh filter and incubated at 16 °C for 1 h to induce zoospore release⁶⁷. Plasmids were propagated in Escherichia coli strain JM109, which was cultured at 37 °C. Agrobacterium tumefaciens strain GV3101 was cultivated at 28 °C for agroinfiltration into N. benthamiana. Saccharomyces cerevisiae strain AH109 was used for yeast two-hybrid assay, culturing at 30 °C.

Bioinformatics analysis

The genome sequence and gene annotations of P. litchii were obtained from NCBI (BioProject ID: PRJNA290406). The genome sequence of litchi was obtained from Sapinaceae Genomic (http://www.sapindaceae.com/)⁶⁸. Protein sequences were submitted to the web-based tool Simple Modular Architecture Research Tool (SMART, http://smart.embl-heidelberg.de/) to identify conserved functional domains. Protein signal peptides (SP) were predicted using SignalP-4.1 or SignalP-5.0 (http://www.cbs.dtu.dk/services/). The alignment of amino acid sequences was performed using BioEdit software. The phylogenetic dendrograms were constructed with the Neighbor-Joining algorithm (with the setting of 5000 bootstrap replications), by the MEGA 11.0 (http://megasoftware.net).

PlPeL1 and PlPeL1-like genes expression patterns analysis

Total RNAs from different development stages of P. litchii, including mycelia and zoospores, and samples from 3, 6, 12, and 24 h post-inoculation with zoospores on leaves, were extracted using the All-In-One DNA/RNA Mini-preps Kit (Bio Basic, Shanghai, China). Reverse transcription was performed using SYBR® Premix Ex Taq^TM II (TaKaRa, Japan). Expression profiles of PlPeL1 and PlPeL1-like genes were detected using quantitative reverse-transcription polymerase chain reaction (qRT-PCR) on qTOWER³ Real-Time PCR thermal cyclers (Analytik Jena, Germany) with SYBR® Premix Ex Taq^TM II (TaKaRa, Japan). The P. litchii actin gene (PlActin)⁶⁹ was used as an endogenous control, and the relative fold change was calculated using the 2^−ΔΔCT method. Primers used for these analyses were listed in Supplementary Data 4.

Peronophythora litchii transformation and virulence assays in litchi leaves

The vectors pYF2.3G-Ribo-sgRNA and pBluescript II KS were utilized for the knockout of PlPeL1 and PlPeL1-like using the CRISPR/Cas9 genome-editing system. Four sgRNAs were designed, with each pair targeting both PlPeL1 and PlPeL1-like. Subsequently, the constructs and pYF2-PsNLS-hSpCas9 were introduced into wild-type SHS3 protoplasts of P. litchii using the PEG-mediated transformation method^38,67. The transformed protoplasts were regenerated overnight, and the recovered mycelia were selected on CJA medium supplemented with 40 µg/mL G418 at 25 °C in the dark. Transformants were verified by genomic PCR and sequencing. Primers and constructs used for these analyses were listed in Supplementary Data 4 and Data 5. Pathogenicity assays were performed by applying suspensions containing 200 zoospore each of P. litchii WT and knockout-mutants on litchi leaves at 25 °C in the dark. Lesion diameters were recorded and photographed 48 h after inoculation. The significance of differences was analyzed with one-way ANOVA test and three independent replicates were set up, with at least six leaves in each replicate.

N. benthamiana RNA extraction and qRT-PCR

N. benthamiana leaf samples (n = 3) were ground in liquid nitrogen. The methods for RNA extraction and reverse transcription are as described above. The translation elongation factor 1 alpha (EF1α) was used as the endogenous control and the primers are listed in Supplementary Data 4.

Agrobacterium tumefaciens-mediated transient expression in N. benthamiana

PlPeL1 and PlPeL1-like genes were amplified from P. litchii cDNA and inserted into the pBin plasmid with an RFP or HA tag using ClonExpress MultiS One Step Cloning Kit (Vazyme, China). Primers and constructs used for these analyses were listed in Supplementary Data 4 and Data 5. Recombinant plasmids were transformed into the A. tumefaciens GV3101 by heat shock. Transformants were verified by PCR and cultured in Luria Bertani (LB) broth with rifampicin (25 μg/mL) and kanamycin (50 μg/mL) at 28 °C 200 rpm for 36 h. The A. tumefaciens cells were collected and resuspended three times with infiltration buffer (10 mM MgCl₂, 10 mM MES, pH 5.7, and 100 μM acetosyringone) to a final OD₆₀₀ of 0.4–0.6. The mixed cell suspensions were infiltrated into the leaves of N. benthamiana using blunt syringes. All the experiments have been repeated at least three times.

Enzyme activity assays of pectate lyase

Pectate lyase activity was assayed with 0.25% (w/v) polygalacturonic acid (PGA; Sigma) as the substrate⁴⁰. Target proteins were expressed in N. benthamiana leaves using agroinfiltration. A total of 0.1 g of infiltrated leaf tissue was collected at 2 dpa, and subjected to protein extraction with 1 mL pectate lyase extraction buffer (Cominbio, China). The reaction mixture of untreated leaf tissue was used as a negative control. An aliquot of 100 μL extraction solution was added to 900 μL of reaction buffer (0.5% PGA, 50 mM glycine-NaOH, pH 9.5, and 1 mM CaCl₂) and the solutions were measured using spectrophotometer (Thermo Scientific, USA) at 235 nm. The sample was then kept at 42 °C for 30 min. PeL was assayed by measuring the increase in absorbance at 235 nm. One unit (U) of enzyme activity was defined to be the amount of enzyme required to release 1 μmol of oligogalacturonic acid from PGA per minute at 42 °C, pH 9.5. Enzyme units were calculated using the formula, Units/g (measured sample) = (Absorbance after the reaction - Absorbance before the reaction) / (4600 L/mol/cm × 1 cm) × 0.001 L × 109/(0.1 mL × 0.1 g/1 mL)/30 min - Units/g (negative control). The molar absorption coefficient of the oligogalacturonides was 4600 L/mol/cm.

Generation of amino acid mutants of PlPeL1, PlPeL1-like, and LcPIP1

The generation of amino acid mutants for PlPeL1, PlPeL1-like, and LcPIP1 was carried out through a polymerase chain reaction (PCR) method. Primers were designed to encompass both the desired mutation site and its flanking sequences. Primers were listed in Supplementary Data 4. The PCR thermal cycling profile included an initial denaturation step at 95 °C for 5 min, followed by 34 cycles of denaturation at 95 °C for 30 seconds, annealing at 60 °C for 30 seconds, and extension at 72 °C for 30 seconds. A final extension step was performed at 72 °C for 5 min. After purifying the PCR product, the amplified DNA fragments were inserted into the enzyme-digested vector through homologous recombination, using (ClonExpress Ultra One Step Cloning Kit (Vazyme, China). The resulting recombinant DNA constructs, containing the desired amino acid mutation sequences, were then transformed into competent E. coli cells. Positive clones were selected and verified through DNA sequencing.

Phytophthora capsici inoculation assay

Target proteins were expressed in N. benthamiana leaves via agroinfiltration as described above. The infiltrated regions were inoculated with mycelia plugs (diameter = 5 mm) of Ph. capsici 24 h post infiltration in the dark. Lesion diameters were recorded and photographed under ultraviolet (UV) light at 48 h after inoculation. After analysis of variance with three replicates composed of 10 leaves each, one-way ANOVA was used to identified significantly different treatments at P = 0.05.

The A. thaliana leaves were inoculated with zoospores of Ph. capsici, following the procedure outlined by Li et al⁷⁰. Specifically, to prepare Ph. capsici zoospores, mycelium was incubated in 10% (v/v) V8 broth at 25 °C for 2–3 days, followed by three washes in autoclaved mineral water at room temperature. After 2 days of continuous light incubation, numerous sporangia were formed. To induce zoospore release, the cultures were subjected to a temperature shift, first at 4 °C for 30 min followed by incubation at 25 °C for 30 min. For zoospore inoculation, A. thaliana leaves were cut and incubated with 150 Ph. capsici zoospores at 25 °C in the dark.

Phytophthora capsici biomass detection

For biomass analysis, the infected N. benthamiana or A. thaliana leaves were ground in liquid nitrogen. Total DNA was extracted from the same areas around Ph. capsici-infected sites and used for quantitative PCR (qPCR) to quantify the ratio of host-to-pathogen biomass, using primers specific for plant NbEF1α or AtUBC9, and Ph. capsici Actin genes (Supplementary Data 4).

Generation of atpip1 mutants

To knockout AtPIP1 (AT5G58375), the CRISPR/Cas9-mediated genome-editing method was used⁴¹ with sgRNA (sg-AtPIP1: CATATTCCTTTCAGCGACTC). The genotypes of the transgenic plants were analyzed by PCR and Sanger sequencing using DNA extracted from transgenic plants as template, and primers used for these analyses are listed in Supplementary Data 4.

Yeast two-hybrid assay

A cDNA library derived from litchi leaves inoculated with P. litchii zoospore suspensions was constructed in the yeast vector pGADT7 (AD) (Clontech) for prey protein screening. PlPeL1 gene was cloned into the yeast vector pGBKT7 (BD) (Clontech) as bait. Recombinant BD-PlPeL1 plasmid was co-transformed into yeast cells (strain AH109) with AD-library and were selected using SD/-Trp/-Leu/-His or SD/-Trp/-Leu/-His/-Ade medium. The gene sequences of candidate targets were verified by individual colony PCR and sequencing. LcPIP1 was cloned into the vector pGADT7 and co-transformed into AH109 with pGBKT7-PlPeL1 and then tested on SD/-Trp/-Leu medium and SD/-Trp/-Leu/-His/-Ade medium with X-α-gal. BD-53 + AD-T and BD-Lam+AD-T were used as the positive and negative controls⁷¹, respectively.

Co-immunoprecipitation and western blot analysis

Proteins were extracted from the leaves of N. benthamiana after agroinfiltration using protein extraction buffer (no. P0013; Beyotime, China) supplemented with 0.1% (v/v) protease inhibitor cocktail (Sigma-Aldrich). The mixture was centrifuged at 4 °C 13000 g for 10 min, and the supernatant was transferred to a new tube. For Co-IP assays, 15 µL RFP-Trap-M beads (ChromoTek, China) were added to the supernatant and incubated at 4 °C for 1 h. After incubation, the beads were washed five times with protein extraction buffer. Subsequently, the beads were boiled with 40 μL of PBS and 10 μL of SDS-PAGE sample loading buffer for 10 min. The eluted proteins were then subjected to SDS-PAGE gel separation, followed by protein analysis using western blot.

Western blot analyses

Total proteins were separated using SDS-PAGE gels, followed by transfer to polyvinylidene fluoride (PVDF) membranes (Bio-Rad). The PVDF membranes were then blocked with 5% non-fat milk in PBST (phosphate-buffered saline + 0.1% Tween 20). Mouse anti-RFP-tagmonoclonal antibodies (ChromoTek, China), anti-Flag-tag, or anti-HA-tag monoclonal antibodies (Abmart, China) were used to detect the corresponding fusion proteins at a 1:5,000 dilution. After three washes with PBST, a goat anti-mouse antibody (1:10,000) was applied (Abmart, China). Finally, proteins were visualized using the Efficient Chemiluminescence kit, and photographs were taken with an imaging system (Bio-Rad ChemiDoc XRS + , USA).

In vitro GST pull-down

The plasmids pGEX-6P-1, pGEX-6P-1-PlPeL1, pGEX-6P-1-PlPeL1-like, pET32a- LcPIP1, and pET32a-NbPIP1 were expressed in E. coli strain BL21 to produce GST, GST-tagged PlPeL1/PlPeL1-like and His-tagged LcPIP1/NbPIP1 proteins at 18 °C and 180 rpm, in 0.2 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 10 h. The bacteria lysate containing GST-PlPeL1 or GST-PlPeL1-like was incubated with 40 μL GST magnetic beads (Thermo Fisher Scientific) for 1 h at 4 °C. After washing the beads five times with PBS, they were incubated with His-tagged proteins for 2 h at 4 °C. The beads were washed five times again, and the presence of His-LcPIP1 and His-NbPIP1 proteins was detected by western blot using anti-His antibody.

Collection of plant apoplastic fluid

The N. benthamiana apoplastic fluid was collected 2 days after agroinfiltration using Phosphate Buffered Saline (PBS) buffer (50 mM NaPO₄, 150 mM NaCl, pH = 7.0), following Dong et al.⁷². The samples were placed into a vacuum desiccato (Eppendorf, Germany), and a pressure of 60 hPa was applied for 5 min using a pump. After removing PBS buffer from the leaf surface using paper towels, the leaves were centrifuged at 1000 g for 6 min at 4 °C, and the apoplastic fluid was pooled into a tube. Subsequently, the N. benthamiana apoplastic fluids were filter-sterilized using 0.45 μm filters and either used immediately or stored at −80 °C. Proteins in the apoplastic fluid were determined by western blot.

Yeast signal trap assay

The function of the signal peptides (SPs) of PlPeL1/PlPeL1-like and LcPIP1 were tested in Saccharomyces cerevisiae YTK12 strain, using the pSUC2 vector, following the procedure outlined by Yin et al.³⁷. These SPs were integrated into the pSUC2 vector to create an in-frame fusion with invertase. The resulting vector were introduced into the yeast strain YTK12 and cultivated on CMD-W plates. Invertase secretion was detected by examining yeast cultures grown in YPAD liquid medium using the transparent triphenyltetrazolium chloride (TTC) assay. YTK12 strains were transformed with pSUC2-SPAvr1b or pSUC2 as positive and negative controls, respectively.

ROS and callose staining

For ROS staining, N. benthamiana leaves were collected 36 h after Agrobacterium infiltration and stained with 1 mg/mL 3,3′-diaminobenzidine (DAB) for 8 h in the dark and then decolored with ethanol. For the callose deposition assay, leaves were decolored with ethanol and stained for 1–2 h in 150 mM K₂HPO₄ buffer with 0.01% aniline blue. A microscope (Olympus, Japan) was used to take photographs. ImageJ software was used to assess ROS accumulation and callose deposition. At least three leaves were tested in each independent experiment. The experiments were repeated at least three times.

Electrolyte leakage

Leaves of N. benthamiana were cut into discs of 6 mm in diameter, which were floated on distilled water for 3 h at room temperature. The electrical conductivity (EC1) of the solution was measured with a meter (DDS-307A; Rex Shanghai). The sample was then boiled for 30 min and cooled to room temperature. The second electrical conductivity measurement (EC2) of the solution was taken. Electrolyte leakage was calculated as follows: electrolyte leakage (%) = EC1/EC2 × 100⁷³.

Accession numbers

Gene nucleotide and protein sequences used in this study were obtained from NCBI (https://www.ncbi.nlm.nih. gov), TAIR (https://www.arabidopsis.org/), Sapinaceae Genomic (http://www.sapindaceae.com/)⁶⁸, UniProt (https://www.uniprot.org/), or Sol Genomics Network (http://solgenomics.net/) databases. Accession numbers are as follows: PlPeL1, OR241278; PlPeL1-like, OR241279; LcPIP1, LITCHI031111; LcPIP1PP, LITCHI003344; LcSERK3, LITCHI011582; NbSERK3A, Niben101Scf11779g01002.1; NbSERK3B, Niben101Scf00279g02022.1; NbBAK1a, Niben101Scf02128g00022.1; NbBAK1b, Niben101Scf02513g11004.1; NbPIP1, Niben101Scf11235g01010; AtPIP1, AT5G58375; AtBAK1, AT2G23950.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The mRNA sequences for PlPeL1 and PlPeL1-like have been submitted to NCBI and assigned accession numbers OR241278 and OR241279, respectively. Data supporting the findings of this work are available within the paper and its Supplementary Information files. Source data are provided in this paper.

References

Lagaert, S., Beliën, T. & Volckaert, G. Plant cell walls: Protecting the barrier from degradation by microbial enzymes. Semin. Cell Dev. Biol. 20, 1064–1073 (2009).
Article CAS PubMed Google Scholar
Blackman, L. M., Cullerne, D. P. & Hardham, A. R. Bioinformatic characterisation of genes encoding cell wall degrading enzymes in the Phytophthora parasitica genome. BMC Genomics 15, 785 (2014).
Article PubMed PubMed Central Google Scholar
Juge, N. Plant protein inhibitors of cell wall degrading enzymes. Trends Plant Sci. 11, 359–367 (2006).
Article CAS PubMed Google Scholar
Kikot, G. E., Hours, R. A. & Alconada, T. M. Contribution of cell wall degrading enzymes to pathogenesis of Fusarium graminearum: a review. J. Basic Microbiol. 49, 231–241 (2009).
Article CAS PubMed Google Scholar
Nguyen, Q. B., Itoh, K., Van Vu, B., Tosa, Y. & Nakayashiki, H. Simultaneous silencing of endo-β-1,4 xylanase genes reveals their roles in the virulence of Magnaporthe oryzae. Mol. Microbiol. 81, 1008–1019 (2011).
Article CAS PubMed Google Scholar
Valette-Collet, O., Cimerman, A., Reignault, P., Levis, C. & Boccara, M. Disruption of Botrytis cinerea pectin methylesterase gene Bcpme1 reduces virulence on several host plants. Mol. Plant-Microbe Interact. 16, 360–367 (2003).
Article CAS PubMed Google Scholar
Wang, L., Rong, W. & He, C. Two Xanthomonas extracellular polygalacturonases, PghAxc and PghBxc, are regulated by type III secretion regulators HrpX and HrpG and are required for virulence. Mol. Plant-Microbe Interact. 21, 555–563 (2008).
Article PubMed Google Scholar
Sun, W. X. et al. Functional analysis of Pcipg2 from the straminopilous plant pathogen Phytophthora capsici. Genesis 47, 535–544 (2009).
Article CAS PubMed Google Scholar
Hématy, K., Cherk, C. & Somerville, S. Host-pathogen warfare at the plant cell wall. Curr. Opin. Plant Biol. 12, 406–413 (2009).
Article PubMed Google Scholar
Bellincampi, D., Cervone, F. & Lionetti, V. Plant cell wall dynamics and wall-related susceptibility in plant-pathogen interactions. Front. Plant Sci. 5, (2014).
Wu, P., Yang, S., Zhan, Z. & Zhang, G. Origins and features of pectate lyases and their applications in industry. Appl. Microbiol. Biotechnol. 104, 7247–7260 (2020).
Article CAS PubMed Google Scholar
Uluisik, S. & Seymour, G. B. Pectate lyases: Their role in plants and importance in fruit ripening. Food Chem. 309, 125559 (2020).
Article CAS PubMed Google Scholar
Dean, R. A. & Timberlake, W. E. Regulation of the Aspergillus nidulans pectate lyase gene (pelA). Plant Cell 1, 275–284 (1989).
CAS PubMed PubMed Central Google Scholar
Cnossen-Fassoni, A., Bazzolli, D. M. S., Brommonschenkel, S. H., Fernandes De Araújo, E. & de Queiroz, M. V. The pectate lyase encoded by the pecCl1 gene is an important determinant for the aggressiveness of Colletotrichum lindemuthianum. J. Microbiol. 51, 461–470 (2013).
Article CAS PubMed Google Scholar
Yang, Y. et al. A Verticillium dahliae pectate lyase induces plant immune responses and contributes to virulence. Front. Plant Sci. 9, 1271 (2018).
Article PubMed PubMed Central Google Scholar
Fu, L. et al. Characterization of cell-death-inducing members of the pectate lyase gene family in Phytophthora capsici and their contributions to infection of pepper. Mol. Plant-Microbe Interact. 28, 766–775 (2015).
Article CAS PubMed Google Scholar
Wegner, A. et al. Gene deletion and constitutive expression of the pectate lyase gene 1 (MoPL1) lead to diminished virulence of Magnaporthe oryzae. J. Microbiol. 60, 79–88 (2022).
Article CAS PubMed Google Scholar
Zhao, L., Wang, K., Wang, K., Zhu, J. & Hu, Z. Nutrient components, health benefits, and safety of litchi (Litchi chinensis Sonn.): a review. Compr. Rev. Food Sci. Food Saf. 19, 2139–2163 (2020).
Article CAS PubMed Google Scholar
Kong, G. et al. Detection of Peronophythora litchii on lychee by loop-mediated isothermal amplification assay. Crop Prot. 139, 105370 (2021).
Article CAS Google Scholar
Zerillo, M. M. et al. Carbohydrate-active enzymes in pythium and their role in plant cell wall and storage polysaccharide degradation. PLoS ONE 8, e72572 (2013).
Article CAS PubMed PubMed Central ADS Google Scholar
Ye, W. et al. Sequencing of the litchi downy blight pathogen reveals it is a Phytophthora species with downy mildew-like characteristics. Mol. Plant-Microbe Interact. 29, 573–583 (2016).
Article CAS PubMed Google Scholar
Situ, J. et al. Oomycete pathogen pectin acetylesterase targets host lipid transfer protein to reduce salicylic acid signaling. Plant Physiol. (2023).https://doi.org/10.1093/plphys/kiad638
Huysmans, M., Lema, A. S., Coll, N. S. & Nowack, M. K. Dying two deaths-programmed cell death regulation in development and disease. Curr. Opin. Plant Biol. 35, 37–44 (2017).
Article CAS PubMed Google Scholar
Balint Kurti, P. The plant hypersensitive response: concepts, control and consequences. Mol. Plant Pathol. (2019).
Chen, Q. & Yang, G. Signal function studies of ROS, especially RBOH-dependent ROS, in plant growth, development and environmental stress. J. Plant Growth Regul. 39, 157–171 (2020).
Article Google Scholar
Li, P. et al. Peronophythora litchii RXLR effector P. litchii avirulence homolog 202 destabilizes a host ethylene biosynthesis enzyme. Plant Physiol. 193, 756–774 (2023).
Article CAS PubMed Google Scholar
Nasir, K. H. B. et al. High-throughput in planta expression screening identifies a class II ethylene-responsive element binding factor-like protein that regulates plant cell death and non-host resistance. Plant J. 43, 491–505 (2005).
Article PubMed Google Scholar
Wang, C. et al. Xa7, a small orphan gene harboring promoter trap for AvrXa7, leads to the durable resistance to Xanthomonas oryzae Pv. oryzae. Rice. 14, (2021).
Takahashi, Y. et al. A high-throughput screen of cell-death-inducing factors in Nicotiana benthamiana identifies a novel MAPKK that mediates INF1-induced cell death signaling and non-host resistance to Pseudomonas cichorii. Plant J. 49, 1030–1040 (2007).
Article CAS PubMed Google Scholar
Zhou, L. et al. Rice hypersensitive induced reaction protein 1 (OsHIR1) associates with plasma membrane and triggers hypersensitive cell death. BMC Plant Biol. 10, 290 (2010).
Article CAS PubMed PubMed Central Google Scholar
Li, S. et al. The hypersensitive induced reaction 3 (HIR3) gene contributes to plant basal resistance via an EDS1 and salicylic acid-dependent pathway. Plant J. 98, 783–797 (2019).
Article CAS PubMed Google Scholar
Wu, X. et al. Genome-wide identification reveals that Nicotiana benthamiana hypersensitive response (HR)-like lesion inducing protein 4 (NbHRLI4) mediates cell death and salicylic acid-dependent defense responses to turnip mosaic virus. Front. Plant Sci. 12, 627315 (2021).
Article PubMed PubMed Central Google Scholar
Burke, R. et al. Stressed to Death: The role of transcription factors in plant programmed cell death induced by abiotic and biotic stimuli. Front. Plant Sci. 11, (2020).
Heese, A. et al. The receptor-like kinase SERK3/BAK1 is a central regulator of innate immunity in plants. Proc. Natl Acad. Sci. USA 104, 12217–12222 (2007).
Article CAS PubMed PubMed Central ADS Google Scholar
Chinchilla, D., Shan, L., He, P., de Vries, S. & Kemmerling, B. One for all: the receptor-associated kinase BAK1. Trends Plant Sci. 14, 535–541 (2009).
Article CAS PubMed PubMed Central Google Scholar
Schwessinger, B. et al. Phosphorylation-dependent differential regulation of plant growth, cell death, and innate immunity by the regulatory receptor-like kinase BAK1. PLoS Genet. 7, e1002046 (2011).
Article CAS PubMed PubMed Central Google Scholar
Yin, W., Wang, Y., Chen, T., Lin, Y. & Luo, C. Functional evaluation of the signal peptides of secreted proteins. Bio-Protocol. 8, (2018).
Fang, Y. & Tyler, B. M. Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR/Cas9. Mol. Plant Pathol. 17, 127–139 (2016).
Article CAS PubMed Google Scholar
Situ, J. et al. An RXLR effector PlAvh142 from Peronophythora litchi triggers plant cell death and contributes to virulence. Mol. Plant Pathol. 21, 415–428 (2020).
Article CAS PubMed PubMed Central Google Scholar
Zhang, C. et al. The alkaline pectate lyase PEL168 of Bacillus subtilis heterologously expressed in Pichia pastoris is more stable and efficient for degumming ramie fiber. BMC Biotechnol. 13, 26 (2013).
Article CAS PubMed PubMed Central Google Scholar
Bao, Y. et al. A pair of G‐type lectin receptor‐like kinases modulates nlp20‐mediated immune responses by coupling to the RLP23 receptor complex. J. Integr. Plant Biol. 65, 1312–1327 (2023).
Article CAS PubMed Google Scholar
Ma, Z. et al. A Phytophthora sojae glycoside hydrolase 12 protein is a major virulence factor during soybean infection and is recognized as a PAMP. Plant Cell 27, 2057–2072 (2015).
Article CAS PubMed PubMed Central Google Scholar
Chen, Z. et al. Convergent evolution of immune receptors underpins distinct elicitin recognition in closely related Solanaceous plants. Plant Cell 35, 1186–1201 (2023).
Article PubMed Google Scholar
Sun, Y. et al. Plant receptor-like protein activation by a microbial glycoside hydrolase. Nature 610, 335–342 (2022).
Article CAS PubMed ADS Google Scholar
Jiang, R. H. Y., Tyler, B. M., Whisson, S. C., Hardham, A. R. & Govers, F. Ancient origin of elicitin gene clusters in Phytophthora genomes. Mol. Biol. Evol. 23, 338–351 (2006).
Article CAS PubMed Google Scholar
Chaparro-Garcia, A. et al. The receptor-like kinase SERK3/BAK1 is required for basal resistance against the late blight pathogen Phytophthora infestans in Nicotiana benthamiana. PLoS ONE 6, e16608 (2011).
Article CAS PubMed PubMed Central ADS Google Scholar
Rogers, L. M. et al. Requirement for either a host- or pectin-induced pectate lyase for infection of Pisum sativum by Nectria hematococca. Proc. Natl Acad. Sci. USA 97, 9813–9818 (2000).
Article CAS PubMed PubMed Central ADS Google Scholar
Kubicek, C. P., Starr, T. L. & Glass, N. L. Plant cell wall-degrading enzymes and their secretion in plant-pathogenic fungi. Annu. Rev. Phytopathol. 52, 427–451 (2014).
Article PubMed Google Scholar
Tsai, H., Huang, P., Kao, C. & Wang, D. Co-expression of neighboring genes in the zebrafish (Danio rerio) genome. Int. J. Mol. Sci. 10, 3658–3670 (2009).
Article CAS PubMed PubMed Central Google Scholar
Trinklein, N. D. et al. An abundance of bidirectional promoters in the human genome. Genome Res. 14, 62–66 (2004).
Article CAS PubMed PubMed Central Google Scholar
Li, Y. Y. et al. Systematic analysis of head-to-head gene organization: evolutionary conservation and potential biological relevance. PLoS Comput. Biol. 2, e74 (2006).
Article PubMed PubMed Central ADS Google Scholar
Wei, W. et al. A fungal extracellular effector inactivates plant polygalacturonase-inhibiting protein. Nat. Commun. 13, (2022).
Wang, C. et al. Pectate lyase from Fusarium sacchari induces plant immune responses and contributes to virulence. Microbiol. Spectr. 11, (2023).
Gao, X., Ruan, X., Sun, Y., Wang, X. & Feng, B. BAKing up to survive a battle: Functional dynamics of BAK1 in plant programmed cell death. Front. Plant Sci. 9, (2019).
Wang, X. et al. Sequential transphosphorylation of the BRI1/BAK1 receptor kinase complex impacts early events in brassinosteroid signaling. Dev. Cell. 15, 220–235 (2008).
Article CAS PubMed Google Scholar
Roux, M. et al. The Arabidopsis leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to hemibiotrophic and biotrophic pathogens. Plant Cell 23, 2440–2455 (2011).
Article CAS PubMed PubMed Central Google Scholar
Wang, Z., Meng, P., Zhang, X., Ren, D. & Yang, S. BON1 interacts with the protein kinases BIR1 and BAK1 in modulation of temperature-dependent plant growth and cell death in Arabidopsis. Plant J. 67, 1081–1093 (2011).
Article CAS PubMed Google Scholar
Yu, X. et al. The receptor kinases BAK1/SERK4 regulate Ca²⁺ channel-mediated cellular homeostasis for cell death containment. Curr. Biol. 29, 3778–3790 (2019).
Article CAS PubMed PubMed Central Google Scholar
Hein, I., Gilroy, E. M., Armstrong, M. R. & Birch, P. R. J. The zig-zag-zig in oomycete-plant interactions. Mol. Plant Pathol. 10, 547–562 (2009).
Article CAS PubMed PubMed Central Google Scholar
Imano, S. et al. AP2/ERF transcription factor NbERF-IX-33 is involved in the regulation of phytoalexin production for the resistance of Nicotiana benthamiana to Phytophthora infestans. Front. Plant Sci. 12, (2022).
Adachi, H. et al. WRKY transcription factors phosphorylated by MAPK regulate a plant immune NADPH oxidase in Nicotiana benthamiana. Plant Cell 27, 2645–2663 (2015).
Article CAS PubMed PubMed Central Google Scholar
Adachi, H., Ishihama, N., Nakano, T., Yoshioka, M. & Yoshioka, H. Nicotiana benthamiana MAPK-WRKY pathway confers resistance to a necrotrophic pathogen Botrytis cinerea. Plant Signal. Behav. 11, e1183085 (2016).
Article PubMed PubMed Central Google Scholar
Zhang, Y. & Li, X. Salicylic acid: biosynthesis, perception, and contributions to plant immunity. Curr. Opin. Plant Biol. 50, 29–36 (2019).
Article CAS PubMed Google Scholar
Zhou, J. M. & Zhang, Y. Plant immunity: danger perception and signaling. Cell 181, 978–989 (2020).
Article CAS PubMed Google Scholar
Shibata, Y., Kawakita, K. & Takemoto, D. Age-related resistance of Nicotiana benthamiana against hemibiotrophic pathogen Phytophthora infestans requires both ethylene- and salicylic acid-mediated signaling pathways. Mol. Plant-Microbe Interact. 23, 1130–1142 (2010).
Article CAS PubMed Google Scholar
Fu, Z. Q. et al. NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486, 228–232 (2012).
Article CAS PubMed PubMed Central ADS Google Scholar
Li, W. et al. A Cytochrome b₅-like heme/steroid binding domain protein, PlCB5L1, regulates mycelial growth, pathogenicity and oxidative stress tolerance in Peronophythora litchii. Front. Plant Sci. 12, (2021).
Li, J. et al. SapBase (Sapinaceae Genomic DataBase): a central portal for functional and comparative genomics of Sapindaceae species. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 2022.
Jiang, L. et al. A Puf RNA-binding protein encoding gene PlM90 regulates the sexual and asexual life stages of the litchi downy blight pathogen Peronophythora litchii. Fungal Genet. Biol. 98, 39–45 (2017).
Article CAS PubMed Google Scholar
Li, Q. et al. A Phytophthora capsici effector targets ACD11 binding partners that regulate ROS-mediated defense response in Arabidopsis. Mol. Plant. 12, 565–581 (2019).
Article CAS PubMed Google Scholar
Lyu, X. et al. A small secreted virulence-related protein is essential for the necrotrophic interactions of Sclerotinia sclerotiorum with its host plants. Plos Pathog. 12, e1005435 (2016).
Article PubMed PubMed Central Google Scholar
Dong, S. et al. Effector specialization in a lineage of the Irish potato famine pathogen. Science 343, 552–555 (2014).
Article CAS PubMed ADS Google Scholar
Ma, T. et al. Plasmopara viticola effector PvRXLR111 stabilizes VvWRKY40 to promote virulence. Mol. Plant Pathol. 22, 231–242 (2021).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This work was supported by the China Agriculture Research System (CARS-32), the National Natural Science Foundation of China (31701771), and the Natural Science Foundation of Guangdong Province, China (2022A1515010458). We thank Professor Brett Tyler (Oregon State University, United States) for offering plasmids. We appreciate Professors Yuanchao Wang and Yan Wang (Nanjing Agricultural University, China) for offering BAK1-knockout N. benthamiana seeds. We are very grateful to Professor Tom Hsiang (University of Guelph, Canada) for the English revisions of the manuscript.

Author information

These authors contributed equally: Wen Li, Peng Li.

Authors and Affiliations

National Key Laboratory of Green Pesticide/Guangdong Province Key Laboratory of Microbial Signals and Disease Control, South China Agricultural University, Guangzhou, China
Wen Li, Peng Li, Junjian Situ, Wenzhe Zhou, Minhui Li, Pinggen Xi, Guanghui Kong & Zide Jiang
State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources/Integrative Microbiology Research Center, South China Agricultural University, Guangzhou, China
Yizhen Deng
State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources/College of Life Sciences, South China Agricultural University, Guangzhou, China
Zhuoyuan He & Xiangxiu Liang

Authors

Wen Li
View author publications
You can also search for this author in PubMed Google Scholar
Peng Li
View author publications
You can also search for this author in PubMed Google Scholar
Yizhen Deng
View author publications
You can also search for this author in PubMed Google Scholar
Junjian Situ
View author publications
You can also search for this author in PubMed Google Scholar
Zhuoyuan He
View author publications
You can also search for this author in PubMed Google Scholar
Wenzhe Zhou
View author publications
You can also search for this author in PubMed Google Scholar
Minhui Li
View author publications
You can also search for this author in PubMed Google Scholar
Pinggen Xi
View author publications
You can also search for this author in PubMed Google Scholar
Xiangxiu Liang
View author publications
You can also search for this author in PubMed Google Scholar
Guanghui Kong
View author publications
You can also search for this author in PubMed Google Scholar
Zide Jiang
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Z.D.J., G.H.K., and W.L. designed the research; W.L., P.L., J.J.S., Z.Y.H., W.Z.Z., M.H.L., and P.G.X. performed the research; W.L., P.L., and Y.Z.D. analyzed the data; W.L., G.H.K., and J.J.S. wrote the paper; W.L., P.L., Y.Z.D., X.X.L., G.H.K., and Z.D.J. discussed and revised on the manuscript; All authors read and approved the submitted version.

Corresponding authors

Correspondence to Guanghui Kong or Zide Jiang.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Description of Additional Supplementary Files

Supplementary Data 1

Supplementary Data 2

Supplementary Data 3

Supplementary Data 4

Supplementary Data 5

Reporting Summary

Source data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Li, W., Li, P., Deng, Y. et al. A plant cell death-inducing protein from litchi interacts with Peronophythora litchii pectate lyase and enhances plant resistance. Nat Commun 15, 22 (2024). https://doi.org/10.1038/s41467-023-44356-y

Download citation

Received: 12 February 2023
Accepted: 11 December 2023
Published: 02 January 2024
DOI: https://doi.org/10.1038/s41467-023-44356-y

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.