NEMO reshapes the α-Synuclein aggregate interface and acts as an autophagy adapter by co-condensation with p62

Furthmann, Nikolas; Bader, Verian; Angersbach, Lena; Blusch, Alina; Goel, Simran; Sánchez-Vicente, Ana; Krause, Laura J.; Chaban, Sarah A.; Grover, Prerna; Trinkaus, Victoria A.; van Well, Eva M.; Jaugstetter, Maximilian; Tschulik, Kristina; Damgaard, Rune Busk; Saft, Carsten; Ellrichmann, Gisa; Gold, Ralf; Koch, Arend; Englert, Benjamin; Westenberger, Ana; Klein, Christine; Jungbluth, Lisa; Sachse, Carsten; Behrends, Christian; Glatzel, Markus; Hartl, F. Ulrich; Nakamura, Ken; Christine, Chadwick W.; Huang, Eric J.; Tatzelt, Jörg; Winklhofer, Konstanze F.

doi:10.1038/s41467-023-44033-0

Download PDF

Article
Open access
Published: 19 December 2023

NEMO reshapes the α-Synuclein aggregate interface and acts as an autophagy adapter by co-condensation with p62

Nature Communications volume 14, Article number: 8368 (2023) Cite this article

5989 Accesses
118 Altmetric
Metrics details

Subjects

Abstract

NEMO is a ubiquitin-binding protein which regulates canonical NF-κB pathway activation in innate immune signaling, cell death regulation and host-pathogen interactions. Here we identify an NF-κB-independent function of NEMO in proteostasis regulation by promoting autophagosomal clearance of protein aggregates. NEMO-deficient cells accumulate misfolded proteins upon proteotoxic stress and are vulnerable to proteostasis challenges. Moreover, a patient with a mutation in the NEMO-encoding IKBKG gene resulting in defective binding of NEMO to linear ubiquitin chains, developed a widespread mixed brain proteinopathy, including α-synuclein, tau and TDP-43 pathology. NEMO amplifies linear ubiquitylation at α-synuclein aggregates and promotes the local concentration of p62 into foci. In vitro, NEMO lowers the threshold concentrations required for ubiquitin-dependent phase transition of p62. In summary, NEMO reshapes the aggregate surface for efficient autophagosomal clearance by providing a mobile phase at the aggregate interphase favoring co-condensation with p62.

Identification of senescent, TREM2-expressing microglia in aging and Alzheimer’s disease model mouse brain

Article 18 April 2024

APOE4/4 is linked to damaging lipid droplets in Alzheimer’s disease microglia

Article Open access 13 March 2024

Proteome-scale discovery of protein degradation and stabilization effectors

Article 20 March 2024

Introduction

Cellular proteostasis is maintained by an elaborate network of protein quality control components, such as molecular chaperones, the ubiquitylation machinery, the proteasome, and the autophagy-lysosome pathway, to coordinate the proper triage, subcellular quarantine, and refolding or disposal of damaged proteins. In aging, proteotoxic stress along with a decline in the fidelity of protein quality control favors the accumulation of misfolded proteins, challenging the integrity of the cellular proteome. This is particularly relevant to postmitotic cells, such as neurons. In fact, the age-dependent accumulation of misfolded proteins is a characteristic feature of neurodegenerative diseases. Cells are equipped with two proteolytic machineries, the ubiquitin-proteasome system and the autophagy-lysosomal system that remove misfolded proteins depending on their subcellular localization, their structure, oligomerization state and posttranslational modifications. Both degradation pathways are critically regulated by ubiquitin in cooperation with specific ubiquitin-binding proteins that target cargo to the proteasome or to selective autophagy^1,2,3,4,5,6.

The selective autophagic degradation of aggregated proteins, referred to as aggrephagy, is mediated by several cargo receptors, such as p62/SQSTM1, NBR1, and TAX1BP1^7,8,9,10,11. p62 and NBR1 both bind to ubiquitinated cargo by their UBA (ubiquitin-associated) domains and cooperate as hetero-oligomers in forming local clusters on the cargo^{12,13,14,15,16}. NBR1 recruits TAXBP1, which drives autophagosome biogenesis by interacting with FIP200, a scaffold protein of the core autophagy machinery^16,17,18. Tethering of the aggregated cargo to the growing autophagosomal membrane is mediated by LC3 proteins, which bind to LIR (LC3-interacting region) motifs present in p62, NBR1, and TAXBP1. Finally, the cargo is engulfed by a double membrane and degraded upon fusion of the autophagosome with lysosomes.

Ubiquitylation is a multifaceted posttranslational modification, regulating a plethora of cellular processes. Its complexity is based on different variables, such as the number of ubiquitin molecules attached to substrates, the mode of inter-ubiquitin linkage, the formation of homo- and heterotypic chains, and the posttranslational modification of ubiquitin itself, for example by phosphorylation, SUMOylation, or NEDDylation^19,20,21,22. In conventional ubiquitylation, the C-terminal glycine of ubiquitin is linked to one of seven lysine residues of another ubiquitin molecule by an isopeptide bond. Alternatively, the C-terminal glycine can be linked to the N-terminal methionine of the acceptor ubiquitin, resulting in the formation of a peptide bond²³. This type of head-to-tail linkage is called linear or M1-linked ubiquitylation. Linear ubiquitin chains are exclusively generated by the RING-in-between-RING (RBR) E3 ubiquitin ligase HOIP, the catalytic component of the linear ubiquitin chain assembly complex (LUBAC). Within this complex, HOIP interacts with HOIL-1 and SHARPIN, which bind to the UBA domain of HOIP by their ubiquitin-like (UBL) domains, thereby activating autoinhibited HOIP^{24,25,26,27,28,29,30,31,32,33}. LUBAC has mostly been studied in the context of immune signaling, NF-κB activation, and cell death regulation^{34,35,36,37,38}. In these paradigms, the regulatory component of the IKK (inhibitor of ĸB kinase) complex NEMO (nuclear factor-κB essential modulator), also called IKKɣ, is an important player, serving both as an interactor of linear ubiquitin chains and a substrate of HOIP^39,40,41. Binding of NEMO to M1-linked ubiquitin chains via its UBAN (ubiquitin-binding in ABIN and NEMO) domain and also ubiquitylation of NEMO upon activation of innate immune receptors, such as the TNF receptor 1, induces a conformational change in NEMO and activates the associated kinases IKKα and IKKβ^26,42,43. The activated IKK kinases phosphorylate IĸBα (inhibitor of ĸBα), which is then modified by K48-linked ubiquitin chains and degraded by the proteasome. Thereby, NF-ĸB heterodimers, typically p65 and p50, are liberated from their binding to IĸBα and translocate to the nucleus to regulate the expression of NF-ĸB-dependent genes.

Amorphic or hypomorphic mutations in the NEMO-encoding IKBKG gene located on the X-chromosome are associated with Incontinentia pigmenti (IP), a condition that is usually lethal in male fetuses and thus almost exclusively occurs in female patients with mosaic X-chromosome inactivation^44,45,46. IP is a rare multisystem disorder that primarily affects the skin, but can also involve other ectodermal tissues including teeth, hair, nails, eyes, and the central nervous system⁴⁷. IP-linked mutations comprise rearrangements, nonsense, frameshift, splice site, or missense variants^45,46. Although IP can be inherited in an X-linked dominant fashion, between 65 and 75% of cases occur sporadically due to de novo mutations⁴⁸. The phenotypic heterogeneity of the clinical presentation is based on the fact that throughout the body, cells expressing the wildtype IKBKG allele co-exist with cells expressing the mutant IKBKG allele, hampering the analysis of patients’ biosamples and the establishment of patient-derived cellular models. We identified a patient with IP who developed early onset, rapidly progressive neurodegeneration with a widespread mixed proteinopathy, including α-synuclein, tau, and TDP-43 aggregates. The pathogenic p.Q330* NEMO variant is compromised in NF-ĸB pathway activation, explaining the manifestation of IP, but in addition causes defective protein quality control. NEMO deficiency favors the accumulation of misfolded proteins and impairs the clearance of protein aggregates by autophagy. In this work, we reveal a critical function of NEMO in proteostasis regulation by remodeling the aggregate interface and facilitating condensate formation of the autophagy cargo receptor p62.

Results

A pathogenic variant in the IKBKG gene encoding NEMO is associated with a widespread mixed proteinopathy and progressive neurodegeneration

A female patient, who was diagnosed with IP during her infancy developed parkinsonism (left-sided bradykinesia, hypophonia, slowed gait) at age 48 years. She noted initial benefit with treatment with carbidopa/levodopa, but her condition rapidly progressed, forcing her retirement from work as a school teacher at age 52 years. A dopamine transporter scan was markedly abnormal, showing near absence of tracer uptake within the caudate and putamen bilaterally. She then developed severe cognitive impairment and died at age 56 years from progressive neurodegeneration. Brain autopsy revealed a widespread mixed proteinopathy, including α-synuclein, tau, and TDP-43 aggregates with predominant α-synuclein pathology (Fig. 1a). There was no family history of neurodegenerative diseases and whole-genome sequencing did not identify pathogenic or likely pathogenic variants in genes associated with neurodegenerative disorders (Supplementary Fig. 1). Genetic testing revealed a mosaic c.988 C > T nonsense mutation in the IKBKG gene, replacing glutamine at position 330 by a premature stop codon (p.Gln330*). If translated, the resulting p.Q330* NEMO variant would be truncated and lack the C-terminal region encompassing the leucine zipper (LZ) and zinc finger (ZF) (Fig. 1b).

**Fig. 1: NEMO is associated with pathological protein aggregates.**

Based on our previous finding that NEMO is recruited to misfolded huntingtin with a polyglutamine expansion (Htt-polyQ)⁴⁹, we investigated whether an IKBKG gene mutation resulting in NEMO dysfunction is causally linked to neuronal protein aggregation observed in our patient. A functional characterization of NEMO p.Q330* (hereafter referred to as Q330X) in cellular models showed that this mutant is defective in NF-κB signaling, explaining the clinical presentation with IP. In contrast to wildtype (WT) NEMO, Q330X NEMO was not able to promote TNF-induced degradation of IĸBα or NF-ĸB transcriptional activity (Supplementary Fig. 2a–d). We observed impaired NF-κB activation by Q330X NEMO also upon IL-1β receptor activation⁵⁰. However, our previous study revealed that HOIP was able to decrease Htt-polyQ aggregates independently of NF-κB activation⁴⁹. Therefore, we studied whether NEMO is a downstream effector of LUBAC-mediated protein quality control. First, we tested if endogenous NEMO is recruited to protein aggregates other than Htt-polyQ. Indeed, immunohistochemistry of brain slices from patients with Parkinson’s disease (PD), Alzheimer’s disease (AD) or frontotemporal dementia (FTD) provided evidence for both NEMO and M1-linked ubiquitin chains co-localizing at aggregates formed by α-synuclein, tau, or TDP-43 (Fig. 1c, d).

NEMO deficiency promotes protein aggregation under proteotoxic stress

To analyze a possible role of NEMO in proteostasis regulation, we quantified the amount of protein aggregates induced by heat stress, proteasomal and lysosomal inhibition in wildtype and NEMO knockout (KO) embryonic fibroblasts (MEFs) by Proteostat®, a red fluorescent molecular rotor dye that binds to the cross-beta spine quaternary structure of aggregated proteins. In the absence of NEMO, protein aggregation was significantly increased in response to both heat stress and lysosomal inhibition, and a trend towards more aggregates was observed upon proteasomal inhibition (Fig. 2a, b). In addition, NEMO-deficient cells were more vulnerable to proteotoxic stress. Cell viability of NEMO KO MEFs was significantly decreased in response to heat stress, proteasomal or lysosomal inhibition compared to wildtype NEMO MEFs (Supplementary Fig. 3a–c). We then made use of a luciferase-based sensor of proteostasis capacity, the conformationally destabilized double mutant firefly luciferase FlucDM (R188Q, R261Q) fused to EGFP^51,52. Imbalances in proteostasis induce misfolding and aggregation of this sensor, which can be monitored by the formation of FlucDM-EGFP-positive foci and a decrease in its luciferase activity. With the help of this sensor we compared the effects of wildtype and Q330X NEMO under basal and proteotoxic stress conditions in a NEMO-deficient background. NEMO KO MEFs transiently expressing FlucDM-EGFP and either wildtype or Q330X NEMO were quantified for the abundance of EGFP-positive foci and for luciferase activity. Heat stress (43 °C, 20 min) increased FlucDM-EGFP foci formation and decreased its luciferase activity in NEMO KO MEFs (Fig. 2c, d). Expression of wildtype NEMO significantly reduced foci formation and increased luciferase activity of FlucDM-EGFP under both basal and heat stress conditions, whereas Q330X NEMO had no effect (Fig. 2c, d). Interestingly, NF-κB was not activated by heat stress, as shown by an NF-ĸB luciferase reporter assay and a p65 nuclear translocation assay (Fig. 2e, f). In conclusion, NEMO plays a role in proteostasis regulation that seems to be independent of NF-κB activation.

**Fig. 2: NEMO protects from proteotoxic stress.**

Misfolded α-synuclein is decorated with M1-linked ubiquitin and NEMO

Since the NEMO mutant patient showed a predominant α-synuclein pathology, we employed cellular models of α-synuclein (aSyn) aggregation for mechanistic studies. Recombinant A53T aSyn preformed fibrils (PFFs) were added as seeds to SH-SY5Y cells stably expressing A53T aSyn fused to GFP (aSyn-GFP) to induce aggregation of aSyn-GFP^53,54,55. Intracellular aSyn aggregates formed upon seeding showed characteristic features of pathologic aSyn, such as phosphorylation at serine 129 and insolubility in detergents, as determined by immunocytochemistry and immunoblotting, respectively (Supplementary Fig. 4a, b). In addition, we characterized the aSyn seeds by Thioflavin T fluorescence, dynamic light scattering, and liquid atomic force microscopy (Supplementary Fig. 5a–f).

Consistent with our observation that M1-linked ubiquitin occurs at Lewy bodies in human brain (Fig. 1c), linear ubiquitin chains co-localized with aSyn aggregates in SH-SY5Y cells after seeding (Fig. 3a). Moreover, seeding of primary cortical neurons induced misfolding and serine 129 phosphorylation of endogenous aSyn, which stained positive for M1-linked ubiquitin (Fig. 3b). The presence of linear ubiquitin chains at aSyn in seeded SH-SY5Y cells was confirmed biochemically by affinity purification of aSyn-GFP followed by immunoblotting using M1-ubiquitin-specific antibodies⁵⁶ (Fig. 3c). Moreover, endogenous NEMO was significantly enriched at seeded aSyn aggregates (Fig. 3d) and all three LUBAC components were recruited to aSyn aggregates (Fig. 3e). In contrast, the RBR E3 ubiquitin ligase ARIH1 (Ariadne homolog 1), used as a control, was not recruited to aSyn aggregates (Fig. 3e).

**Fig. 3: NEMO and LUBAC components are recruited to aSyn aggregates.**

The Q330X NEMO mutant does not bind to M1-linked ubiquitin chains and is not ubiquitylated by HOIP

To gain further insight into the function of NEMO in proteostasis regulation, we compared the effect of wildtype NEMO and Q330X NEMO on aSyn aggregates in the SH-SY5Y seeding model. We first tested for NEMO recruitment and observed that Q330X NEMO did not efficiently co-localize with aSyn aggregates, whereas wildtype NEMO was strongly enriched at aSyn aggregates (Fig. 4a). Defective recruitment of Q330X NEMO to protein aggregates was confirmed in SH-SY5Y cells with Htt-polyQ (Htt-Q97) aggregates, indicating that this phenomenon is not limited to aSyn aggregates (Fig. 4b). We also performed filter retardation assays using the SDS-insoluble fraction of Htt-Q97-expressing NEMO KO MEFs reconstituted with either wildtype, Q330X or K285R/K309R NEMO. The K285R/K309R NEMO mutant lacks two critical lysine residues required for NEMO linear ubiquitylation⁵⁷. In contrast to wildtype NEMO, Q330X or K285R/K309R NEMO were less efficiently retained by the membrane together with Htt-Q97, suggesting decreased abundance of these mutants at Htt-Q97 aggregates (Fig. 4c).

**Fig. 4: In contrast to Q330X NEMO, WT NEMO is recruited to pathological protein aggregates and increases the abundance of M1-linked ubiquitin.**

We previously found that NEMO is recruited to Htt-polyQ aggregates by binding to linear ubiquitin chains generated by HOIP⁴⁹. Therefore, we compared the capacity of wildtype NEMO and Q330X NEMO to bind linear ubiquitin chains. Lysates of cells expressing either wildtype or Q330X HA-tagged NEMO were incubated with recombinant tetra-M1-ubiquitin (4×M1-ub), then NEMO was affinity-purified via its HA tag and immunoblotted using M1-ubiquitin-specific antibodies. In contrast to wildtype NEMO, Q330X NEMO did not bind to tetra-M1-ubiquitin, although the UBAN domain (residues 296–327) is not affected by the C-terminal deletion (Fig. 4d). Moreover, Q330X NEMO was not modified by linear ubiquitin chains, although the key ubiquitin acceptor lysine residues (K285 and K309) are present in this mutant⁵⁷. We induced M1-ubiquitination of HA-tagged NEMO by either treating the cells with TNF or overexpressing the LUBAC components HOIP, HOIL-1L, and SHARPIN (Fig. 4e). The cells were lysed under denaturing conditions, NEMO was immunoprecipitated via its HA tag and analyzed by immunoblotting using M1-ubiquitin-specific antibodies. Whereas wildtype NEMO was M1-ubiquitylated in both conditions, Q330X NEMO was not even ubiquitylated upon the overexpression of LUBAC (Fig. 4e). Next, we analyzed the interaction of wildtype NEMO and Q330X NEMO with endogenous HOIP by co-immunoprecipitation experiments. The NZF1 domain of HOIP interacts with the coiled-coil 2 (CC2) region upstream the UBAN domain of NEMO^57,58,59. HOIP did not co-purify with Q330X NEMO, which helps to explain why Q330X NEMO is not ubiquitylated (Fig. 4f).

Since NEMO not only binds to M1-linked polyubiquitin but also is covalently modified by HOIP, we followed up the hypothesis that NEMO increases M1-ubiquitylation at aSyn aggregates. We generated NEMO KO SH-SY5Y cells by CRISPR/Cas9 and induced aggregation of transiently expressed aSyn-GFP by adding aSyn seeds. NEMO KO SH-SY5Y cells were reconstituted with either wildtype NEMO or Q330X NEMO and the colocalization of M1-linked ubiquitin, NEMO, and aSyn aggregates was quantified by the Pearson coefficient. Colocalization of M1-linked ubiquitin and aSyn was strongly reduced when Q330X NEMO was expressed in comparison to wildtype NEMO (Fig. 4g, h, Supplementary Fig. 6a), suggesting that NEMO amplifies M1-ubiquitylation at aSyn aggregates. A disadvantage of the aSyn seeding model regarding biochemical studies is the low aggregation efficiency due to the fact that PFFs are taken up only by a subfraction of cells. To add more evidence for the role of NEMO in increasing the abundance of M1-linked ubiquitin at aggregates, we therefore used cells expressing Htt-Q97, resulting in aggregate formation in all cells transfected with Htt-Q97. HEK293T cells expressing Htt-Q97 or Htt-Q97 together with either wildtype NEMO, Q330X NEMO, or D311N NEMO, a mutant that is defective in binding to M1-linked ubiquitin^60,61, were lysed 72 h after transfection under denaturing conditions. The SDS-insoluble pellets containing the Htt-Q97 aggregates were dissolved in formic acid and analyzed by immunoblotting. Wildtype NEMO but neither Q330X nor D311N NEMO increased the M1-linked ubiquitin-specific signal, supporting the M1-ubiquitin-amplifying function of NEMO at protein aggregates (Fig. 4i).

A local NF-ĸB signaling platform is assembled at aSyn aggregates which does not promote a functional response

It has been shown recently that LUBAC is recruited to intracellular bacteria, such as Salmonella enterica, which can escape vacuoles and invade the cytosol^62,63,64. Modification of the bacterial surface with linear ubiquitin chains by HOIP induces anti-bacterial autophagy (xenophagy) and recruits NEMO for local activation of NF-ĸB. We therefore tested whether an NF-ĸB signaling platform is also assembled at aSyn aggregates. Indeed, endogenous phospho-IKKα/β (p-IKKα/β), p65, and phospho-p65 (p-p65) were strongly enriched at aSyn aggregates (Fig. 5a). However, we did not observe nuclear translocation of the NF-ĸB subunit p65 on day 1, 2, or 3 after seeding (Fig. 5b, c). To test whether NF-κB signaling is compromised in the presence of aSyn aggregates, we treated aSyn-expressing cells with TNF on day 1, 2 and 3 after seeding. Whereas almost 100% of non-seeded cells showed nuclear translocation of p65 in response to TNF treatment, p65 translocation was significantly reduced upon seeding with only about 50% of cells positive for nuclear p65 on day 3 after seeding (Fig. 5b, c). Super-resolution structured illumination fluorescence microscopy (SR-SIM) revealed that p65 is trapped at aSyn aggregates upon TNF stimulation, whereas in cells without aSyn aggregates, TNF-induced efficient nuclear translocation of p65 (Fig. 5c). Moreover, TNF-induced nuclear translocation was also impaired in SH-SY5Y cells expressing Htt-Q97, suggesting that pathogenic protein aggregates interfere with NF-κB signaling (Fig. 5d). These results indicated that although NF-κB is locally activated at aggregates, functional NF-κB signaling is impaired most probably through sequestration of p65 and possibly other NF-κB pathway components at the aggregates.

**Fig. 5: A local NF-κB signaling platform is assembled at aSyn aggregates that does not promote nuclear translocation of p65.**

NEMO promotes autophagosomal degradation of α-synuclein in a p62-dependent manner

Our previous data indicated that NEMO is recruited to aSyn aggregates along with other NF-κB signaling components without inducing a functional NF-κB response. Thus, NEMO seems to have an NF-κB-independent role in proteostasis regulation. Along this line, different protein aggregates accumulated in the brain of the Q330X NEMO patient, and wildtype NEMO but not Q330X NEMO reduced the fraction of cells with FlucDM-EGFP aggregates. LUBAC promotes the autophagic clearance of cytosol-invading bacteria^62,63,64, we therefore wondered whether linear ubiquitin chains can influence the degradation of protein aggregates by autophagy.

Intracellular aSyn can be degraded by both the proteasome and lysosomes depending on its posttranslational modifications, conformational state, and subcellular localization^65,66,67. To test whether linear ubiquitylation promotes degradation of aSyn aggregates via autophagy, we transiently expressed NEMO or HOIP in SH-SY5Y cells and quantified the fraction of cells with aSyn aggregates 48 h after seeding. Both wildtype NEMO and wildtype HOIP, but neither Q330X NEMO nor catalytically inactive C885A HOIP, decreased the number of cells with aSyn aggregates (Fig. 6a, b). Notably, inhibition of lysosomal degradation by bafilomycin A1 abolished the ability of NEMO and HOIP to reduce the number of cells with aSyn aggregates (Fig. 6a, b). We also tested the D311N NEMO mutant, compromised in binding to M1-linked ubiquitin^60,61. Similarly to Q330X NEMO, M1- and K63-ubiquitylation of D311N NEMO was impaired (Supplementary Fig. 6b). Also, it was not recruited to aSyn aggregates (Supplementary Fig. 6c) and did not reduce aSyn aggregates (Fig. 6a). To validate our observations for endogenous NEMO and HOIP, we downregulated the expression of NEMO or HOIP by RNA interference in the aSyn seeding model. Silencing of NEMO or HOIP increased the number of cells with aSyn aggregates to a similar extent (Fig. 6c), corroborating our results with NEMO or HOIP overexpression.

**Fig. 6: NEMO decreases the number of cells with aSyn aggregates in a p62-dependent manner.**

Since NEMO and HOIP apparently promote the degradation of misfolded aSyn depending on lysosomal function, we aimed at uncovering the underlying mechanism. Ubiquitylation is decoded and translated into cellular effects by specific ubiquitin-binding proteins. We reasoned that p62/SQSTM1 might be a promising candidate to test in our paradigm, based on its key role in targeting protein aggregates for selective autophagy^{5,12,68,69,70}. The ubiquitin-binding UBA domain of p62, which is required to shuttle cargo to the autophagic machinery, binds to M1-linked ubiquitin with the strongest affinity compared to other ubiquitin linkages⁷¹. Moreover, p62 has been reported to interact with NEMO^72,73,74 and to co-localize with Lewy bodies^75,76. We confirmed that endogenous p62 binds to aSyn aggregates in our seeding model (Fig. 6d) and that the recruitment of p62 to aSyn aggregates depends on its UBA domain (Supplementary Fig. 6d). Co-immunoprecipitation experiments using cell lysates revealed that in contrast to wildtype NEMO, the Q330X NEMO mutant does not interact with endogenous p62 (Fig. 6e).

To test for a role of p62 in mediating effects downstream of linear ubiquitylation, we analyzed aSyn aggregates in p62-deficient MEFs (p62 KO MEFs) expressing aSyn-GFP. Two days after seeding, about 75% of aSyn-GFP-expressing p62 KO MEFs displayed aSyn aggregates. Restoring p62 expression in p62 KO MEFs decreased the fraction of aggregate-positive cells to about 55%, similarly to the extent of aSyn aggregation observed in wildtype SH-SY5Y cells. Notably, the rescue effect of p62 was dependent on its UBA domain, since expression of p62-ΔUBA had no effect on the number of cells with aSyn aggregates in p62 KO MEFs (Fig. 6f). Increased expression of NEMO or HOIP in p62-deficient cells revealed a p62-dependent effect of both NEMO and HOIP, seen after reconstituting p62 KO MEFs with wildtype p62 in comparison to p62-ΔUBA (Fig. 6f). In addition, we observed a minor p62-independent effect in reducing aSyn aggregates, most probably mediated by other ubiquitin-binding autophagy receptors. Notably, the p62-dependent effect of NEMO was blocked by bafilomycin A1, confirming that p62 decreased aSyn aggregates downstream of NEMO by autophagosomal clearance (Fig. 6g).

Next, we wondered whether defective p62-dependent autophagosomal degradation of aSyn might explain the accumulation of aSyn aggregates in the Q330X NEMO patient. We analyzed brain sections from the Q330X NEMO patient by immunohistochemistry and found that colocalization of p62 with aSyn-positive aggregates was significantly reduced in comparison to patients suffering from other α-synucleinopathies, such as Dementia with Lewy Bodies (DLB) (Fig. 7a, b). Of note, p62 signal intensity was strongly increased in the Q330X NEMO patient’s brain, possibly reflecting a compensatory upregulation of p62 expression (Fig. 7c). Encouraged by these findings, we wondered whether an influence of NEMO on p62 recruitment to aSyn aggregates is also evident in cellular models. We induced aggregation of transiently expressed aSyn-GFP in wildtype and NEMO KO SH-SY5Y cells by adding aSyn seeds and visualized endogenous p62 by SR-SIM, which revealed a striking difference in the pattern of p62 localization at the aggregates. Whereas p62 mostly formed foci at the aggregate surface in the presence of NEMO, it showed a more diffuse distribution around the aggregates in the absence of NEMO (Fig. 7d). The same NEMO-dependent differences in the localization pattern at aSyn aggregates were observed for the autophagy receptor NBR1 (Fig. 7e), which cooperates with p62 in forming local clusters on protein aggregates¹⁶. Ubiquitin-dependent p62 condensation is required for efficient autophagic clearance of cargo^{14,15,16,77,78}, we therefore tested whether the non-condensated localization of p62 and NBR1 at aggregates has consequences on subsequent steps of the autophagic process. Indeed, the abundance of both LC3 and LAMP2 at aSyn aggregates was significantly decreased in NEMO KO cells (Fig. 7f, g). Thus, in the absence of NEMO, p62 and NBR1 are impaired in clustering at aggregated cargo, which compromises recruitment of the autophagic machinery.

**Fig. 7: p62 binds to aSyn aggregates in a NEMO-dependent manner.**

NEMO promotes p62 condensate formation at aggregates by lowering the threshold for ubiquitin-induced phase transition

We and others recently observed that NEMO undergoes phase separation upon binding to linear ubiquitin chains^50,79. Since Q330X NEMO is impaired in binding to M1-linked ubiquitin, it does neither phase-separate in vitro nor form condensates in cells⁵⁰. We therefore speculated that NEMO by interacting with M1-linked ubiquitin chains at protein aggregates may prime the aggregate surface for efficient p62 condensate formation. Fluorescence recovery after photobleaching (FRAP) of Halo-tagged NEMO expressed in NEMO KO cells indicated that NEMO forms a mobile phase at aSyn aggregates, whereas the aSyn aggregates show a non-dynamic behavior (Fig. 8a, b). We also observed by SR-SIM microscopy that endogenous p62, NEMO, and M1-linked ubiquitin co-localize in condensates at aSyn aggregates (Fig. 8c). Next, we tested a possible role of M1-linked ubiquitin in mediating the interaction between NEMO and p62 by using recombinantly expressed proteins. Wildtype or Q330X NEMO fused to MBP (maltose-binding protein) was mixed with mCherry-p62 in the presence or absence of M1-linked tetra-ubiquitin (4×M1-ub). NEMO was immunoprecipitated by MBP-specific antibodies and immunoblotted for p62. In the absence of 4×M1-ub, the p62 signal upon co-purification with NEMO was minimally increased over background, but strongly increased in the presence of 4×M1-ub (Fig. 8d). Similarly to the co-immunoprecipitation experiments in cellular lysates, p62 did not co-purify with Q330X NEMO, confirming that defective binding of linear ubiquitin to Q330X NEMO also affects its interaction with p62 (Fig. 8d).

**Fig. 8: NEMO promotes the local concentration of p62 by co-condensation with M1-linked ubiquitin.**

Our SR-SIM images indicated a foci-like staining also for NEMO and M1-linked ubiquitin at aggregates (Fig. 8c). This observation prompted us to study a possible effect of NEMO on ubiquitin-induced p62 condensation in vitro. We first tested whether p62 and NEMO can co-condensate. Recombinant mCherry-p62 and NEMO-GFP were mixed with or without recombinant tetra- or octa-M1-linked ubiquitin. Laser scanning microscopy revealed that co-condensation of p62 and NEMO occurred in presence of tetra- or octa-M1-linked ubiquitin, but not in the absence of M1-linked ubiquitin (Fig. 8e). We then studied p62 condensate formation dependent on the concentration of p62 and tetra- or octa-M1-linked ubiquitin (from 0.5 to 10 µM each) in the presence and absence of NEMO. As illustrated by phase diagrams, NEMO shifted p62 phase transition to the lowest concentration of both p62 and tetra- or octa-M1-ubiquitin (Fig. 8f). Thus, by co-condensation with p62 and M1-linked ubiquitin, NEMO facilitates the local concentration of p62. These results provide a mechanistic explanation for the impaired autophagic clearance of protein aggregates in the absence of functional NEMO observed in our cellular models and the Q330X NEMO patient brain samples.

Discussion

Here we demonstrate that NEMO has an NF-κB-independent role in maintaining cellular proteostasis by acting as an autophagy adapter protein. NEMO-deficient cells accumulate misfolded proteins upon proteotoxic stress and are hypersensitive to proteostasis dysregulation. The crucial role of NEMO in maintaining proteostasis was confirmed by the neuropathological alterations found in the Q330X NEMO mutant patient, who shows a progressive widespread mixed brain proteinopathy with predominant aSyn pathology. Studying this NEMO variant revealed that LUBAC-mediated formation of linear ubiquitin chains and binding of NEMO to linear ubiquitin chains are required to promote autophagosomal degradation of misfolded aSyn through the selective autophagy receptor p62. We previously reported that wildtype NEMO in contrast to Q330X NEMO has the propensity to form phase-separated condensates upon binding to linear ubiquitin chains⁵⁰. Here we show that through this propensity NEMO facilitates p62-dependent aggrephagy. Condensate formation with ubiquitinated cargo is a crucial event in p62-mediated autophagy, since it contributes to the recruitment of the autophagic machinery^{14,15,16,77,78}. Whereas the mechanism of autophagy initiation by p62 has been studied in great detail, little is known about processes at the aggregate interface required to locally concentrate and rearrange p62. Our study identified NEMO as a major player in priming the aggregate interphase for p62 condensation. At least two NEMO-dependent processes seem to be relevant in this context. First, NEMO amplifies linear ubiquitination at protein aggregates. This is accomplished by both binding to M1-linked ubiquitin via its UBAN domain and being M1-ubiquitylated by HOIP. HOIP is recruited to protein aggregates by VCP/p97 and can generate free, unanchored M1-linked polyubiquitin⁴⁹ or assemble M1-linked ubiquitin chains on pre-existing K63-linked chains⁸⁰, suggesting that the aggregated protein not necessarily needs to be modified directly by HOIP. Moreover, NEMO is a HOIP substrate available at protein aggregates. Accordingly, we found M1-linked ubiquitin and NEMO at various protein aggregates, including aSyn, Htt-polyQ, tau, and TDP-43. Second, binding of NEMO to M1-linked ubiquitin generates a mobile phase-separated aggregate surface, facilitating the local concentration of p62 by co-condensation. Indeed, liquidity at the cargo surface seems to be an important prerequisite for efficient selective autophagy^{81,82,83,84,85}.

The Q330X NEMO mutant lacks the C-terminal region including part of the LZ and the ZF domain. The region between the CC2 (coiled-coil 2) and LZ domain includes the UBAN domain and forms elongated parallel coiled-coil dimers⁵⁹. This region is required for binding to polyubiquitin, dimerization and interaction with HOIP^57,58,59. The UBAN domain binds M1-linked polyubiquitin chains 100-fold stronger compared to K63-linked chains, whereas the C-terminal ZF binds K63-linked polyubiquitin chains with high affinity^{61,86,87,88,89,90}. The ZF has also been reported to mediate binding to IκBα⁹¹ and to the ubiquitin chain-editing enzyme A20, a negative regulator of NF-κB activation⁹². Although the UBAN domain is present in the Q330X NEMO mutant, it cannot bind to M1-linked ubiquitin, most likely caused by conformational alterations or impaired dimer formation of Q330X NEMO.

The UBAN domain is an M1-ubiquitin-binding domain present in NEMO, Optineurin, and ABIN-1-3 (A20-binding inhibitors of NF-κB)⁸⁷. Whereas these UBAN proteins show differences in their ubiquitin-binding properties and their biological functions⁹³, they share a link to autophagy. Optineurin is a well-characterized autophagy receptor in mitophagy, xenophagy and aggrephagy^8,11, and ABIN-1 has recently been linked to mitophagy⁹⁴. In contrast to Optineurin and ABIN-1, NEMO has no LIR domain to directly interact with LC3. It rather functions as an indirect autophagy adapter protein by interacting with p62 in an M1-ubiquitin-dependent manner. Interestingly, the Drosophila melanogaster NEMO homolog Kenny has a LIR motif that interacts with Atg8/LC3 and promotes the autophagic degradation of the IKK complex in order to prevent constitutive production of antimicrobial peptides against commensal microbiota⁹⁵. According to a mathematical model proposed by Tusco et al., host-pathogen co-evolution could have been the driving force for the loss of the LIR motif in mammalian NEMO⁹⁵.

LUBAC-mediated quality control of cellular protein aggregates shares some similarities with its role in anti-bacterial autophagy. Bacteria that escape from the vacuolar compartment into the cytosol, such as Salmonella species, are coated by ubiquitin to restrict bacterial proliferation^62,63,64. In this pathway, the RNF213 ubiquitin ligase ubiquitylates the bacterial outer membrane component lipopolysaccharide (LPS), which is a prerequisite for the subsequent recruitment of LUBAC⁶⁴. HOIP binds to pre-existing ubiquitin at the bacterial surface and assembles M1-linked ubiquitin chains on bacterial membrane proteins or on ubiquitin moieties previously attached by RNF213. Linear ubiquitin chains then recruit Optineurin and NEMO to the bacterial surface, which both bind to M1-linked ubiquitin with high affinity via their UBAN domain. Whereas Optineurin induces selective autophagy to promote the clearance of bacteria, NEMO locally activates the IKK complex and thereby transforms the bacterial surface into an NF-ĸB signaling platform^62,63. LUBAC-mediated aggrephagy differs from bacterial xenophagy in some substantial aspects. First, HOIP is recruited to cytosolic bacteria via its NZF domain by pre-existing ubiquitin assembled by RNF213⁶⁴, whereas VCP/p97 is required to recruit HOIP to misfolded proteins by an interaction of the PIM domain of VCP/p97 with the PUB domain of HOIP⁴⁹. Second, Optineurin is required for anti-bacterial autophagy, whereas for the clearance of misfolded aSyn p62 plays a major role, though we cannot exclude an additional role of Optineurin. Third, NEMO is apparently dispensable for bacterial autophagy⁶² and mitophagy^74,96, but required for autophagic degradation of aSyn. This difference may be attributable to the fact that p62 is a key cargo receptor in aggrephagy. The increased abundance of p62 in the brain of the Q330X NEMO patient may reflect either a compensatory upregulation by transcription factors other than NF-ĸB, such as NRF2⁹⁷, or an accumulation of p62 due to a decreased autophagic flux.

Even though the role of LUBAC and NEMO in protein quality control seems to be independent of NF-ĸB signaling, impaired activation of the NF-ĸB prosurvival pathway may contribute to the toxicity of protein aggregates. Whereas prolonged and excessive NF-ĸB activation is associated with inflammation, constitutive NF-ĸB signaling in neurons regulates synaptic plasticity and neuronal viability^{98,99,100,101,102}. Moreover, induced NF-ĸB activation protects from neuronal cell death in various stress conditions^{102,103,104,105}. Of note, several neurotrophic proteins, such as NGF, BDNF, and GDNF, signal via NF-ĸB to promote neuronal viability^{106,107,108,109,110}. Our data indicate that similar to intracellular bacteria, an NF-ĸB signaling platform is assembled at aSyn aggregates. However, this signaling platform is not functional, since p65 seems to be sequestered and trapped at the aggregates so that not even an additional NF-ĸB-activating stimulus, like TNF, promotes nuclear translocation of p65. Thus, prosurvival signals cannot efficiently be transduced via NF-ĸB in cells with aSyn or Htt-polyQ aggregates. It is noteworthy in this context that our study revisits an earlier finding linking NEMO to PD. We previously discovered that linear ubiquitination of NEMO is a prerequisite for Parkin to prevent stress-induced neuronal cell death. This activity of Parkin was associated with adding K63-linked ubiquitin to NEMO, suggesting that Parkin can act as a priming E3 ligase for subsequent modification of NEMO by LUBAC^111,112. Whether Parkin also plays a role in LUBAC-mediated protein quality control is an interesting question to be addressed in further studies.

Finally, our study adds to the notion that different neurodegenerative diseases share common pathways. The accumulation of various proteins linked to neurodegeneration in the brain of the Q330X NEMO patient reflects a general neuronal proteostasis dysregulation, which at least partially can be explained by defective p62-mediated selective autophagy. The presence of α-synuclein, tau, and TDP-43 aggregates has also been reported in some patients with OPTN mutations affecting the UBAN domain of Optineurin, which binds linear ubiquitin chains¹¹³. Thus, neurodegeneration in these patients may also be linked to defective protein quality control downstream of LUBAC. Shared pathological mechanisms related to proteostasis dysregulation may entail specific targets for disease-modifying strategies. Further studies need to address whether the linear ubiquitination machinery can be exploited for therapeutic approaches.

Methods

Ethical statement

Research performed for this study complies with all ethical regulations of the respective local authorities the Charité Universitätsmedizin Berlin (Clinical Ethics Committee), and the Institute for Neuropathology, University Medical Center Hamburg-Eppendorf (Clinical Ethics Committee), Hamburg, Germany. Post mortem brain tissue from the index case with the NEMO mutation and age-matched controls from the same brain regions were obtained from the Autopsy Service in the Department of Pathology at the University of California San Francisco. Brain tissue samples were collected after informed consent was obtained from the patient or their families, in accordance with guidelines put forth in the Declaration of Helsinki. Autopsy consent and all protocols were approved by the Human Gamete, Embryo, and Stem Cell Research Committee and the Institutional Review Board (IRB) at UCSF.

Human brain sections

Post mortem brain samples from the Q330X NEMO patient, from DLBD patients and from respective controls were provided by the Department of Pathology, University of California, San Francisco, California, USA. PD brain samples were provided by the Charité Universitätsmedizin Berlin, Germany. Post mortem brain samples of frontal isocortex from neuropathologically confirmed AD, DLBD, FTLD and tauopathy patients were obtained from the Institute of Neuropathology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany. Available data are listed in the Supplementary Table 1.

Genetic analyses

For whole-genome sequencing (WGS) performed at CENTOGENE GmbH, genomic DNA was fragmented by sonication, and Illumina adapters were ligated to the generated fragments for subsequent sequencing on the HiSeqX platform (Illumina Inc., San Diego, CA). The achieved average coverage depth was at least 30x. Data analysis included base calling, de-multiplexing, and alignment to the hg19 human reference genome (Genome Reference Consortium GRCh37). The WGS finding was confirmed by Sanger sequencing of the relevant IKBKG exon on a ABI 3500xL Genetic Analyzer (Applied Biosystems) and analyzed using GeneMapper software (Applied Biosystems). The sequence variant nomenclature followed the standard Human Genome Variation Society guidelines (http://varnomen.hgvs.org/). Variants were classified according to the guidelines of the American College of Medical Genetics (ACMG)¹¹⁴. Written informed consent to participate in this study was provided. In addition, we obtained consent from the husband of the deceased patient to publish information that identifies individuals (including three or more indirect identifiers).

DNA constructs

The following constructs were described previously: human HOIP, HOIL-1L, SHARPIN, HA-HOIP, HOIL-1L-HA, SHARPIN-HA, HA-HHARI, FLAG-NEMO WT, FLAG-NEMO D311N, HA-IKKβ, mCherry, NF-κB-luciferase reporter¹¹¹; HA-HOIP C885A, Htt-Q25-GFP, Htt-Q97-GFP⁴⁹; p62 and p62ΔUBA¹². HA-NEMO WT and HA-NEMO D311N were generated using the following primers: HA-NEMO-fwd: 5′-ATATGGATCC AATAGGCACCTCTGGAAGAGC-3′, HA-NEMO-rev: 5′-ATATGCGGCCGC CTACTCAATGCACTCCATGACATG-3′. The amplified fragment was digested with BamHI and NotI and cloned into pcDNA3.1-N-HA. HA-NEMO Q330X was generated using the following primers: HA-NEMO Q330X-fwd: 5′- ATAT GGATCC AATAGGCACCTCTGGAAGAGC-3′, HA-NEMO Q330X-rev: 5′-ATATGCGGCCGCTCACAGGAGCTCCTTCTTCTCGG-3′. The amplified fragment was digested with BamHI and NotI and cloned into pcDNA3.1-N-HA. FLAG-NEMO Q330X was generated using the following primers: FLAG-NEMO Q330X-fwd 5’- GCGC AAGCTT ATGGACTACAAGGATGATGATGACAAG-3′, FLAG-NEMO Q330X-rev 5′- ATAT TCTAGA CTACAGGAGCTCCTTCTTCTCGGC-3′. The amplified fragment was digested with HindIII and XbaI and cloned into pEF4 -N-FLAG. HA-IκBα was generated using the following primers: HA-IκBα-fwd: 5′- ATAT GGATCC ACCGAGGACGGGGACTCG-3′, HA-IκBα-rev: 5′- ATAT GCGGCCGC CTATAACGTCAGACGCTGGCC-3′. The amplified fragment was digested with BamHI and NotI and cloned into pcDNA3.1-N-HA. p62ΔUBA-HA (AA 1-388) was generated using the following primers: p62ΔUBA-HA-fwd: 5′- ATAT GAATTC GCCACC ATG GCG TCG CTC ACC GTG-3′, p62ΔUBA-HA-rev 5′- TATAGCGGCCGC T GGC GGG AGA TGT GGG TAC-3′. The amplified fragment was digested with EcoRI and NotI and cloned into pcDNA3.1-C-HA. aSyn A53T-GFP was generated using the following primers: α-Synuclein A53T-eGFP-fwd: 5′- ATAT AAGCTT GCCACC ATG GAT GTA TTC ATG AAA GGA C-3′, α-Synuclein A53T-eGFP-rev: 5′- ATATGCGGCCGCGGCTTCAGGTTCGTAGTC-3′. The amplified fragment was digested with HindIII and NotI and cloned into pcDNA3.1-C-eGFP.

Cell lines

HEK293T cells (CRL-1573; American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS) and 100 IU/ml penicillin 100 μg/ml streptomycin sulfate. SH-SY5Y (DSMZ number ACC 209), were cultured in Dulbecco’s modified Eagle’s medium F-12 (DMEM/F-12) supplemented with 15% (v/v) fetal bovine serum (FBS), 100 IU/ml penicillin 100 μg/ml streptomycin sulfate and 1% non-essential amino acids. Mouse embryonic fibroblasts (MEFs) derived from wildtype or NEMO KO mice¹¹⁵ or p62 KO mice¹¹⁶ were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS) and 100 IU/ml penicillin 100 μg/ml streptomycin sulfate.

Generation of NEMO CRISPR/Cas9 knockout (KO) SH-SY5Y cells and HOIP CRISPR/Cas9 KO HeLa cells

sgRNAs (RNF31-24147982 AGGGUGUUGAGGUAGUUUCG; RNF31-24147993 GAGCCGUGGACAGGGUGUUG; IKBKG-154552050 UGUGAGAUGGUGCAGCCCAG; IKBKG-154552185 GAGGAGAAUCAAGAGCUCCG) were designed using the Synthego website (www.design.synthego.com). 1.5 nmol sgRNAs were rehydrated in 50 µl nuclease-free 1× TE buffer (10 mM Tris–HCl, 1 mM EDTA, pH 8.0) to a final concentration of 30 µM (30 pmol/µl). sgRNA and recombinant CAS9 were delivered as ribonucleoprotein (RNP) complexes using a 4D-Nucleofector X-Unit (Lonza). Briefly, for the assembly of the RNP complexes, Cas9 2NLS and sgRNAs were combined in Nucleofector™ solution at a molar ratio of 9:1 sgRNA to Cas9 and incubated for 10 min at room temperature. The cells were resuspended at a concentration of 150,000 cells/5 µl. 5 µl of the cell suspension was added to the 25 µl of pre-complexed RNPs for a total transfection volume of 30 µl per reaction and transferred to Nucleofector cartridges. Nucleofection was performed according to the predefined protocol (CA-137 for SH-SY5Y- and CN-114 for HeLa cells) and cells were carefully resuspended in each well of the Nucleocuvette™ with 70 µl of pre-warmed growth medium and transferred to the pre-warmed 6-well and incubated in a humidified 37 °C/5% CO₂ incubator. After 24 h the medium was replaced.

For clone screening, the cells were split into two 6-well cell culture plates, and pools were analyzed by PCR and subsequent DNA sequencing. For this, primer pairs (HOIP_fwd: AGTCCCACCCTCTCTCCTAG, HOIP_rev: TGTGACTGTAGCAACCTGGT, NEMO_fwd: CCTGGAGCTAGGCCTTTTCA, NEMO_rev: ACTTCCTCCCCGCTAATCTG) were ordered extending approx. 200–250 bp 3´and 5´ of the sgRNA binding region. To perform cell pool or single clone sequencing analysis, genomic DNA was isolated using a genomic DNA extraction kit (Monarch Genomic DNA Purification Kit, New England Biolabs, Frankfurt am Main, Germany) and the PCR was optimized to yield a single amplicon. Following PCR product purification (NucleoSpin Gel and PCR Clean-up, Macherey-Nagel GmbH, Düren, Germany), the DNA was sent for Sanger sequence analysis (Microsynth Seqlab GmbH, Göttingen, Germany). The KO efficiency of the cell pools and single colony clones was determined using the SYNTHEGO ICE analysis website (https://ice.synthego.com). To isolate single KO clones, the KO cell pools were diluted to 1 cell/100 µl and 5 cells/100 µl, and the dilutions were distributed over several 96-well plates. 15–25 clones were grown from single cells and reanalyzed using the above-mentioned process. Finally, clones with a high KO score were amplified and KO efficiency was confirmed by immunoblotting.

Expression and purification of recombinant proteins

Recombinant α-synuclein expression and seeding was performed as described previously^54,55. Briefly, α-synuclein (aSyn) A53T encoded on a pT7-7 plasmid was transformed into E. coli strain BL21 (DE3). Bacteria were grown in Terrific Broth medium supplemented with ampicillin at 37 °C to a density of an A600 value of 0.8–1.0, and protein expression was induced by adding 1 mM IPTG for 4 h at 37 °C. Bacteria were harvested by centrifugation (6000 rcf, 20 min, 4 °C). Pellet was resuspended in high-salt buffer (750 mM NaCl, 10 mM Tris, pH 7.6, 1 mM EDTA, protease inhibitor tablet (Roche)) and lysed by sonication at 60% power using a probe sonicator (Branson sonifier 450) for a total time of 5 min (30 s pulse on, 30 s pulse off), followed by boiling of the sample for 15 min. After cooling on ice, the sample was centrifuged for 20 min at 6000 rcf. The supernatant was dialyzed overnight with 10 mM Tris, pH 7.6, 50 mM NaCl, 1 mM EDTA. Protein was concentrated with a 3.5 kDa MWCO Amicon ultracentrifuge filter device (Millipore). After filtering the protein through a syringe filter (0.45 µm), the soluble proteins were separated by size exclusion chromatography on a Superdex 200 column (GE Healthcare Life Sciences). 40 2 ml fractions were collected using an ÄKTA chromatography system (GE Healthcare Life Sciences). Collected fractions were analyzed by SDS-PAGE using a 16% (w/v) polyacrylamide-gel followed by Coomassie staining/destaining. Fractions containing aSyn A53T were combined and dialyzed over night with 10 mM Tris, pH 7.6, 25 mM NaCl, 1 mM EDTA. On the next day, the combined fractions were subjected to anion-exchange chromatography on two connected 5 ml HiTrap Capto Q ImpRes (GE Healthcare Life Sciences) anion-exchange columns using a linear gradient, ranging from 25 mM NaCl to 1 M NaCl. Forty 2 ml fractions were collected using an ÄKTA chromatography system (GE Healthcare Life Sciences). Collected fractions were analyzed by SDS-PAGE using a 16% (w/v) polyacrylamide-gel followed by Coomassie staining/destaining. Fractions containing aSyn A53T were combined and dialyzed over night with 50 mM Tris, pH 7.5, 150 mM KCl. Protein was concentrated with a 3.5 kDa MWCO Amicon ultracentrifuge filter device (Millipore) to a concentration of 5 mg/ml. Aliquots of 1 ml were stored at −80 °C.

To prepare recombinant seeds for the induction of aSyn aggregates in SH-SY5Y cells stably expressing aSyn A53T-GFP, an aliquot containing 1 ml aSyn A53T with a concentration of 5 mg/ml was thawed on ice and centrifuged (20,000 rcf, 30 min, 4 °C). The supernatant was transferred into a new tube and incubated on a thermomixer for 24 h at 37 °C, 900 rpm. The sample was divided into 50 µl aliquots and stored at −80 °C until further use.

pET-Duet1-6xHis-mCherry-p62⁷¹ was recombinantly expressed and purified from E. coli Rossetta (DE3) pLysS cells. Bacteria were grown in Luria broth (LB) medium until OD600≈0.6, then induced with 0.3 mM isopropylthiogalactoside (IPTG) and grown at 20 °C for overnight. Harvested cells were resuspended in lysis buffer 50 mM 4-(2-hydroxyethyl)−1-piperazineethanesulfonic acid (HEPES) at pH 7.5, 500 mM NaCl, 10 mM imidazole, 2 mM MgCl₂, 2 mM β-mercaptoethanol, complete protease inhibitor, and DNase I and lysed by French press. Lysates were cleared by ultracentrifugation at 40,000 g for 45 min at 4 °C. Supernatants were applied to Nickel-Nitrilotriacetic (Ni-NTA) His-Trap FF column (GE Healthcare) and 6×His-tagged-mCherry-p62 was eluted via a stepwise imidazole gradient (50, 75, 100, 150, 200, and 300 mM). Protein-containing fractions were pooled and dialysed overnight at 4 °C in storage buffer containing 50 mM HEPES pH 7.5, 500 mM NaCl, 2 mM MgCl₂, 2 mM β-mercaptoethanol. The protein was filtered using a 0.45 μm syringe, aliquoted, and flash frozen until further use.

Wildtype NEMO-GFP and 4×M1-ubiquitin were expressed and purified as described previously⁵⁰. 8×M1-ub was bought from Enzo Life Sciences.

Induction of α-Synuclein aggregates by α-Synuclein A53T seeds in cultured cells and primary neurons

SH-SY5Y cells stably expressing aSyn A53T-GFP or MEFs transiently expressing aSyn- A53T-GFP were cultivated on glass coverslips (Laboratory Glassware Marienfeld) for immunofluorescence analysis or on cell culture dishes for biochemical analysis. 24 h after plating, transient transfection, or gene silencing, freshly sonicated aSyn A53T seeds were added to the cells to a final concentration of 12.5 µg/ml as follows:

50 µl of aSyn A53T seeds were thawed at room temperature and added to 950 µl Opti-MEM (Gibco) to obtain a concentration of 250 µg/ml. Sonication was performed with a probe sonicator (Branson sonifier 450) for 3 min (30% power, 10 s intervals). Sonicated seeds were added to 960 µl of Opti-MEM plus 40 µl Lipofectamine 2000 (Invitrogen) in order to increase uptake of seeds by the cells, to a final concentration of 125 µg/ml. After incubation for 15 min at room temperature, the seed solution was added to cells to obtain a final concentration of 12.5 µg/ml per well in Opti-MEM. After 24 h the cells were either harvested, fixed for immunofluorescence experiments, or Opti-MEM was exchanged by Dulbecco’s modified Eagle’s medium F-12 (DMEM/F-12) supplemented with 15% (v/v) FCS, 1% (v/v) Penicillin/Streptomycin (Gibco) and 1% (v/v) minimum essential medium non-essential amino acids (Gibco), and cells were further grown for 24 to 48 h prior to harvesting or fixing.

For the induction of aSyn aggregation in primary cortical mouse neurons by aSyn A53T seeds, cells were plated on poly-L-lysine- and laminin-coated coverslips, and sonicated aSyn A53T seeds were added on DIV 5 to a final concentration of 1 µg/ml. Primary neurons were fixed with 4% PFA 7 or 10 days after seeding and prepared for immunocytochemistry.

Detergent solubility assay

SH-SY5Y cells stably expressing aSyn A53T-GFP were grown in 3.5 cm dishes and harvested in cold PBS 24, 48, or 72 h after seeding with aSyn A53T seeds. Cells were lysed 10 min on ice in 1% (v/v) Triton X-100 in TBS supplemented with protease inhibitor (cOmplete, Roche) and phosphatase inhibitor (PhosStop, Roche). Samples were centrifuged (15 min, 20,000 rcf, 4 °C), the supernatants were transferred into new tubes, and 5× Laemmli sample buffer was added (1% Triton X-100-soluble fraction). The pellets were washed two times with lysis buffer, solved in 1% (w/v) SDS in TBS, and boiled 15 min at 99 °C. In addition, DNA was sheared by passing the samples 15 times through a 23-Gauge needle. Finally, 5× Laemmli sample buffer was added (1% SDS-soluble fraction). Equal amounts of the two fractions were used for analysis by immunoblotting using the indicated antibodies.

Immunocytochemistry

Cells were cultivated on glass coverslips (Laboratory Glassware Marienfeld). For some experiments, coverslips were coated with both poly-L-lysine (PLL) (Sigma) and laminin (Sigma) or PLL only. 24–72 h after seeding with aSyn A53T seeds, the cells were fixed for 10 min with 4% paraformaldehyde in PBS or Tris pH 7.4, and permeabilized and blocked in 0.2% (v/v) Triton X-100, 5% (v/v) goat serum in PBS or Tris for 2 h. Cells were stained with primary antibodies (Table 1) at a dilution of 1:100–1:1000 in 0.2% (v/v) Triton X-100, 5% (v/v) goat serum in PBS or Tris at 4 °C overnight, washed 3× with PBS or Tris, and incubated with fluorescent dye-conjugated secondary antibodies Alexa Fluor 488, 555, or 647 (Thermo Scientific), at a dilution of 1:1000 for 1 h at room temperature. After extensive washing, cells were mounted in Fluoroshield G (Thermo Scientific) with DAPI (Sigma).

Table 1 Antibodies used in this study

Full size table

Immunohistochemistry

For peroxidase immunohistochemistry, paraffin-embedded brain sections (5 µm) were deparaffinized with xylene and ethanol and briefly washed with deionized water. Brain sections were cut from archived paraffin tissue blocks obtained during routine brain autopsy after whole-brain fixation in formalin for at least two weeks. Antigen retrieval through microwaving in 100 mM citrate buffer pH 6.0 was followed by blocking of endogenous peroxidase with 5% H₂O₂ in methanol. Then sections were transferred in PBS with 0.02% Brij35 and blocked with 2% FBS in PBS. Incubation with the primary antibody (Table 1) was performed overnight at 4 °C. After rinsing with 0.02 % Brij35 in PBS, antibody binding was detected and enhanced by DCS Super Vision 2 HRP-Polymer-Kit (DCS, Germany) using the chromogen DAB. Counterstaining with hematoxylin for cellular structures was performed. Microscopic images were obtained with a BX50 microscope and Cell-D software (Olympus).

For immunofluorescence histochemistry, paraffin-embedded human brain sections were deparaffinized, and antigen retrieval was performed as described above. Sections were blocked and permeabilized with 10% (v/v) goat serum, 0.3% (v/v) Triton X-100 in PBS for 1 h. Primary antibodies at a dilution of 1:50 (α-synuclein), 1:100 (Tau, TDP-43, M1Ubi, and NEMO) or 1:250 (p62) in 10% (v/v) goat serum, 0.3% (v/v) Triton X-100 in PBS were incubated at 4 °C for 48 h. After the brain sections were washed 3x with PBS and blocked with 2% (w/v) BSA in PBS for 1 h, they were incubated with fluorescent dye-conjugated secondary antibodies Alexa Fluor 488 and 555 (Thermo Scientific) at a dilution of 1:1000 in 2% (w/v) BSA in PBS at room temperature for 1 h. After extensive washing, sections were mounted with Prolong Gold including DAPI (Thermo Fisher Scientific). Confocal images were obtained using a Zeiss ELYRA PS.1 equipped with an LSM880 (Carl Zeiss, Oberkochen). Super-resolution and confocal images were processed using the ZEN2.1 software (Carl Zeiss, Oberkochen).

Fluorescence microscopy

Fluorescence microscopy was performed using a Zeiss ELYRA PS.1 system equipped with an LSM880 (Carl Zeiss, Oberkochen) and a 20x/0.8, 63x/1.4 oil or 100x/1.46 oil immersion objective or a C2+ system (Nikon). Super-resolution images were generated by the Structured Illumination (SIM) technology using 405, 488, 561, and 647 nm widefield laser illumination. SIM confocal images were processed using the ZEN Black software (Carl Zeiss, Oberkochen), image data were exported using the ZEN Blue software for further use. For the analysis of stained human brain sections, laser scanning microscopy was performed using the 405, 488, 561, and 647 nm laser illumination set in individual channels to avoid cross-talk. The pinhole was adjusted to generate optical section of 2–5 µm, the acquisition settings were kept constant throughout the experiment. For the analysis of p62 positive aSyn aggregates in human brain sections, a 2 × 2 tile scan using the 20x/0.8 objective acquired and subsequently stitched with ZEN Black software.

Colocalization studies

To investigate the colocalization of aSyn, NEMO and M1-ub, the respective cell lines were transiently transfected with pcDNA3.1 aSyn A53T-GFP and seeded with aSyn seeds as described above. After 48 h the cells were fixed and stained with the respective antibodies as described under Immuncytochemistry. To quantify the colocalization of NEMO and aSyn, M1-ub and NEMO, and M1-ub and aSyn, samples were imaged with constant laser settings, and respective signal thresholds were set to specific signal intensities and kept constant throughout the experiment. A contour was drawn around each protein aggregate and the Pearson colocalization coefficient within the contour was plotted for each comparison.

Fluorescence recovery after photobleaching (FRAP)

For FRAP analysis, the Halo tag was labeled by incubating the cells for 30 min with 2.5 µM TMR dye and washing for 30 min with cell culture medium prior to live cell imaging. FRAP was performed by 5 consecutive bleaching pulses using the 561 nm laser at 100% intensity within a defined region of interest (white circle) at an aSyn-GFP protein aggregate (green outline). The measurement within the aSyn-GFP aggregates was performed using 5 consecutive bleaching pulses with the 488 nm laser at 100% intensity at the indicated regions of interest (white circle). Fluorescence recovery was measured every 20 ms for 3 min and plotted as a percentage of baseline fluorescence.

3D-image reconstruction and surface coverage analysis

To investigate the coverage by LC3 and LAMP2 and the spatial localization of p62 and NBR1 at aSyn protein aggregates, image acquisition was performed using a Zeiss Elyra7 equipped with the SIM² module. Images stacks of 3–8 µm in z were collected using the Leap-function and the minimal interval. Following the SIM conversion by ZEN 3.0 black, images were imported into Imaris 10.0.3 image analysis software. 3D-surfaces of aSyn aggregates and the respective antibody signal were reconstructed using the Surface module in batch mode. Surface-to-surface contacts sites were analyzed using a MatLab Plugin (Imaris website modules). The coverage of the reconstructed aSyn aggregate surface by the respective antibody signal was quantified and plotted as the percentage of the total aSyn-GFP aggregate surface.

Analysis of condensate formation

Fluorescent imaging laser scanning microscopy was performed using an LSM880 (Carl Zeiss, Oberkochen) with a 63× oil immersion objective. A 63× NA 1.4 oil immersion objective was used to record a z-stack of 67.5 × 67.5 × 10 and 0.330 μm for each optical section. The argon laser power was set to 0.006% at 488 nm with pixel dwell time of 5.71 μs. During all measurements, laser power, gain, and field of view were kept constant. The Z-stacks were then processed to obtain maximum intensity projections.

Immunoprecipitations

Cells were lysed in 1% (v/v) Triton X-100 in PBS supplemented with 30 mM NEM (Sigma), protease inhibitor (cOmplete, Roche), and phosphatase inhibitor (PhosStop, Roche). The lysates were cleared by centrifugation (20,000 × g, 4 °C, 15 min). Samples were incubated overnight with anti-HA magnetic beads (Thermo Scientific) or for 5 h with GFP-Trap magnetic agarose (Chromotek) at 4 °C under rotation. Beads were washed five times with 1% (v/v) Triton X-100 in PBS. Immunopurified proteins were eluted by adding 2x Laemmli sample buffer and boiling for 10 min at 95 °C. Samples were analyzed by immunoblotting using the indicated antibodies (Table 1).

p65 translocation assay

SH-SY5Y cells stably expressing α-Synuclein A53T-GFP were plated on cover slips, and after 24 h they were treated with α-Synuclein A53T seeds ( + seeds) or PBS as a control (−seeds). One, two, and three days post-seeding, cells were treated with 25 ng/ml TNF (PeproTech) for 15 min as indicated and fixed with PFA. Samples were analyzed by immunocytochemistry using an antibody for p65. Nuclear translocation was quantified using the green, red, and DAPI channel of a fluorescence microscope (Nikon Eclipse E400).

Quantification of aSyn A53T-GFP aggregates

After preparation of the samples on coverslips, they were analyzed using the green, red, and DAPI channel of a fluorescence microscope (Nikon Eclipse E400). Cells containing aggregates or fibrillar structures of aSyn A53T-GFP were counted positive, cells with neither aggregates nor fibrillar structures but with cytosolic and nuclear GFP staining were counted negative. When plasmids were transiently transfected during sample preparation, only cells positive for the transfected construct were considered. For quantification of the percentage of cells with aggregates five independent experiments were performed, and at least 150 cells were analyzed per condition for each replicate.

Analysis of SDS-insoluble Htt-Q97 proteins

HEK293T cells transfected with the indicated plasmids were grown on 10 cm dishes. Three days after transfection, the cells were harvested and lysed under denaturing conditions in TEX buffer (70 mM Tris–HCL pH 6.8, 1.5% SDS (w/v), 20% glycerol (v/v)), vortexed for 10 s, heated to 99 °C, and DNA was sheared by passing the samples 15 times through a 23-Gauge needle. Subsequently, DTT was added to the samples at a final concentration of 50 mM, the samples were boiled for 10 min at 99 °C, and centrifuged for 60 min (20,000 rcf, room temperature). The SDS-insoluble pellets were dissolved in 70 μl 100% formic acid by incubation of the samples for 40 min at 37 °C while shaking at 1000 rpm. Formic acid was evaporated overnight at 30 °C using a Speedvac system (Eppendorf). The remaining protein pellets were solved in Laemmli sample buffer and boiled for 10 min at 95 °C. SDS-insoluble, formic acid-dissolved aggregates were analyzed by immunoblotting using the M1-ubiquitin-specific antibody 1F11/3F5/Y102L.

Filter retardation assay

To detect Htt aggregates, transfected cells were lysed in 1% (v/v) Triton X-100, 50 mM MgCl₂ and 0.2 mg/ml DNase I in PBS. After centrifugation (180,000 × g for 30 min at 4 °C) the pellet was resuspended in 2% SDS in 100 mM Tris (pH 7.0). After 1 h incubation at room temperature the homogenates were diluted 1:5 in 100 mM Tris (pH 7.0) and filtered through a cellulose acetate membrane with 0.2 μm pore size (GE) using a Slot Blot Blotting Manifold (Hoeffer).

Sedimentation assay

An aliquot of both aSyn A53T seeds and aSyn A53T monomers was thawed at room temperature. 10 µl of each sample was centrifuged for 10 min at 20,000 rcf, respectively. The supernatant was transferred into a new tube and 10 µl of 2× Laemmli sample buffer was added (sup). The pellets were resuspended in 200 µl PBS and centrifuged again (20,000 rcf, 10 min). Supernatants were discarded and 10 µl PBS and 10 µl 2× Laemmli sample buffer were added to the pellets (pellet). Sup and pellet fractions of both seeds and monomeric aSyn A53T were analyzed by SDS-PAGE and Coomassie staining/destaining.

Thioflavin T assay

An aliquot of both aSyn A53T seeds and aSyn A53T monomers was thawed at room temperature. For each sample 4 technical replicates were prepared: For each technical replicate either 5 µl of seeds, monomeric aSyn A53T, or PBS were pipetted into a black 96-well plate (Berthold), respectively. Samples were incubated with 95 µl of a 25 µM Thioflavin T (Sigma–Aldrich) in PBS solution for 45 min at room temperature. Fluorometry was performed using a microplate reader (Cytation 5, BioTek, excitation 442 nm, emission 485 nm).

Atomic force microscopy (AFM)

AFM measurements were conducted on a Bruker Bioscope RESOLV, using Peak Force Tapping Mode at 2 kHz resonant frequency. For liquid AFM measurements a ScanAsyst Fluid+ probe from Bruker Nano was run at 0.5 nN setpoint and a peak force amplitude of 90 nm. Freshly cleaved MICA from PLANO was used as a substrate for in situ measurements. Beam alignment was done in the buffer solution. 4 µl of the target solution was drop cast on the MICA substrate, shortly after (max. 10 s) the volume was filled with 2 ml buffer solution. For dry AFM measurements a ScanAsyst Air probe from Bruker Nano was run at 1.3 nN setpoint and a peak force amplitude of 150 nm. A silicon wafer from PLANO was used as a substrate for dry measurements. 4 µl of the target solution was spin coated on the Si-substrate (5.59 × g) and air counter flux.

Dynamic light scattering (DLS)

DLS measurements were performed on a Malvern Instruments Zetasizer Ultra (633 nm laser source), in a 20 µl quartz cuvette (ZEN2112). The displayed data were recorded over three cycles in back-scattering mode. The total acquisition time was 2 s. Attenuation and position where fixed by the device automatically. The refractive index and absorbance of polystyrene was used.

Analysis of proteotoxic stress

Immunocytochemistry

MEFs were cultivated on glass coverslips (Laboratory Glassware Marienfeld). 24 h after seeding, cells were heat stressed at 42 °C for 1 h or treated with 0.5 µM MG-132 for 48 h or 100 nM BafA1 for 48 h. Cells were fixed for 15 min with 4 % paraformaldehyde in PBS pH 7.4 and permeabilized with 0.5% (v/v) Triton X-100, 3 mM EDTA pH 8.0, and 5% goat serum in PBS for 30 min at room temperature and then stained with Proteostat® (Enzo Life Sciences, Inc.) at a dilution of 1:2000 in 1× assay buffer (ENZO) for 20 min. Cells were then mounted in Fluorshield with DAPI (Sigma). Fluorescence microscopy was performed using a Zeiss ELYRA PS.1 equipped with an LSM880 (Carl Zeiss, Oberkochen) with a 63 × oil immersion objective. Super-resolution images were generated by the Structured Illumination (SIM) technology. SIM confocal images were processed using the ZEN2.1 software (Carl Zeiss, Jena).

Trypan blue dye exclusion

Cells were seeded in a 6-well dish at a density of ~500,000 cells. After 24 h, cells were either heat stressed at 46 °C for 1 h or treated with MG-132 for 16 h (2 µM), or 24 h (2 µM), or 48 h (0.5 µM) or treated with BafA1 for 16 h (500 nM), or 24 h (500 nM), or 48 h (100 nM) and trypsinized. The cell suspension was centrifuged for 5 min at 100 × g and the cell pellets were resuspended in PBS. One part of cell suspension was mixed with one part of trypan blue dye. Trypan blue dye only permeates damaged cell membranes. Therefore, the unstained (viable) and stained (nonviable) cells were counted by using a hemocytometer. To obtain the total number of viable cells per ml of aliquot, the total number of viable cells were multiplied by 2 (the dilution factor for trypan blue). To obtain the total number of cells per ml of aliquot, the total number of viable and nonviable cells were added and multiplied by 2. The percentage of viable cells were calculated as follows: Cell viability (%) = (total number of viable cells per ml of aliquot/total number of cells per ml) *100.

Immunoblotting

Proteins were size-fractionated by SDS-PAGE (16% or 8% polyacrylamide) and transferred to nitrocellulose by electroblotting. The nitrocellulose membranes were blocked with 5% non-fat dry milk in TBST (tris-buffered saline (TBS) containing 0.1% Tween 20) for 30 min at room temperature and subsequently incubated with the primary antibody against Poly (ADP-ribose) polymerase (PARP) or active caspase-3 in TBST for 16 h at 4 °C. After extensive washing with PBST, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Following washing with PBST, the antigen was detected with the enhanced chemiluminescence detection system.

Pull-down assay for protein-protein interaction

2.5 µM recombinant NEMO and 2 µM recombinant p62 were incubated with or without 1 µM recombinant linear tetra-ubiquitin chains with 25 µL MBP affinity agarose beads (Chromotek) for 4 h at 4 °C on rotation. The beads were pre-equilibrated in native buffer containing 50 mM HEPES pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 10% glycerol, 25 mM NaF, 10 µM ZnCl₂ supplemented with protease inhibitor (cOmplete, Roche) and N-ethylmaleimid (Sigma) in PBS. After 4 h, the beads were washed 5 times with the same native buffer and then boiled in 2× Laemmli sample buffer for 8 min at 95 °C. Samples were analyzed by immunoblotting using the indicated antibodies (Table 1).

Phase separation assay

Protein aliquots were thawed on ice. Using Vivaspin 500 columns with 30 or 10 kDa molecular weight cut off (Sartorius Stedim Biotech), the buffer was exchanged to 10 mM Tris, pH 7.4, 1 mM DTT by centrifuging five to eight times for 9 min at 12,000 g, 4 °C. After buffer exchange, protein was collected and finally centrifuged at 20,000 g for 10 min at 4 °C to remove aggregates. The final protein concentration was determined by NanoDrop 2000. TEV protease was added to the samples and incubated 1 h for complete cleavage of MBP and 6xHis before microscopy. After the reaction, 10 μl of reaction mix was spotted on ibidi coverslip bottom dishes. The samples were then imaged as maximum intensity projection of a z-stack obtained using laser scanning microscopy.

Quantification and statistical analysis

Data represent the mean ± SD or SEM, n numbers are indicated in the figure legends. For the quantification analysis in which manual counting was used, not all experiments were performed in a blinded manner. All statistical analyses were performed by using GraphPad PRISM (Version 5; San Diego, CA, USA). To check for Gaussian distribution of the data, the Kolmogorov–Smirnov test was applied. Based on the outcome of the test, appropriate parametric and non-parametric tests were chosen. For the comparison of two independent parametric datasets, the student’s t-test was used. For the comparison of more than 2 parametric datasets, one-way ANOVA was applied. To correct for α-error inflation resulting from multiple comparisons, ANOVA was followed by the Tukey’s post hoc multiple comparison tests. For the direct comparison of two non-parametric datasets, the Wilcoxon Mann–Whitney (U-test), and for the comparison of more than 2 non-parametric datasets, the Kruskal–Wallis test was used. Significance levels for all tests: *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001. For the analysis of microscopic images, representative images are displayed; experiments were performed at least three times with similar results.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The authors declare that the data supporting the findings of this study are available within the article and its supplementary information files. Source data are provided with this paper. The whole-genome sequencing data generated in this study have been deposited in the NCBI Sequence Read Archive database under accession codes http://www.ncbi.nlm.nih.gov/bioproject/1043442 and https://www.ncbi.nlm.nih.gov/biosample/38340847. Source data are provided with this paper.

References

Kwon, Y. T. & Ciechanover, A. The ubiquitin code in the ubiquitin-proteasome system and autophagy. Trends Biochem. Sci. 42, 873–886 (2017).
Article CAS PubMed Google Scholar
Johnston, H. E. & Samant, R. S. Alternative systems for misfolded protein clearance: life beyond the proteasome. FEBS J. 288, 4464–4487 (2021).
Article CAS PubMed Google Scholar
Le Guerroue, F. & Youle, R. J. Ubiquitin signaling in neurodegenerative diseases: an autophagy and proteasome perspective. Cell Death Differ. 28, 439–454 (2021).
Article PubMed Google Scholar
Lei L., Wu Z., Winklhofer K. F. Protein quality control by the proteasome and autophagy: a regulatory role of ubiquitin and liquid-liquid phase separation. Matrix Biol. 100–101, 9–22 (2020).
Pohl, C. & Dikic, I. Cellular quality control by the ubiquitin-proteasome system and autophagy. Science 366, 818–822 (2019).
Article ADS CAS PubMed Google Scholar
Yin, Z., Popelka, H., Lei, Y., Yang, Y. & Klionsky, D. J. The roles of ubiquitin in mediating autophagy. Cells 9, 2025 (2020).
Article CAS PubMed PubMed Central Google Scholar
Bauer, B., Martens, S. & Ferrari, L. Aggrephagy at a glance. J. Cell Sci. 136, jcs260888 (2023).
Article CAS PubMed Google Scholar
Adriaenssens, E., Ferrari, L. & Martens, S. Orchestration of selective autophagy by cargo receptors. Curr. Biol. 32, R1357–R1371 (2022).
Article CAS PubMed Google Scholar
Sanchez-Martin, P. & Komatsu, M. p62/SQSTM1 - steering the cell through health and disease. J. Cell Sci. 131, jcs222836 (2018).
Article PubMed Google Scholar
Dikic, I. & Elazar, Z. Mechanism and medical implications of mammalian autophagy. Nat. Rev. Mol. Cell Biol. 19, 349–364 (2018).
Article CAS PubMed Google Scholar
Vargas, J. N. S., Hamasaki, M., Kawabata, T., Youle, R. J. & Yoshimori, T. The mechanisms and roles of selective autophagy in mammals. Nat. Rev. Mol. Cell Biol. 24, 167–185 (2023).
Article CAS PubMed Google Scholar
Bjorkoy, G. et al. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 171, 603–614 (2005).
Article PubMed PubMed Central Google Scholar
Kirkin, V. et al. A role for NBR1 in autophagosomal degradation of ubiquitinated substrates. Mol. Cell 33, 505–516 (2009).
Article CAS PubMed Google Scholar
Sun, D., Wu, R., Zheng, J., Li, P. & Yu, L. Polyubiquitin chain-induced p62 phase separation drives autophagic cargo segregation. Cell Res. 28, 405–415 (2018).
Article CAS PubMed PubMed Central Google Scholar
Zaffagnini, G. et al. p62 filaments capture and present ubiquitinated cargos for autophagy. EMBO J. 37, e98308 (2018).
Article PubMed PubMed Central Google Scholar
Turco, E. et al. Reconstitution defines the roles of p62, NBR1, and TAX1BP1 in ubiquitin condensate formation and autophagy initiation. Nat. Commun. 12, 5212 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Ohnstad, A. E. et al. Receptor-mediated clustering of FIP200 bypasses the role of LC3 lipidation in autophagy. EMBO J. 39, e104948 (2020).
Article CAS PubMed PubMed Central Google Scholar
Sarraf, S. A. et al. Loss of TAX1BP1-directed autophagy results in protein aggregate accumulation in the brain. Mol. Cell 80, 779–795 e710 (2020).
Article CAS PubMed PubMed Central Google Scholar
Swatek, K. N. & Komander, D. Ubiquitin modifications. Cell Res. 26, 399–422 (2016).
Article CAS PubMed PubMed Central Google Scholar
Yau, R. & Rape, M. The increasing complexity of the ubiquitin code. Nat. Cell Biol. 18, 579–586 (2016).
Article CAS PubMed Google Scholar
Oh, E., Akopian, D. & Rape, M. Principles of ubiquitin-dependent signaling. Annu Rev. Cell Dev. Biol. 34, 137–162 (2018).
Article CAS PubMed Google Scholar
Dikic I., Schulman B. A. An expanded lexicon for the ubiquitin code. Nat. Rev. Mol. Cell Biol. 24, 1−15 (2022).
Kirisako, T. et al. A ubiquitin ligase complex assembles linear polyubiquitin chains. EMBO J. 25, 4877–4887 (2006).
Article CAS PubMed PubMed Central Google Scholar
Iwai, K. Discovery of linear ubiquitination, a crucial regulator for immune signaling and cell death. FEBS J. 288, 1060–1069 (2021).
Article CAS PubMed Google Scholar
Fiil, B. K. & Gyrd-Hansen, M. The Met1-linked ubiquitin machinery in inflammation and infection. Cell Death Differ. 28, 557–569 (2021).
Article CAS PubMed PubMed Central Google Scholar
Fuseya, Y. & Iwai, K. Biochemistry, pathophysiology, and regulation of linear ubiquitination: intricate regulation by coordinated functions of the associated ligase and deubiquitinase. Cells 10, 2706 (2021).
Article CAS PubMed PubMed Central Google Scholar
Jahan, A. S., Elbaek, C. R. & Damgaard, R. B. Met1-linked ubiquitin signalling in health and disease: inflammation, immunity, cancer, and beyond. Cell Death Differ. 28, 473–492 (2021).
Article CAS PubMed PubMed Central Google Scholar
Oikawa, D., Sato, Y., Ito, H. & Tokunaga, F. Linear ubiquitin code: its writer, erasers, decoders, inhibitors, and implications in disorders. Int J. Mol. Sci. 21, 3381 (2020).
Article CAS PubMed PubMed Central Google Scholar
Dittmar, G. & Winklhofer, K. F. Linear ubiquitin chains: cellular functions and strategies for detection and quantification. Front. Chem. 7, 915 (2019).
Article CAS PubMed Google Scholar
Rittinger, K. & Ikeda, F. Linear ubiquitin chains: enzymes, mechanisms and biology. Open Biol. 7, 170026 (2017).
Article PubMed PubMed Central Google Scholar
Hrdinka, M. & Gyrd-Hansen, M. The Met1-linked ubiquitin machinery: emerging themes of (De)regulation. Mol. Cell 68, 265–280 (2017).
Article CAS PubMed Google Scholar
Tokunaga, F. & Ikeda, F. Linear ubiquitination in immune and neurodegenerative diseases, and beyond. Biochem. Soc. Trans. 50, 799–811 (2022).
Article CAS PubMed Google Scholar
Shibata, Y. & Komander, D. Lubac. Curr. Biol. 32, R506–R508 (2022).
Article CAS PubMed Google Scholar
Spit, M., Rieser, E. & Walczak, H. Linear ubiquitination at a glance. J. Cell Sci. 132, jcs208512 (2019).
Article PubMed Google Scholar
Zinngrebe, J. & Walczak, H. TLRs go linear - on the ubiquitin edge. Trends Mol. Med. 23, 296–309 (2017).
Article PubMed Google Scholar
Sasaki, K. & Iwai, K. Roles of linear ubiquitinylation, a crucial regulator of NF-kappaB and cell death, in the immune system. Immunol. Rev. 266, 175–189 (2015).
Article CAS PubMed Google Scholar
Ikeda, F. Linear ubiquitination signals in adaptive immune responses. Immunol. Rev. 266, 222–236 (2015).
Article CAS PubMed PubMed Central Google Scholar
Iwai, K., Fujita, H. & Sasaki, Y. Linear ubiquitin chains: NF-kappaB signalling, cell death and beyond. Nat. Rev. Mol. Cell Biol. 15, 503–508 (2014).
Article CAS PubMed Google Scholar
Maubach, G., Schmadicke, A. C. & Naumann, M. NEMO links nuclear factor-kappaB to human diseases. Trends Mol. Med. 23, 1138–1155 (2017).
Article CAS PubMed Google Scholar
Clark, K., Nanda, S. & Cohen, P. Molecular control of the NEMO family of ubiquitin-binding proteins. Nat. Rev. Cancer 13, 673–685 (2013).
Google Scholar
Israel, A. The IKK complex, a central regulator of NF-kappaB activation. Cold Spring Harb. Perspect. Biol. 2, a000158 (2010).
Article PubMed PubMed Central Google Scholar
Annibaldi, A. & Meier, P. Checkpoints in TNF-induced cell death: implications in inflammation and cancer. Trends Mol. Med. 24, 49–65 (2018).
Article CAS PubMed Google Scholar
Brenner, D., Blaser, H. & Mak, T. W. Regulation of tumour necrosis factor signalling: live or let die. Nat. Rev. Immunol. 15, 362–374 (2015).
Article CAS PubMed Google Scholar
Smahi, A. et al. Genomic rearrangement in NEMO impairs NF-kappaB activation and is a cause of incontinentia pigmenti. The International Incontinentia Pigmenti (IP) Consortium. Nature 405, 466–472 (2000).
Article ADS CAS PubMed Google Scholar
Fusco, F. et al. EDA-ID and IP, two faces of the same coin: how the same IKBKG/NEMO mutation affecting the NF-kappaB pathway can cause immunodeficiency and/or inflammation. Int. Rev. Immunol. 34, 445–459 (2015).
Article CAS PubMed Google Scholar
Conte, M. I. et al. Insight into IKBKG/NEMO locus: report of new mutations and complex genomic rearrangements leading to incontinentia pigmenti disease. Hum. Mutat. 35, 165–177 (2014).
Article CAS PubMed Google Scholar
Narayanan, M. J., Rangasamy, S. & Narayanan, V. Incontinentia pigmenti (Bloch-Sulzberger syndrome). Handb. Clin. Neurol. 132, 271–280 (2015).
Article PubMed Google Scholar
Cammarata-Scalisi, F., Fusco, F. & Ursini, M. V. Incontinentia Pigmenti. Actas Dermosifiliogr. 110, 273–278 (2019).
Article CAS PubMed Google Scholar
van Well, E. M. et al. A protein quality control pathway regulated by linear ubiquitination. EMBO J. 38, e100730 (2019).
Article PubMed PubMed Central Google Scholar
Goel, S. et al. Linear ubiquitination induces NEMO phase separation to activate NF-kappaB signaling. Life Sci. Alliance 6, e202201607 (2023).
Article CAS PubMed PubMed Central Google Scholar
Gupta, R. et al. Firefly luciferase mutants as sensors of proteome stress. Nat. Methods 8, 879–884 (2011).
Article CAS PubMed Google Scholar
Blumenstock, S. et al. Fluc-EGFP reporter mice reveal differential alterations of neuronal proteostasis in aging and disease. EMBO J. 40, e107260 (2021).
Article CAS PubMed PubMed Central Google Scholar
Polinski, N. K. et al. Best Practices for Generating and Using Alpha-Synuclein Pre-Formed Fibrils to Model Parkinson’s Disease in Rodents. J. Parkinsons Dis. 8, 303–322 (2018).
Article PubMed PubMed Central Google Scholar
Volpicelli-Daley, L. A., Luk, K. C. & Lee, V. M. Addition of exogenous alpha-synuclein preformed fibrils to primary neuronal cultures to seed recruitment of endogenous alpha-synuclein to Lewy body and Lewy neurite-like aggregates. Nat. Protoc. 9, 2135–2146 (2014).
Article CAS PubMed PubMed Central Google Scholar
Trinkaus, V. A. et al. In situ architecture of neuronal alpha-Synuclein inclusions. Nat. Commun. 12, 2110 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Matsumoto, M. L. et al. Engineering and structural characterization of a linear polyubiquitin-specific antibody. J. Mol. Biol. 418, 134–144 (2012).
Article CAS PubMed Google Scholar
Tokunaga, F. et al. Involvement of linear polyubiquitylation of NEMO in NF-kappaB activation. Nat. Cell Biol. 11, 123–132 (2009).
Article CAS PubMed Google Scholar
Fujita, H. et al. Mechanism underlying IkappaB kinase activation mediated by the linear ubiquitin chain assembly complex. Mol. Cell Biol. 34, 1322–1335 (2014).
Article PubMed PubMed Central Google Scholar
Rahighi, S., Iyer, M., Oveisi, H., Nasser, S. & Duong, V. Structural basis for the simultaneous recognition of NEMO and acceptor ubiquitin by the HOIP NZF1 domain. Sci. Rep. 12, 12241 (2022).
Article ADS CAS PubMed PubMed Central Google Scholar
Hubeau, M. et al. New mechanism of X-linked anhidrotic ectodermal dysplasia with immunodeficiency: impairment of ubiquitin binding despite normal folding of NEMO protein. Blood 118, 926–935 (2011).
Article CAS PubMed PubMed Central Google Scholar
Rahighi, S. et al. Specific recognition of linear ubiquitin chains by NEMO is important for NF-kappaB activation. Cell 136, 1098–1109 (2009).
Article CAS PubMed Google Scholar
Noad, J., von der Malsburg, A., Pathe, C., Michel, M. A., Komander, D. & Randow, F. LUBAC-synthesized linear ubiquitin chains restrict cytosol-invading bacteria by activating autophagy and NF-kappaB. Nat. Microbiol. 2, 17063 (2017).
Article CAS PubMed PubMed Central Google Scholar
van Wijk, S. J. L. et al. Linear ubiquitination of cytosolic Salmonella Typhimurium activates NF-kappaB and restricts bacterial proliferation. Nat. Microbiol 2, 17066 (2017).
Article PubMed Google Scholar
Otten, E. G. et al. Ubiquitylation of lipopolysaccharide by RNF213 during bacterial infection. Nature 594, 111–116 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Stefanis, L., Emmanouilidou, E., Pantazopoulou, M., Kirik, D., Vekrellis, K. & Tofaris, G. K. How is alpha-synuclein cleared from the cell? J. Neurochem. 150, 577–590 (2019).
Article CAS PubMed Google Scholar
Sahoo, S., Padhy, A. A., Kumari, V. & Mishra, P. Role of ubiquitin-proteasome and autophagy-lysosome pathways in alpha-synuclein aggregate clearance. Mol. Neurobiol. 59, 5379–5407 (2022).
Article CAS PubMed Google Scholar
Lashuel, H. A., Overk, C. R., Oueslati, A. & Masliah, E. The many faces of alpha-synuclein: from structure and toxicity to therapeutic target. Nat. Rev. Neurosci. 14, 38–48 (2013).
Article CAS PubMed PubMed Central Google Scholar
Lamark, T., Svenning, S. & Johansen, T. Regulation of selective autophagy: the p62/SQSTM1 paradigm. Essays Biochem. 61, 609–624 (2017).
Article PubMed Google Scholar
Pankiv, S. et al. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J. Biol. Chem. 282, 24131–24145 (2007).
Article CAS PubMed Google Scholar
Danieli, A. & Martens, S. p62-mediated phase separation at the intersection of the ubiquitin-proteasome system and autophagy. J. Cell Sci. 131, jcs214304 (2018).
Article PubMed Google Scholar
Wurzer, B. et al. Oligomerization of p62 allows for selection of ubiquitinated cargo and isolation membrane during selective autophagy. eLife 4, e08941 (2015).
Article PubMed PubMed Central Google Scholar
Zotti, T. et al. TRAF6-mediated ubiquitination of NEMO requires p62/sequestosome-1. Mol. Immunol. 58, 27–31 (2014).
Article CAS PubMed PubMed Central Google Scholar
Martin, P., Diaz-Meco, M. T. & Moscat, J. The signaling adapter p62 is an important mediator of T helper 2 cell function and allergic airway inflammation. EMBO J. 25, 3524–3533 (2006).
Article CAS PubMed PubMed Central Google Scholar
Harding, O., Holzer, E., Riley, J. F., Martens, S. & Holzbaur, E. L. F. Damaged mitochondria recruit the effector NEMO to activate NF-kappaB signaling. Mol. Cell 83, 3188–3204 e3187 (2023).
Article CAS PubMed Google Scholar
Kuusisto, E., Salminen, A. & Alafuzoff, I. Ubiquitin-binding protein p62 is present in neuronal and glial inclusions in human tauopathies and synucleinopathies. Neuroreport 12, 2085–2090 (2001).
Article CAS PubMed Google Scholar
Trejo-Lopez, J. A. et al. Generation and characterization of novel monoclonal antibodies targeting p62/sequestosome-1 across human neurodegenerative diseases. J. Neuropathol. Exp. Neurol. 79, 407–418 (2020).
Article CAS PubMed PubMed Central Google Scholar
Turco, E. et al. FIP200 claw domain binding to p62 promotes autophagosome formation at ubiquitin condensates. Mol. Cell 74, 330–346 e311 (2019).
Article CAS PubMed PubMed Central Google Scholar
Jakobi, A. J. et al. Structural basis of p62/SQSTM1 helical filaments and their role in cellular cargo uptake. Nat. Commun. 11, 440 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Du, M., Ea, C. K., Fang, Y. & Chen, Z. J. Liquid phase separation of NEMO induced by polyubiquitin chains activates NF-kappaB. Mol. Cell 82, 2415–2426.e5 (2022).
Article CAS PubMed PubMed Central Google Scholar
Emmerich, C. H. et al. Activation of the canonical IKK complex by K63/M1-linked hybrid ubiquitin chains. Proc. Natl Acad. Sci. USA 110, 15247–15252 (2013).
Article ADS CAS PubMed PubMed Central Google Scholar
Yamasaki, A. et al. Liquidity Is a Critical Determinant for Selective Autophagy of Protein Condensates. Mol. Cell 77, 1163–1175 e1169 (2020).
Article CAS PubMed Google Scholar
Gallagher, E. R. & Holzbaur, E. L. F. The selective autophagy adaptor p62/SQSTM1 forms phase condensates regulated by HSP27 that facilitate the clearance of damaged lysosomes via lysophagy. Cell Rep. 42, 112037 (2023).
Article CAS PubMed PubMed Central Google Scholar
Ma, X., Zhang, M. & Ge, L. A switch of chaperonin function regulates the clearance of solid protein aggregates. Autophagy 18, 2746–2748 (2022).
Article CAS PubMed PubMed Central Google Scholar
Peng, S. Z. et al. Phase separation of Nur77 mediates celastrol-induced mitophagy by promoting the liquidity of p62/SQSTM1 condensates. Nat. Commun. 12, 5989 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Kageyama, S. et al. p62/SQSTM1-droplet serves as a platform for autophagosome formation and anti-oxidative stress response. Nat. Commun. 12, 16 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Komander, D., Reyes-Turcu, F., Licchesi, J. D., Odenwaelder, P., Wilkinson, K. D. & Barford, D. Molecular discrimination of structurally equivalent Lys 63-linked and linear polyubiquitin chains. EMBO Rep. 10, 466–473 (2009).
Article CAS PubMed PubMed Central Google Scholar
Wagner, S. et al. Ubiquitin binding mediates the NF-kappaB inhibitory potential of ABIN proteins. Oncogene 27, 3739–3745 (2008).
Article CAS PubMed Google Scholar
Lo, Y. C. et al. Structural basis for recognition of diubiquitins by NEMO. Mol. Cell 33, 602–615 (2009).
Article CAS PubMed PubMed Central Google Scholar
Laplantine, E. et al. NEMO specifically recognizes K63-linked poly-ubiquitin chains through a new bipartite ubiquitin-binding domain. EMBO J. 28, 2885–2895 (2009).
Article CAS PubMed PubMed Central Google Scholar
Cordier, F., Grubisha, O., Traincard, F., Veron, M., Delepierre, M. & Agou, F. The zinc finger of NEMO is a functional ubiquitin-binding domain. J. Biol. Chem. 284, 2902–2907 (2009).
Article CAS PubMed Google Scholar
Schrofelbauer, B., Polley, S., Behar, M., Ghosh, G. & Hoffmann, A. NEMO ensures signaling specificity of the pleiotropic IKKbeta by directing its kinase activity toward IkappaBalpha. Mol. Cell 47, 111–121 (2012).
Article CAS PubMed PubMed Central Google Scholar
Zilberman-Rudenko, J. et al. Recruitment of A20 by the C-terminal domain of NEMO suppresses NF-kappaB activation and autoinflammatory disease. Proc. Natl Acad. Sci. USA 113, 1612–1617 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Herhaus, L. et al. Molecular recognition of M1-linked ubiquitin chains by native and phosphorylated UBAN domains. J. Mol. Biol. 431, 3146–3156 (2019).
Article CAS PubMed Google Scholar
Merline, R. et al. A20 binding and inhibitor of nuclear factor kappa B (NF-kappaB)-1 (ABIN-1): a novel modulator of mitochondrial autophagy. Am. J. Physiol. Cell Physiol. 324, C339–C352 (2023).
Article CAS PubMed Google Scholar
Tusco, R. et al. Kenny mediates selective autophagic degradation of the IKK complex to control innate immune responses. Nat. Commun. 8, 1264 (2017).
Article ADS PubMed PubMed Central Google Scholar
Wu, Z. et al. LUBAC assembles a ubiquitin signaling platform at mitochondria for signal amplification and transport of NF-kappaB to the nucleus. EMBO J. 41, e112006 (2022).
Article CAS PubMed PubMed Central Google Scholar
Jain, A. et al. p62/SQSTM1 is a target gene for transcription factor NRF2 and creates a positive feedback loop by inducing antioxidant response element-driven gene transcription. J. Biol. Chem. 285, 22576–22591 (2010).
Article CAS PubMed PubMed Central Google Scholar
Meffert, M. K., Chang, J. M., Wiltgen, B. J., Fanselow, M. S., Baltimore, D. & NF-kappa, B. functions in synaptic signaling and behavior. Nat. Neurosci. 6, 1072–1078 (2003).
Article CAS PubMed Google Scholar
Neidl, R. et al. Late-life environmental enrichment induces acetylation events and nuclear factor kappab-dependent regulations in the hippocampus of aged rats showing improved plasticity and learning. J. Neurosci. 36, 4351–4361 (2016).
Article CAS PubMed PubMed Central Google Scholar
O’Riordan, K. J. et al. Regulation of nuclear factor kappaB in the hippocampus by group I metabotropic glutamate receptors. J. Neurosci. 26, 4870–4879 (2006).
Article PubMed PubMed Central Google Scholar
Dresselhaus, E. C., Boersma, M. C. H. & Meffert, M. K. Targeting of NF-kappaB to dendritic spines is required for synaptic signaling and spine development. J. Neurosci. 38, 4093–4103 (2018).
Article CAS PubMed PubMed Central Google Scholar
Bhakar, A. L. et al. Constitutive nuclear factor-kappa B activity is required for central neuron survival. J. Neurosci. 22, 8466–8475 (2002).
Article CAS PubMed PubMed Central Google Scholar
Blondeau, N., Widmann, C., Lazdunski, M. & Heurteaux, C. Activation of the nuclear factor-kappaB is a key event in brain tolerance. J. Neurosci. 21, 4668–4677 (2001).
Article CAS PubMed PubMed Central Google Scholar
Cheng, B., Christakos, S. & Mattson, M. P. Tumor necrosis factors protect neurons against metabolic-excitotoxic insults and promote maintenance of calcium homeostasis. Neuron 12, 139–153 (1994).
Article CAS PubMed Google Scholar
Turrin, N. P. & Rivest, S. Tumor necrosis factor alpha but not interleukin 1 beta mediates neuroprotection in response to acute nitric oxide excitotoxicity. J. Neurosci. 26, 143–151 (2006).
Article CAS PubMed PubMed Central Google Scholar
Carter, B. D. et al. Selective activation of NF-kappa B by nerve growth factor through the neurotrophin receptor p75. Science 272, 542–545 (1996).
Article ADS CAS PubMed Google Scholar
Foehr, E. D., Lin, X., O’Mahony, A., Geleziunas, R., Bradshaw, R. A., Greene, W. C. & NF-kappa, B. signaling promotes both cell survival and neurite process formation in nerve growth factor-stimulated PC12 cells. J. Neurosci. 20, 7556–7563 (2000).
Article CAS PubMed PubMed Central Google Scholar
Nakajima, K. et al. Neurotrophins regulate the function of cultured microglia. Glia 24, 272–289 (1998).
Article CAS PubMed Google Scholar
Hayashi, H. et al. Characterization of intracellular signals via tyrosine 1062 in RET activated by glial cell line-derived neurotrophic factor. Oncogene 19, 4469–4475 (2000).
Article CAS PubMed Google Scholar
Meka, D. P. et al. Parkin cooperates with GDNF/RET signaling to prevent dopaminergic neuron degeneration. J. Clin. Invest. 125, 1873–1885 (2015).
Article PubMed PubMed Central Google Scholar
Muller-Rischart, A. K. et al. The E3 ligase parkin maintains mitochondrial integrity by increasing linear ubiquitination of NEMO. Mol. Cell 49, 908–921 (2013).
Article PubMed Google Scholar
Henn, I. H. et al. Parkin mediates neuroprotection through activation of IkappaB kinase/nuclear factor-kappaB signaling. J. Neurosci. 27, 1868–1878 (2007).
Article CAS PubMed PubMed Central Google Scholar
Ayaki, T. et al. Multiple proteinopathies in familial ALS cases with optineurin mutations. J. Neuropathol. Exp. Neurol. 77, 128–138 (2018).
Article PubMed Google Scholar
Richards, S. et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 17, 405–424 (2015).
Article PubMed PubMed Central Google Scholar
Schmidt-Supprian, M. et al. NEMO/IKK gamma-deficient mice model incontinentia pigmenti. Mol. Cell 5, 981–992 (2000).
Article CAS PubMed Google Scholar
Komatsu, M. et al. Homeostatic levels of p62 control cytoplasmic inclusion body formation in autophagy-deficient mice. Cell 131, 1149–1163 (2007).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank Tetsuro Ishii for p62 KO MEFs, Marc Schmidt-Supprian for NEMO KO MEFs, Terje Johansen for p62 plasmids, Sascha Martens for mCherry-p62, Yen-Ting Chen for discussing protein adsorption processes, and Genentech for the 1F11/3F5/Y102L antibody. We also thank Bruce Conklin (Gladstone Institutes) and the Gladstone Stem Cell Core for assistance with the patient skin biopsy and fibroblast culture. This work was supported by the German Research Foundation (WI/2111-4, WI/2111-6, WI/2111-8, FOR 2848 to KFW) and Germany’s Excellence Strategy EXC 2033 390677874 – RESOLV (to KFW and JT) and EXC 2145 390857198 – SyNergy (to CB and FUH), the NIH (R01 AG065428 to KN) as well as by the joint efforts of The Michael J. Fox Foundation for Parkinson’s Research (MJFF) and the Aligning Science Across Parkinson’s (ASAP) initiative. MJFF administers the grant ASAP-000282 on behalf of ASAP and itself. SR-SIM microscopy was funded by the German Research Foundation and the State Government of North Rhine-Westphalia (INST 213/840-1 FUGG).

Funding

Open Access funding enabled and organized by Projekt DEAL.

Author information

Gisa Ellrichmann
Present address: Department of Neurology, Klinikum Dortmund, University Witten/Herdecke, 44135, Dortmund, Germany
Benjamin Englert
Present address: Center for Neuropathology and Prion Research, Ludwig-Maximilians University, 81377, Munich, Germany

Authors and Affiliations

Department Molecular Cell Biology, Institute of Biochemistry and Pathobiochemistry, Ruhr University Bochum, 44801, Bochum, Germany
Nikolas Furthmann, Verian Bader, Lena Angersbach, Simran Goel, Ana Sánchez-Vicente, Laura J. Krause, Sarah A. Chaban, Eva M. van Well & Konstanze F. Winklhofer
Department Biochemistry of Neurodegenerative Diseases, Institute of Biochemistry and Pathobiochemistry, Ruhr University Bochum, 44801, Bochum, Germany
Verian Bader, Prerna Grover & Jörg Tatzelt
Department of Neurology, St Josef Hospital, Ruhr University Bochum, 44791, Bochum, Germany
Alina Blusch, Carsten Saft, Gisa Ellrichmann & Ralf Gold
Cluster of Excellence RESOLV, 44801, Bochum, Germany
Laura J. Krause, Kristina Tschulik, Jörg Tatzelt & Konstanze F. Winklhofer
Department of Cellular Biochemistry, Max Planck Institute of Biochemistry, 82152, Martinsried, Germany
Victoria A. Trinkaus & F. Ulrich Hartl
Analytical Chemistry II, Faculty of Chemistry and Biochemistry, Ruhr University Bochum, 44801, Bochum, Germany
Maximilian Jaugstetter & Kristina Tschulik
Department of Biotechnology and Biomedicine, Technical University of Denmark, 2800, Kongens Lyngby, Denmark
Rune Busk Damgaard
Charité - Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Department of Neuropathology, Charitéplatz 1, 10117, Berlin, Germany
Arend Koch & Benjamin Englert
Institute of Neurogenetics, University of Lübeck, Lübeck, Germany
Ana Westenberger & Christine Klein
Ernst-Ruska Centre for Microscopy and Spectroscopy with Electrons (ER-C-3/Structural Biology), Forschungszentrum Jülich, Jülich, Germany
Lisa Jungbluth & Carsten Sachse
Institute for Biological Information Processing (IBI-6/Cellular Structural Biology), Forschungszentrum Jülich, Jülich, Germany
Lisa Jungbluth & Carsten Sachse
Department of Biology, Heinrich Heine University, Düsseldorf, Germany
Carsten Sachse
Munich Cluster for Systems Neurology, Faculty of Medicine, Ludwig-Maximilians-Universität München, Munich, Germany
Christian Behrends
Institute of Neuropathology, University Medical Center Hamburg-Eppendorf, Martinistraße 52, 20251, Hamburg, Germany
Markus Glatzel
Munich Cluster for Systems Neurology (SyNergy), 81377, Munich, Germany
F. Ulrich Hartl
Gladstone Institute of Neurological Disease, Gladstone Institutes, San Francisco, CA, USA
Ken Nakamura
Department of Neurology, University of California, San Francisco, CA, USA
Ken Nakamura, Chadwick W. Christine & Eric J. Huang
Weill Institute for Neurosciences, University of California San Francisco, San Francisco, CA, USA
Chadwick W. Christine
Department of Pathology, University of California, San Francisco, CA, USA
Eric J. Huang

Authors

Nikolas Furthmann
View author publications
You can also search for this author in PubMed Google Scholar
Verian Bader
View author publications
You can also search for this author in PubMed Google Scholar
Lena Angersbach
View author publications
You can also search for this author in PubMed Google Scholar
Alina Blusch
View author publications
You can also search for this author in PubMed Google Scholar
Simran Goel
View author publications
You can also search for this author in PubMed Google Scholar
Ana Sánchez-Vicente
View author publications
You can also search for this author in PubMed Google Scholar
Laura J. Krause
View author publications
You can also search for this author in PubMed Google Scholar
Sarah A. Chaban
View author publications
You can also search for this author in PubMed Google Scholar
Prerna Grover
View author publications
You can also search for this author in PubMed Google Scholar
Victoria A. Trinkaus
View author publications
You can also search for this author in PubMed Google Scholar
Eva M. van Well
View author publications
You can also search for this author in PubMed Google Scholar
Maximilian Jaugstetter
View author publications
You can also search for this author in PubMed Google Scholar
Kristina Tschulik
View author publications
You can also search for this author in PubMed Google Scholar
Rune Busk Damgaard
View author publications
You can also search for this author in PubMed Google Scholar
Carsten Saft
View author publications
You can also search for this author in PubMed Google Scholar
Gisa Ellrichmann
View author publications
You can also search for this author in PubMed Google Scholar
Ralf Gold
View author publications
You can also search for this author in PubMed Google Scholar
Arend Koch
View author publications
You can also search for this author in PubMed Google Scholar
Benjamin Englert
View author publications
You can also search for this author in PubMed Google Scholar
Ana Westenberger
View author publications
You can also search for this author in PubMed Google Scholar
Christine Klein
View author publications
You can also search for this author in PubMed Google Scholar
Lisa Jungbluth
View author publications
You can also search for this author in PubMed Google Scholar
Carsten Sachse
View author publications
You can also search for this author in PubMed Google Scholar
Christian Behrends
View author publications
You can also search for this author in PubMed Google Scholar
Markus Glatzel
View author publications
You can also search for this author in PubMed Google Scholar
F. Ulrich Hartl
View author publications
You can also search for this author in PubMed Google Scholar
Ken Nakamura
View author publications
You can also search for this author in PubMed Google Scholar
Chadwick W. Christine
View author publications
You can also search for this author in PubMed Google Scholar
Eric J. Huang
View author publications
You can also search for this author in PubMed Google Scholar
Jörg Tatzelt
View author publications
You can also search for this author in PubMed Google Scholar
Konstanze F. Winklhofer
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization: N.F., L.A., V.B., S.G., A.S.-V., C.Sachse., C.B., K.N., C.W.C., J.T. and K.F.W. Validation: N.F., L.A., V.B., A.B., S.G., A.S.-V., L.J.K., S.A.C., P.G., V.A.T., E.M.v.W., M.J., A.W., L.J., J.T. and K.F.W. Visualization: N.F., L.A., V.B., A.B., S.G., A.S.-V., V.A.T., M.J., E.J.H., J.T. and K.F.W. Writing—original draft: N.F., V.B., A.B., S.G., A.S.-V., J.T. and K.F.W. Writing – review & editing: L.J.K., S.A.C., K.T., R.B.D., A.W., C.K., C.B., M.G., F.U.H., K.N., C.W.C. and E.J.H. Formal analysis: N.F., L.A., V.B., A.B., S.G., A.S.-V., L.J.K., S.A.C., P.G., E.M.v.W., M.J., A.W. and L.J. Methodology: N.F., L.A., V.B., A.B., S.G., A.S.-V., V.A.T., M.J., A.W., C.K., L.J. and E.J.H. Investigation: N.F., L.A., V.B., A.B., S.G., A.S.-V., L.J.K., S.A.C., P.G., V.A.T., E.M.v.W., M.J., A.W., C.K., L.J. and E.J.H. Data curation: N.F., L.A., V.B. and S.G. Resources: L.J.K., S.A.C., K.T., R.B.D., C.Sachse, G.E., A.K., B.E., C.Saft, C.B., M.G., F.U.H., K.N., C.W.C., E.J.H., R.G. Supervision: J.T. and K.F.W. Funding acquisition: K.F.W. Project administration: J.T. and K.F.W.

Corresponding author

Correspondence to Konstanze F. Winklhofer.

Ethics declarations

Competing interests

R.B.D. is a scientific advisor for Immagene B.V. C.K. serves as a medical advisor to Centogene for the validation of genetic testing reports in the field of movement disorders and dementia, excluding Parkinson’s disease, and Retromer Therapeutics and received speakers’ honoraria from Bial and Desitin. The remaining authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Eun-Jin Bae, Ivan Dikic, and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Furthmann, N., Bader, V., Angersbach, L. et al. NEMO reshapes the α-Synuclein aggregate interface and acts as an autophagy adapter by co-condensation with p62. Nat Commun 14, 8368 (2023). https://doi.org/10.1038/s41467-023-44033-0

Download citation

Received: 08 February 2023
Accepted: 28 November 2023
Published: 19 December 2023
DOI: https://doi.org/10.1038/s41467-023-44033-0

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Subjects

Abstract

Similar content being viewed by others

Introduction

Results

A pathogenic variant in the IKBKG gene encoding NEMO is associated with a widespread mixed proteinopathy and progressive neurodegeneration

NEMO deficiency promotes protein aggregation under proteotoxic stress

Misfolded α-synuclein is decorated with M1-linked ubiquitin and NEMO

The Q330X NEMO mutant does not bind to M1-linked ubiquitin chains and is not ubiquitylated by HOIP

A local NF-ĸB signaling platform is assembled at aSyn aggregates which does not promote a functional response

NEMO promotes autophagosomal degradation of α-synuclein in a p62-dependent manner

NEMO promotes p62 condensate formation at aggregates by lowering the threshold for ubiquitin-induced phase transition

Discussion

Methods

Ethical statement

Human brain sections

Genetic analyses

DNA constructs

Cell lines

Generation of NEMO CRISPR/Cas9 knockout (KO) SH-SY5Y cells and HOIP CRISPR/Cas9 KO HeLa cells

Expression and purification of recombinant proteins

Induction of α-Synuclein aggregates by α-Synuclein A53T seeds in cultured cells and primary neurons

Detergent solubility assay

Immunocytochemistry

Immunohistochemistry

Fluorescence microscopy

Colocalization studies

Fluorescence recovery after photobleaching (FRAP)

3D-image reconstruction and surface coverage analysis

Analysis of condensate formation

Immunoprecipitations

p65 translocation assay

Quantification of aSyn A53T-GFP aggregates

Analysis of SDS-insoluble Htt-Q97 proteins

Filter retardation assay

Sedimentation assay

Thioflavin T assay

Atomic force microscopy (AFM)

Dynamic light scattering (DLS)

Analysis of proteotoxic stress

Immunocytochemistry

Trypan blue dye exclusion

Immunoblotting

Pull-down assay for protein-protein interaction

Phase separation assay

Quantification and statistical analysis

Reporting summary

Data availability

References

Acknowledgements

Funding

Author information

Authors and Affiliations

Contributions

Corresponding author

Ethics declarations

Competing interests

Peer review

Peer review information

Additional information

Supplementary information

Source data

Rights and permissions

About this article

Cite this article

Share this article

Comments

Search

Quick links