Discovery and remodeling of Vibrio natriegens as a microbial platform for efficient formic acid biorefinery

Tian, Jinzhong; Deng, Wangshuying; Zhang, Ziwen; Xu, Jiaqi; Yang, Guiling; Zhao, Guoping; Yang, Sheng; Jiang, Weihong; Gu, Yang

doi:10.1038/s41467-023-43631-2

Download PDF

Article
Open access
Published: 27 November 2023

Discovery and remodeling of Vibrio natriegens as a microbial platform for efficient formic acid biorefinery

Nature Communications volume 14, Article number: 7758 (2023) Cite this article

5037 Accesses
4 Citations
12 Altmetric
Metrics details

Subjects

Abstract

Formic acid (FA) has emerged as a promising one-carbon feedstock for biorefinery. However, developing efficient microbial hosts for economically competitive FA utilization remains a grand challenge. Here, we discover that the bacterium Vibrio natriegens has exceptional FA tolerance and metabolic capacity natively. This bacterium is remodeled by rewiring the serine cycle and the TCA cycle, resulting in a non-native closed loop (S-TCA) which as a powerful metabolic sink, in combination with laboratory evolution, enables rapid emergence of synthetic strains with significantly improved FA-utilizing ability. Further introduction of a foreign indigoidine-forming pathway into the synthetic V. natriegens strain leads to the production of 29.0 g · L⁻¹ indigoidine and consumption of 165.3 g · L⁻¹ formate within 72 h, achieving a formate consumption rate of 2.3 g · L⁻¹ · h⁻¹. This work provides an important microbial chassis as well as design rules to develop industrially viable microorganisms for FA biorefinery.

Elucidation of genes enhancing natural product biosynthesis through co-evolution analysis

Article 12 April 2024

H2O2-mediated electrosynthesis of nitrate from air

Article 19 April 2024

Automated in vivo enzyme engineering accelerates biocatalyst optimization

Article Open access 24 April 2024

Introduction

Microbial assimilation and conversion of one-carbon (C1) compounds to produce value-added products have attracted significant attention because it represents an important biological manufacturing route using abundant and highly available carbon sources¹. Formic acid (FA) is a promising C1 feedstock since it can be efficiently derived from CO₂ or syngas (mainly CO and CO₂) with high selectivity via chemical conversions and further utilized by microorganisms². Additionally, the storage of FA as a liquid is more convenient compared to gases³. Thus, FA is a CO₂-equivalent carbon source that is more easily handled than CO₂.

Native FA-utilizing microorganisms mainly employ the Wood-Ljungdahl pathway (also known as the reduced acetyl-CoA pathway), serine cycle, and reductive glycine pathway for FA assimilation⁴. These pathways all depend on a core FA-fixing module called the tetrahydrofolate (THF) cycle which is initiated by formate-tetrahydrofolate ligase (FTL)⁴. Pyruvate formate-lyase (PFL)-catalyzed pyruvate formation from formate and acetyl-CoA is another important FA-assimilating approach in organisms⁴. However, native FA-utilizing microorganisms generally grow slowly and cannot efficiently utilize this C1 carbon source^{5,6,7,8,9,10,11,12,13,14,15,16,17}. Hence, efforts have been made to develop synthetic microorganisms such as Escherichia coli through rational genetic modifications and adaptive laboratory evolution, wherein FA assimilation was achieved by reconstructing the THF cycle and reverse glycine cleavage^18,19,20. Despite the improved performance of synthetic microorganisms in FA utilization, the efficiency is still much lower than those of traditional carbon sources such as sugars, which is largely due to the native weak FA tolerance and metabolic capacity of these microbial hosts. Thus, the discovery and employment of more suitable microorganisms as a chassis to establish efficient FA bioconversion platforms are needed.

Vibrio natriegens is a rapidly growing bacterium with the shortest doubling time (<10 min) of all known bacteria^21,22. It is also regarded as a desirable microbial host for bio-manufacturing^23,24,25. Vibrio natriegens can grow on diverse substrates including galactose, arabinose, and glycerol^26,27, due to its versatile metabolism. Furthermore, genetically modified V. natriegens strains are capable of producing multiple chemicals including amino acids, polymers, and polyols^27,28,29. However, its inherent physiological and metabolic characteristics and potential in utilizing C1 resources remain unclear.

In this work, we discover the previously unreported superior tolerance and metabolic capacity of Vibrio natriegens to FA and develop this bacterium into a platform microorganism for FA utilization and conversion. Using a combination of bioinformatic, omics, and experimental validation approaches, multiple potentially crucial genes and metabolic pathways associated with FA metabolism in Vibrio natriegens are revealed. Based on these findings, we design and remodel this bacterium, combined with laboratory evolution, achieving efficient FA utilization and indigoidine production.

Results

Superior tolerance and metabolic capacity of native Vibrio natriegens to formate

V. natriegens has rapid growth, but its tolerance and metabolic capacity to formate are unknown; thus, we first examined its growth and formate consumption in the presence of different formate concentrations. We observed that V. natriegens could grow in the LBv2 medium supplemented with 20 and 40 g·L^‒1 sodium formate (HCOONa·2H₂O) (equivalent to 192 and 385 mM formate, respectively) (Fig. 1a), and exhausted all the formate within 24 h (Fig. 1b), although the growth rates and highest biomass gradually decreased with increasing formate concentration (Fig. 1a). At a higher sodium formate concentration (60 g · L^‒1, equivalent to 577 mM), the strain could hardly grow (Fig. 1a), but it still consumed 69 mM formate within 24 h (Fig. 1b). However, when V. natriegens was cultivated in the M9 minimal medium (containing 4 g · L^‒1 glucose), the addition of 288 mM formate (30 g · L^‒1 HCOONa·2H₂O) could completely inhibit cell growth (Supplementary Fig. 1a), showing poorer formate tolerance relative to that of the LBv2 medium. At a lower formate concentration (192 mM, equivalent to 20 g · L^‒1 HCOONa·2H₂O) in this minimal medium, V. natriegens could grow and consume 95 mM formate within 24 h (3.96 mM·h⁻¹) (Supplementary Fig. 1b, c). Taken together, compared with the reported data from other microorganisms, V. natriegens exhibited a superior ability in the consumption of formate (Supplementary Table 1), showcasing great potential in biological FA utilization.

**Fig. 1: Comparative analysis of formate metabolic pathways in *V. natriegens*.**

Genes and metabolic pathways for formate metabolism in V. natriegens

Natural FA assimilation reactions in organisms are quite scarce, in which two of the best known are FTL-catalyzed formylation of tetrahydrofolate (THF) and (PFL)-catalyzed pyruvate formation (Supplementary Fig. 2). Additionally, FA can be oxidized to form CO₂ by formate dehydrogenase (FDH), a major FA dissimilation reaction in microorganisms. The V. natriegens genome contains six fdh genes (two fdhFs, one fdhA, one fdoI, one fdoH, and one fdhD), two THF cycle genes (ftl and folD) and one pfl gene, enabling the operation of both FA dissimilation and assimilation reactions mentioned above (Fig. 1c); however, the other two THF cycle genes, fchA and metdA, were missing (Table 1). Furthermore, all the candidate genes responsible for the reactions starting from methylene-THF in the reductive glycine pathway and serine cycle were found in V. natriegens (Supplementary Fig. 3a), suggesting that the assimilated formate can be further converted into diverse metabolites. Additionally, energy conservation systems play important roles in microbial growth on organic C1 resources such as formate and methanol²⁰. Of note, diverse energy conservation systems were found in V. natriegens, most of which had multiple coding genes and gene clusters in the genome (Supplementary Fig. 3b). This may be crucial for the required energy supply in the growth of V. natriegens on formate.

Table 1 Occurrence of genes involved in formate metabolism in V. natriegens and some other representative formate-utilizing microorganisms

Full size table

To explore the potential genes and metabolic pathways associated with formate metabolism in V. natriegens, we measure the transcriptomic changes with the induction of formate. There were 755 and 606 genes significantly up-regulated and down-regulated, respectively, following formate addition to the culture (Supplementary Fig. 4a). Functional category analysis yielded 28 subsets containing many genes exhibiting significantly altered transcriptional levels (Supplementary Fig. 4b). An obvious positive correlation was detected between qRT-PCR and RNA-seq results for 15 selected genes (Supplementary Fig. 5), suggesting a good quality of the comparative transcriptomic data. We observed that, with formate stress, multiple crucial genes located in the THF cycle, the reductive glycine pathway, and the serine cycle were significantly up-regulated (Fig. 2a). Four (PN96_22795, PN96_05840, PN96_05845, and PN96_05850) out of six FDH-encoding genes were up-regulated with the highest fold change (9.7-fold) occurring for PN96_05850 (Fig. 2a). Furthermore, an 8.9-fold transcriptional increase in the pfl gene which encodes pyruvate formate-lyase occurred (Fig. 2a). These findings indicate that the formate assimilation and dissimilation reactions mediated by these genes may contribute to the formate metabolism in V. natriegens. Noticeably, the transcriptional levels of nearly all the genes located in the TCA cycle were significantly up-regulated (Fig. 2a). The TCA cycle is the metabolic hub in cells connecting major nutrients, including sugars, lipids, and amino acids^30,31. The overall up-regulation of TCA genes indicates that V. natriegens enhanced its fundamental metabolism to meet the energy demand in formate assimilation. In addition, multiple genes encoding ionic transporters or associated with unsaturated fatty acid synthesis and DNA repair were significantly upregulated (Supplementary Fig. 6). It is known that the acid tolerance of microorganisms can be affected by the efficiency of ionic transporters and the ratio of unsaturated fatty acids in cell membrane^32,33,34; hence, higher expression of these genes may be crucial for the formate tolerance of V. natriegens.

**Fig. 2: Validation of formate assimilation and dissimilation pathways and reconstitution of formate metabolism in *V. natriegens*.**

Based on the above analyses, V. natriegens is predicted to metabolize formate through FTL and PFL-catalyzed assimilation reactions as well as an FDH-catalyzed dissimilation reaction (Fig. 2b, upper). To test them, the candidate genes (i.e., fdh, ftl and pfl) responsible for these reactions were separately or simultaneously deleted in V. natriegens for phenotypic analysis (Fig. 2b, upper). We observed that the deletion of the fdh genes or the ftl gene significantly impaired cell growth and formate consumption, indicating that both the formate dissimilation (oxidation) and assimilation pathways mediated by fdh and ftl, respectively, play roles in the formate metabolism of V. natriegens (Fig. 2b, middle and bottom). However, the deletion of the pfl gene had no influence on cell growth and formate consumption (Fig. 2b, middle and bottom), although this gene was up-regulated in the presence of formate (Fig. 2a). This finding indicates the low catalytic activity of PFL towards formate in V. natriegens. Furthermore, the simultaneous deletion of all the fdh, ftl, and pfl genes led to less formate consumption compared to the separate deletion of the fdh or ftl genes (Fig. 2b, bottom); but interestingly, the mutated strain (with the deletion of all the fdh, ftl, and pfl genes) still maintained partial consumption ability of formate (Fig. 2b, bottom), indicating that these pathways were not completely blocked or there are other unknown approaches contributing to the formate metabolism in V. natriegens.

Designing and creating a metabolic sink to promote formate metabolic flux

The above findings prompted us to reprogram V. natriegens to further enhance its formate utilization. To this end, the following basic rationale was adopted: construction of a powerful metabolic sink that is linked to formate assimilation by integrating the TCA cycle and the serine cycle, aiming at increasing the flux of the serine cycle and its upstream THF cycle by the strong pull from the TCA cycle (Fig. 2c, upper). This was achieved by manipulating the following pathways and genes (Fig. 2c, bottom): (i) disruption of three madh genes (PN96_06470, PN96_19465, and PN96_11695), two maeAB genes (PN96_07295 and PN96_14755), and the aceB gene (PN96_10585) to fuse the serine cycle and the TCA cycle, thus forcing the metabolic flux of the serine cycle to go through the TCA cycle; (ii) disruption of the serA gene (PN96_00930) to enable the generation of more serine from formate assimilation rather than glycolysis.

The resulting strain S-TCA-1.0 was cultivated with the supplementation of 40 g · L^‒1 sodium formate (HCOONa·2H₂O) (equivalent to 385 mM formate). Compared with the wild type strain, S-TCA-1.0 exhibited impaired growth and less total formate consumption (Fig. 2d, e); but interestingly, its formate consumption per unit biomass was much higher than that of the wild type strain (Fig. 2f), indicating the utility of our metabolic engineering strategy in enhancing the formate metabolic flux of individual V. natriegens cells. To confirm that the S-TCA cycle truly contributed to the enhanced formate consumption, we examined the transcriptional differences of all the S-TCA genes between the S-TCA-1.0 and the wild-type strains. As expected, all these genes could be properly expressed in S-TCA-1.0, and moreover, most of them exhibited higher transcription levels in S-TCA-1.0 relative to the wild-type strain (Supplementary Fig. 7). We also assayed multiple metabolites (glycine, serine, hydroxypyruvate, glycerate, phosphoenolpyruvate, α-Ketoglutarate, succinic acid, and fumarate) throughout the S-TCA cycle in the S-TCA-1.0 strain. We found that all these eight compounds could be detected, in which five showed higher concentration in S-TCA-1.0 relative to the wild-type strain, while the other three had no significant differences between the two strains (Supplementary Fig. 8). Our analysis suggests that the S-TCA cycle exerts its function in the cells of S-TCA-1.0, leading to enhanced formate metabolic flux. If the growth deficiency of S-TCA-1.0 can be remedied, this strain will exhibit advantages over the wild type strain in formate utilization.

Adaptive laboratory evolution of S-TCA-1.0 leads to a high-performance strain grown on formate

To efficiently overcome the growth limitation of S-TCA-1.0, this strain was subjected to adaptive laboratory evolution (ALE) with gradually increasing sodium formate concentrations to improve its growth under formate stress. The strain was initially cultivated in the LBv2 medium supplemented with approximately 20 g·L^‒1 sodium formate (HCOONa·2H₂O) (equivalent to 192 mM formate) and subcultured once every 12 h (Fig. 3a). Several rounds of subculturing resulted in the biomass of grown cells reaching OD₆₀₀ ~ 1.0. At this point, the formate concentration was increased and a new evolutionary period began. This approach gradually improved the tolerance of S-TCA-1.0 to formate as well as its growth. Finally, an evolved strain (named S-TCA-2.0) capable of growing in the presence 140 g·L^‒1 sodium formate (equivalent to 1,346 mM formate) was obtained after serial subculturing (Fig. 3b). More importantly, S-TCA-2.0 exhibited exceedingly high formate utilization ability, capable of growing to OD₆₀₀ ~ 1.6 with the consumption of 78.9 g·L^‒1 sodium formate (equivalent to 759 mM formate) within 24 h following initial supplementation of 85 g·L^‒1 sodium formate (equivalent to 817 mM formate) in the medium (Fig. 3c), reaching a formate consumption rate of 1.42 g · L⁻¹ · h⁻¹ (31.6 mM·h⁻¹) which was several times higher than the highest level reported in microorganisms (Supplementary Table 1).

**Fig. 3: Adaptive laboratory evolution of the *V. natriegens* strains further enhances formate tolerance and metabolism.**

An independent ALE experiment was performed in parallel to improve the formate utilization of the wild-type strain of V. natriegens; however, the cellular adaptation of this strain under formate stress was much slower than that of S-TCA-1.0, and enhancement was difficult when the concentration of sodium formate reached 70 g · L^‒1 (equivalent to 673 mM formate) (Supplementary Fig. 9). These results suggest that the reconstituted formate metabolic pathways in V. natriegens (S-TCA-1.0) facilitated the strain evolution to adapt to high formate stress, increasing its formate consumption accordingly.

To better elucidate the genetic basis for the performance of S-TCA-2.0 in using formate, we chose three isolates to sequence their genome. A total of nine mutated genes were found in all the three isolates of S-TCA-2.0 relative to the S-TCA-1.0 strain (Fig. 3d and Table 2). Among them, rpoS, ZapC, and actP, encoding a general stress responsible regulator³⁵, a division protein³⁶, and an acetate permease³⁷, respectively, are commonly observed to be mutated in ALE experiments³⁸. Thus, the mutations of these three genes are unlikely to be specifically linked to the phenotypes (high formate tolerance and consumption) of S-TCA-2.0. Of note, we found a mutation (A44E) in fumA, the gene encoding fumarate hydratase that converts fumarate toward malate (a main flux branch point of the S-TCA cycle). The mutation of this enzyme may reduce the diversion of metabolic flux from the S-TCA cycle. Another potentially key mutation is in sdhC, encoding a cytochrome subunit of succinate dehydrogenase (catalyzing the conversion of succinate to fumarate in the TCA cycle), whose inactivation may change the metabolic flux of TCA cycle. For the remaining four mutated genes, there is currently no clue linked to formate consumption.

Table 2 The nine mutated genes occurred in all the three isolates of the S-TCA-2.0 stain

Full size table

Next, we sought to evaluate how much formate can be assimilated in S-TCA-2.0. For this we cultivated this strain in the M9 minimal medium supplemented with ¹³C-labeled sodium formate and then collected cells for isotopomer analysis. Based on the specific consumption rates of formate, glucose, and glycine, the specific formate assimilation rate was calculated to be 43.3 mg·gDCW^‒1·h^‒1, accounting for approximate 12.1% of the total consumed formate (Supplementary Table 2). Considering that some formate could be converted to the metabolites that are secreted outside cells, the exact amount of formate assimilated by this strain should be higher.

Engineering S-TCA-2.0 for efficient synthesis of indigoidine from formate

Considering the excellent formate utilization ability of S-TCA-2.0, we attempted to evaluate if it could be reprogrammed to efficiently convert formate into valuable compounds. Here, indigoidine was chosen as a target product because it is an important pigment widely used in food, medicine, and dyeing industries, and moreover, can be synthesized using α-ketoglutarate in the TCA cycle as the precursor.

The indigoidine-producing pathway consisting of the Streptomyces lividans Idgs and Bacillus subtilis Sfp, which catalyze the conversion of glutamine to indigoidine, was introduced into S-TCA-2.0 via an expression plasmid, yielding the strain S-TCA-2.0-IE (Fig. 4a). Next, the S-TCA-2.0-IE strain was cultivated in the LBv2 medium supplemented with 85 g·L^‒1 sodium formate (HCOONa·2H₂O). As expected, the culture of S-TCA-2.0-IE appeared blue color, which was caused by indigoidine, after 24 h of fermentation, whereas no blue occurred for the control (the strain S-TCA-2.0 harboring a blank plasmid) (Fig. 4b), indicating the production of indigoidine by S-TCA-2.0-IE in the presence of high concentration of formate. To further validate the formate assimilation in S-TCA-2.0-IE, the amino acids formed from the artificial S-TCA cycle (glycine, serine, isoleucine, lysine, methionine, aspartic acid, glutamate, and phenylalanine) or pyruvate (alanine, valine, and leucine) were analyzed through the isotopic labeling experiment using ¹³C-labelled formate. The result showed that all the detected amino acids were labeled by ¹³C (mostly, m + 1), in which serine and methionine contained higher proportions of ¹³C-labelled amino acids (45.7% and 39.4%, respectively), probably due to that these two amino acids relative to the other amino acids are more closely linked to formate assimilation (THF cycle) (Fig. 4c).

**Fig. 4: Engineering the evolved *V. natriegens* strain for efficient production of indigoidine from formate.**

We next attempted to explore the real potential of S-TCA-2.0-IE in using formate for indigoidine production in a fed-batch mode. This strain was grown in the LBv2 medium containing approximately 60 g·L^‒1 initial sodium formate (HCOONa·2H₂O) (equivalent to 577 mM formate), with additional sodium formate (60 g·L^‒1) added into the medium every 12 h (repeated five times). We observed that S-TCA-2.0-IE continued to grow with the supplementation of formate, achieving the highest biomass (OD₆₀₀ ~ 3.1) at 60 h (Fig. 4d, left); in contrast, the biomass of S-TCA-2.0-IE stopped to increase after 18 h in the medium without formate addition, reaching to the highest biomass of OD₆₀₀ ~ 1.5 (Fig. 4d, left). Concurrently, S-TCA-2.0-IE consumed all the formate (approximately 165.3 g·L⁻¹ formate) added into the medium and produced 29.0 g · L⁻¹ of indigoidine within 72 h (Fig. 4d, right), achieving a specific formate consumption rate of 2.3 g · L⁻¹ · h⁻¹. Such an indigoidine production level, to our knowledge, is higher than the reported highest indigoidine production through microbial synthesis although under different cultivation conditions (Supplementary Table 3). In contrast, the indigoidine produced by S-TCA-2.0-IE was only 4.7 g · L⁻¹ without the supplementation of formate (Fig. 4d, right). Altogether, these results confirmed the great potential of S-TCA-2.0-IE in indigoidine production using formate as the co-substrate.

Discussion

FA chemically converted from CO₂ is an attractive feedstock for biological production of various value-added chemicals. In this study, we have two important findings. First, the exceptional tolerance and metabolic capacity of V. natriegens to formate represent a superior FA-utilizing platform strain. Second, a combination of rational metabolic remodeling that generated the non-native S-TCA loop and laboratory evolution represents a successful strategy with potential universality for enhancing microbial FA utilization.

A large number of pathways and genes were found to be active during the formate metabolism in V. natriegens. Therefore, it seems that this organism has metabolic flexibility and versatility in the presence of formate. Multiple formate dehydrogenase genes were significantly up-regulated under formate stress (Fig. 2a), indicating that these FDHs were activated to oxidize the available formate to CO₂ with the generation of reducing power. Although the key genes (ftl and folD) responsible for the THF cycle exhibited similar expression levels with and without formate (Fig. 2a), the majority of the genes associated with the downstream reductive glycine pathway, the serine cycle, and the TCA cycle were significantly up-regulated following formate addition (Fig. 2a), which would pull the flux of the THF cycle and promote formate conversion into various metabolites. Noticeably, V. natriegens still remained partial formate consumption ability even after the deletion of all the predicted fdh, ftl, and pfl genes (Fig. 2b, bottom), suggesting the existence of potential alternative pathways for formate assimilation. One possibility is the pathways starting with the reduction of fomate to formaldehyde⁴: (i) formate can be ligated with CoA by an acetyl-CoA synthetase to form formyl-CoA followed by the reduction to formaldehyde by an acyl-CoA reductase. (ii) formate can be activated by a kinase to produce formyl phosphate followed by the reduction to formaldehyde by a formyl phosphate reductase. These two pathways have been constructed and tested in vivo recently^39,40,41; however, whether they occur in nature in microorganisms and contribute to formic assimilation remain unclear.

Formate assimilation has been previously used to relieve the serine-auxotrophy of E. coli^2,42, suggesting that formate assimilation fluxes could be directed toward serine synthesis. In our design, serine production from glycolysis was blocked by deleting the serA gene, which would enhance the THF cycle flux to form serine. Additionally, the artificial S-TCA cycle created by integrating the serine cycle and the TCA cycle enabled the high-flux TCA to pull the upstream carbon supply and consequently enhance formate assimilation and conversion. This metabolic design is crucial for the following rapid evolution of V. natriegens into the strains with exceptional formate metabolic capacity since the wild-type strain did not achieve the goal using the same adaptive laboratory evolution strategy. Although the growth of V. natriegens was impaired after multiple gene deletions for constructing the S-TCA module (Fig. 2d), the following adaptive laboratory evolution rapidly recovered cellular fitness. This finding indicates that V. natriegens has excellent plasticity in metabolic remodeling. Therefore, the rapid generation of the evolved strain S-TCA-2.0 with strikingly enhanced formate metabolism should be attributed to the combination of metabolic engineering and adaptive laboratory evolution. This metabolic design may also work in other microbial chassis to create diverse cell factories for formate utilization. However, even though the S-TCA-2.0 stain exhibited efficient formate consumption, potential bottlenecks may still exist in the artificial S-TCA cycle. For example, we found that the overexpression of some genes in the glycine cleavage system (GCS) and the serine cycle could affect the formate consumption of S-TCA-2.0 (Supplementary Fig. 10), indicating ample room for further improvement of this metabolic pathway.

It should be noted that formate assimilation to acetyl-CoA via the THF cycle in microorganisms is an energy consuming process. The energy required for formate assimilation should depend on other approaches, such as the metabolism of other organic carbon sources or FDH-catalysed formate oxidation. Moreover, all the reported native and artificial bacteria showed poor growth using formate as the sole organic carbon source^{5,6,7,9,10,19,20}. Therefore, the LBv2 medium which contains yeast extract and peptone was used here to evaluate the real potential of the strain S-TCA-2.0-IE in formate consumption and indigoidine production, rather than using the minimal medium containing formate as the sole carbon source. Although yeast extract and peptone in the LBv2 medium enabled growth and indigoidine synthesis of S-TCA-2.0-IE, further enhanced biomass and indigoidine production were observed with the supplementation of formate (Fig. 4d), strongly indicating the contribution of formate consumption to indigoidine production. We analyzed the proportion of ¹³C-labelled glutamine (the precursor of indigoidine) to total glutamine in the S-TCA-2.0-IE strain and found that the ¹³C-glutamine (M1) accounted for 12.9% of total glutamine (Supplementary Fig. 11). This analysis confirmed that the carbon atom in formate could be incorporated into indigoidine but the ratio was not high. Therefore, we deduce that a large portion of the consumed formate was oxidized to form CO₂ (generating reducing power) and assimilated into biomass components in S-TCA-2.0-IE, which would facilitate cell growth or other co-substrates (e.g., tryptone and yeast extract) to be more used for indigoidine synthesis. This may also partially explain why the addition of formate could significantly enhance the production of indigoidine by S-TCA-2.0-IE grown in the LBv2 medium.

In summary, our work uncovered the excellent metabolic power of V. natriegens towards formate and further developed this bacterium into an efficient cell factory for converting formate into target products. The knowledge gained in this study and the engineering strategies presented here will be highly useful for advancing formate bioutilization.

Methods

Bacterial strains and growth conditions

Vibrio natriegens ATCC 14048 (stored at −80 °C as a 20% glycerol stock) was used as the parental strain for formate fermentation as well as further genetic modifications. The V. natriegens strains were grown in the nutrient-rich LBv2 medium or a slightly modified M9 minimal medium (addition of 2% (w/v) NaCl; 0.25 g·L^‒1 of glycine was added when needed) at 30 °C²². Chloramphenicol (12.5 µg·mL^‒1), kanamycin (100 µg·mL^‒1), carbenicillin (100 µg·mL^‒1), and different amounts of sodium formate (HCOONa·2H₂O) were added into the media when needed. Escherichia coli DH5ɑ (stored at −20 °C as a 20% glycerol stock) was used as the host for plasmid cloning. The E. coli cells were grown in the LB medium supplemented with chloramphenicol (12.5 µg·mL^‒1), ampicillin (100 µg·mL^‒1), or kanamycin (100 µg·mL^‒1). All the strains used in this study are listed in Supplementary Table 4.

Reagents and chemicals

Primers were synthesized by BioSune (BioSune, China). PCR reactions were carried out by using KOD plus Neo and KOD FX DNA polymerase (Toyobo, Japan). The restriction enzymes and ligases used in plasmid construction were purchased from Thermo Fisher Scientific (Thermo Fisher Scientific, USA) and Takara (Takara, Japan), respectively. The assembly of multiple DNA fragments for plasmid construction was performed by using the ClonExpress MultiS One Step Cloning Kit (Vazyme Biotech Co., Ltd., China). Plasmid isolation and DNA purification were performed with kits (Axygen Biotechnology Company Limited, China).

Sodium formate used in this study was HCOONa·2H₂O. ¹³C-labelled sodium formate was ordered from Cambridge Isotope Laboratories (Cambridge Isotope Laboratories, Inc., USA). The other commercial chemicals were purchased from Sigma-Aldrich (Sigma-Aldrich Co., USA) and Aladdin (Shanghai Aladdin Biochemical Technology Co., Ltd., China).

Plasmid construction

All the plasmids and primers used in this study are listed in Supplementary Table 4 and Supplementary Data 1, respectively.

The vector co-expressing idgs (SLIVYQS_19313, encoding indigoidine synthetase) and sfp (GFX43_019515, encoding phosphoryltransferase), from S. lavendulae CGMCC 4.1386 and Bacillus subtilis 168, respectively, for indigoidine production was constructed as follows. A DNA fragment (idgs-RBS-sfp) that contained the codon-optimized idgs gene, an RBS sequence (ggatccactctgtcagatctcactctgccaaggaggacgcac), and the sfp gene was synthesized (GenScript, China). Another DNA fragment that harbored a promoter (ttgacagctagctcagtcctaggtactgtgctagc) and RBS sequence (agagtcacacaggaaagtacta) was obtained by PCR amplification, using the primers J23102-B00320m-F/J23102-B00320m-R which have a 21-nt overlap at the 3′ region. Next, this DNA fragment was linked to the idgs-RBS-sfp fragment via overlapping PCR using the primers J23102-B00320m-idgs-sfp-F/idgs-sfp-R, yielding a larger DNA fragment. The obtained DNA fragment was further linked with a linear plasmid pColE1-Amp vector⁴³ using a ClonExpress MultiS One Step cloning kit (Vazyme, China), generating the target plasmid for indigoidine production.

The plasmid pMMB67EH-tfox-sacB, modified from the plasmid pMMB67EH-tfox²⁸, was used for supporting the transformation of exogenous DNA into V. natriegens. In brief, the plasmid backbone was obtained by PCR amplification using the plasmid pMMB67EH-tfox as the template and the primers tfox-F/tfox-R. The sacB gene was obtained by PCR amplification using the plasmid pEcCas⁴⁴ as the template and primers sacB-F/sacB-R. These two DNA fragments were assembled using the ClonExpress MultiS One Step cloning kit (Vazyme, China), yielding the plasmid pMMB67EH-tfox-sacB.

Generation of V. natriegens mutants

Gene knockout was achieved in V. natriegens using the MuGENT (multiplex genome editing by natural transformation) method²⁸. In brief, the V. natriegens cells harboring the abovementioned pMMB67EH-tfox-sacB plasmid were grown overnight in the LBv2 medium (containing 100 µg·mL^‒1 carbenicillin and 100 μM IPTG) in a shaking incubator with a shaker rate of 280 rpm at 30 °C. 3.5 μL of the grown culture were then diluted into 350 μL using the IO medium (28 g·L^‒1 of instant ocean sea salts)²⁸ plus 100 μM IPTG, which was further mixed with 50 ng of a selected product (a DNA fragment that has an antibiotic resistance marker and two homologous arms flanking the dns gene) and 200 ng of an unselected product (a DNA fragment that has two homologous arms flanking the gene of interest but lacks any selectable marker). The mixture was incubated statically at 30 °C for 5 h. Next, 1 mL of the LBv2 medium was added, and the mixture was further outgrown at 30 °C with shaking (280 rpm) for 2 h. The cultures were then plated onto the LBv2 agar plates (containing 100 µg·mL^‒1 carbenicillin and 12.5 µg·mL^‒1 chloramphenicol or 100 µg·mL^‒1 kanamycin). When colonies were visible on the plates after incubation at 30 °C for 10 h, some were picked and subjected to colony PCR using the primers KO-gene-seq-F/KO-gene-seq-R, aiming to detect the desired gene knockout events.

Finally, to eliminate the pMMB67EH-tfox-sacB plasmid in cells, the colonies with desired gene knockout were harvested from agar surface, resuspended in 5 mL of the LBv2 medium (containing 80 g·L^‒1 sucrose), and incubated at 30 °C with shaking (280 rpm) for 10 h. The grown cells were plated onto the LBv2 agar plates (containing 80 g·L^‒1 sucrose) again. When colonies were visible on the plates after incubation at 30 °C for 12 h, some were picked and resuspended in the LBv2 medium with and without carbenicillin (100 µg·mL^‒1) to verify plasmid curing.

Adaptive laboratory evolution

The engineered V. natriegens strain S-TCA-1.0 was first inoculated into 5 mL of the LBv2 medium that contained 20 g·L^‒1 sodium formate (HCOONa·2H₂O) and then incubated in a shaking incubator (30 °C and 280 rpm) for inoculum preparation. After overnight cultivation, 0.1 mL of grown cells were inoculated into 5 mL of the fresh LBv2 medium (containing 20 g·L^‒1 sodium formate). Once cells could grow to over 1.0 of OD₆₀₀ after overnight cultivation by serial subculturing, the concentration of sodium formate was increased in the next round of subculturing. Samples were taken every passage and then stored at ‒80 °C. When formate concentration in the medium was raised to 50 g·L^‒1, the UV (ultraviolet) mutagenesis of cells was carried out every three passages by placing the culture at a distance of 10 cm away from a 20-W UV light lamp for 15 min, aiming to accelerate the strain mutation and evolutionary efficiency.

Analytical methods

The concentration of formate was determined using an Agilent 1100 HPLC system (Agilent, China) equipped with a bio-Rad Aminex HPx-87H column (Bio-Red). In brief, samples were taken from the fermentation broth at appropriate time intervals and then centrifuged at 7000 × g for 20 min at 4 °C. Next, 200 μL of supernatant was analyzed by HPLC. The column temperature was maintained at 30 °C. The flow rate of the mobile phase (5 mM H₂SO₄) is 0.6 mL·min^‒1.

The purification of indigoidine was performed as previously described with slight modifications⁴⁵. In brief, the fermentation broth was firstly freeze-dried. The generated powder was sequentially treated with methanol, isopropanol, water, ethanol, and hexane for three rounds, aiming to lyse cells and remove contaminating proteins and metabolites. The pellet was dried overnight and then resuspended in dimethylsulfoxide (DMSO) at a concentration of 1 mg·mL⁻¹. The purity of indigoidine was determined by HPLC and mass spectrum (Supplementary Fig. 12). The purified indigoidine reagent was used to establish a standard curve correlating the concentration of indigoidine to the absorbance at OD₆₀₀ (Supplementary Fig. 13). To quantify indigoidine produced by V. natriegens, 1 mL of the fermentation broth was collected and treated by the same procedure described above. The concentration of indigoidine was determined by measuring the optical absorbance at 600 nm using a spectrophotometer (DU730, Beckman Coulter, Inc., USA).

The measurement of glycine was carried out based on the method described previously with a few modifications⁴⁶. In brief, glycine was measured by HPLC with o-phthaldialdehyde (OPA) (500 mg OPA, 5 ml ethanol, and 500 µl mercaptopropionic acid in 50 ml of 0.4 M borate buffer) as a precolumn derivatization reagent. Mobile phase A and B were sodium acetate solution (50 mM) and methanol, respectively. The flow rate was 1 mL‧min⁻¹ and the detection wavelength was 334 nm. The Zorbax Eclipse XDB-C8 (4.6 × 150 mm, 3.5 µm) column was used with a matched guard column. The gradient program for HPLC was as follows: 0–7 min, 30% solution B; 7–14 min, 45% solution B; 14.5–18 min, 30% solution B. The sample loading volume was 5 µl. The column temperature was kept at 35 °C.

RNA-seq analysis

V. natriegens strains were cultured in the LBv2 medium with or without the supplementation of sodium formate (HCOONa·2H₂O) (40 g·L^‒1). The grown cells (6 h of cultivation) were harvested by centrifugation (6000 × g, 4 °C, 20 min) and then frozen in liquid nitrogen. The RNA-seq assays were finished by the Majorbio Co. Ltd. in China. In brief, total RNA was extracted using the TRIzol® reagent (R0016, Beyotime, China) followed by the removal of genomic DNA using DNase I (TaKara, Japan). The 16S and 23S ribosomal RNA (rRNA) in total RNA were eliminated using a Ribo-Zero Magnetic kit (Epicenter Biotechnologies, WI, USA). Thereafter, mRNA was broken into short fragments (~200 bp) with the fragmentation buffer. Next, cDNA was synthesized via reverse transcriptase using a SuperScript double-stranded cDNA synthesis kit (Invitrogen, CA) with random hexamer primers (Illumina, USA). The second strand of cDNA was generated by incorporating deoxyuridine triphosphate (dUTP) into the place of deoxythymidine triphosphate (dTTP), aiming to create blunt-ended cDNAs. The yielding double-stranded cDNAs were subjected to end repair, phosphorylation, 3′ adenylation, and adapter ligation in sequential. Next, the second strand of cDNA with dUTP was degraded using UNG enzyme (Uracil-N-Glycosylase). cDNA fragments were separated on a 2% agarose gel. The DNA fragments of ~200 bp were extracted from the gel and used as the template for the construction of cDNA libraries by PCR amplification using the Phusion DNA polymerase (NEB, USA) with 15 reaction cycles. After quantification with a micro fluorometer (TBS-380, TurnerBioSystems, USA), the libraries were sequenced on the Illumina HiSeq × Ten sequencer using paired-end sequencing.

Bioinformatics analysis was performed using a cloud platform (Shanghai Majorbio Bio-Pharm Technology Co., Ltd., China) based on the data generated by the Illumina platform. The main methods are as follows: RSEM was used to quantify gene and isoform abundances. The TPM method was used to calculated expression levels. Differentially expressed genes were identified by using the DESeq2 packages (http://bioconductor.org/packages/release/bioc/html/DESeq2.html).

Quantitative real-time-PCR

Quantitative real-time-PCR (qRT-PCR) was performed to verify the RNA-seq data. Briefly, cultures (cultivation in the LBv2 medium with or without the supplementation of sodium formate) were taken after 6 h of cultivation, frozen quickly in liquid nitrogen, and ground into powders. RNA samples were then extracted using a Ultrapure RNA Kit (SparkJade, China), followed by the removal of genomic DNA with DNase I (SparkJade, China). Next, qRT-PCR was carried out in a MyiQ2 thermal cycler (Bio-Rad, USA) using a SYBR Green PCR premix kit (SparkJade, China). The transcript levels of the tested genes were normalized to that of the 16S rRNA gene (PN96_00205, an internal control) of V. natriegens. The primers used are listed in Supplementary Data 1.

¹³C isotopomer analysis

¹³C isotopomer analysis of amino acids in the V. natriegens S-TCA-2.0-IE strain was carried out as follows. Briefly, the V. natriegens cells were grown in 4 mL of the LBv2 medium (40 g‧L^‒1 of HCOONa·2H₂O) at 30 °C. When cells grew to the plateau stage, 60 g·L^‒1 of ¹³C-labeled sodium formate (HCOONa·2H₂O) was added into the medium. After 24 h of cultivation, 0.01 mL of the grown cells were inoculated into the same medium (40 g‧L^‒1 of HCOONa·2H₂O) for cultivation again with the supplementation of 60 g·L^‒1 of ¹³C-labeled sodium formate. Such a subculturing was repeated three times. The grown cells of the last passage were harvested by centrifugation (6000 × g, 4 °C, 20 min) and incubated with 200 μL 6 M HCl at 105 °C for 24 h. The samples were dried in a vacuum centrifuge and then derivatized with 100 μL of pyridine and 50 μL of N-methyl-N-[tert-butyldimethylsilyl] trifluoroacetamide at 85 °C for 1 h. After filtration (0.45 μm pore size, Millipore), 1 μL of samples were injected into a GC-MS system equipped with a DB-5HT column (30 × 0.25 mm, 0.1 μm), which was operated in an electron shock (EI) mode at 70 eV. Amino acids were determined by matching masses and retention times to authenticated standards library.

Isotopomer analysis of glutamine in the S-TCA-2.0-IE strain was performed as follows. The cells were grown in 5 mL of the LBv2 medium supplemented with 60 g‧L^‒1 of ¹³C-labelled sodium formate (HCOONa·2H₂O). After 24 h of cultivation, 0.25 mL of the grown cells were inoculated into the same medium for cultivation again. Such a subculturing was repeated three times. The grown cells of the last passage were collected by centrifugation (6000 × g, 4 °C, 20 min). Then, cells were mixed with acetonitrile/methanol/water (40: 40: 20), incubated at –20 °C for 20 min, and centrifuged (12,000 × g, 4 °C, 20 min). The supernatant was collected to analyze glutamine by ultrahigh-performance liquid chromatograph (UHPLC; Acquity; Waters) coupled to a Q Exactive hybrid quadrupole-orbitrap mass spectrometer (Thermo Fisher Scientific, Inc., USA). Metabolites were separated with a Waters Corp Acquity UPLC HSS T3 column (100 × 2 mm, 1.8 μm). The mass spectrometer was run in both electrospray ionization positive (ESI+) and negative (ESI−) modes. Data were acquired using full scan over 70–1000 m/z at 70,000 resolution. MS/MS spectra were acquired with 30-eV collision energy. Data processing was performed by Compound Discoverer 2.0 (Thermo Fisher Scientific, Inc., USA), with a mass tolerance of 5 ppm for both noise filtering and database search.

Metabolomics analysis

The grown cells (OD₆₀₀ ~ 1.0) were harvested by centrifugation (6000 × g, 4 °C, 20 min). Then, cells were mixed with acetonitrile/methanol/water (40:40:20) and incubated at –20 °C for 20 min. Next, the samples were centrifuged (12,000 × g, 4 °C, 20 min), and the supernatant was collected. The metabolites were analyzed through the ultrahigh performance liquid chromatograph (Acquity, Waters) with a Q Exactive hybrid quadrupole–orbitrap mass spectrometer (Thermo Fisher Scientific, Inc., USA). 10 µL of the samples were injected into the LC-MS system. Metabolites were separated by a Luna NH2 column (100 mm × 2 mm, 3 µm particle size, Phenomenex) with a solvent flow rate of 0.3 mL min⁻¹. The analysis was carried out with the column temperature maintained at 15 °C. Solvent A (20 mM ammonium acetate, adjusted to pH 9.0 with ammonium hydroxide) and solvent B (acetonitrile) served as the mobile phases with a gradient as follows: 0 min, 85% solvent B; 10 min, 45% solvent B; 15 min, 2% solvent B; 18 min, 2% solvent B; 18.1 min, 85% solvent B; 24 min 85% solvent B. The mass spectrometer with a heated electrospray ionization source was operated in a positive mode. Data were generated through full scan over 70–1000 m/z at 70,000 resolution. MS/MS spectra were acquired with 30-eV collision energy. The compound identities were verified by mass and retention-time match to authenticated standards.

Analysis of ¹³C ratio in biomass

Formate assimilation ratio was performed by analyzing the proportion of ¹³C in the total carbon of biomass as previously described¹⁸. In brief, the V. natriegens S-TCA-2.0 cells were grown in the modified M9 medium (supplemented with 2.0 g·L^‒1 glucose, 0.25 g·L^‒1 glycine, and 10 g·L^{‒1 13}C-labeled HCOONa·2H₂O) at 30 °C. After 48 h of cultivation, 1 mL of the grown cells were harvested by centrifugation (6000 × g, 4 °C, for 10 min) and then washed twice with the double distilled water. Next, the samples were freeze-dried and used for determining ¹³C contents by an isotope ratio mass spectrometer coupled with an elemental analyzer (Thermo Fisher Scientific, Inc., USA).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The RNA-seq data and genome resequencing data generated in this study have been deposited in the NCBI SRA database under Bioproject accession PRJNA843433 and PRJNA1022572, respectively. Source data are provided with this paper.

References

Jiang, W. et al. Metabolic engineering strategies to enable microbial utilization of C1 feedstocks. Nat. Chem. Biol. 17, 845–855 (2021).
Article CAS PubMed Google Scholar
Yishai, O., Goldbach, L., Tenenboim, H., Lindner, S. N. & Bar-Even, A. Engineered assimilation of exogenous and endogenous formate in Escherichia coli. ACS Synth. Biol. 6, 1722–1731 (2017).
Article CAS PubMed Google Scholar
Bang, J. et al. Synthetic formatotrophs for one-carbon biorefinery. Adv. Sci. 8, 2100199 (2021).
Article CAS Google Scholar
Bar-Even, A. Formate assimilation: the metabolic architecture of natural and synthetic pathways. Biochemistry 55, 3851–3863 (2016).
Article CAS PubMed Google Scholar
Stokes, J. E. & Hoare, D. S. Reductive pentose cycle and formate assimilation in Rhodopseudomonas palustris. J. Bacteriol. 100, 890–894 (1969).
Article CAS PubMed PubMed Central Google Scholar
Goldberg, I. & Mateles, R. I. Growth of Pseudomonas C on C1 compounds: enzyme activites in extracts of Pseudomonas C cells grown on methanol, formaldehyde, and formate as sole carbon sources. J. Bacteriol. 122, 47–53 (1975).
Article CAS PubMed PubMed Central Google Scholar
Moon, Y. J. et al. Proteome analyses of hydrogen-producing hyperthermophilic archaeon Thermococcus onnurineus NA1 in different one-carbon substrate culture conditions. Mol. Cell. Proteomics 11, M111.015420 (2012).
Article PubMed PubMed Central Google Scholar
Zhuang, W. Q. et al. Incomplete Wood-Ljungdahl pathway facilitates one-carbon metabolism in organohalide-respiring Dehalococcoides mccartyi. Proc. Natl Acad. Sci. USA 111, 6419–6424 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Grunwald, S. et al. Kinetic and stoichiometric characterization of organoautotrophic growth of Ralstonia eutropha on formic acid in fed-batch and continuous cultures. Microb. Biotechnol. 8, 155–163 (2015).
Article CAS PubMed Google Scholar
Urschel, M. R., Hamilton, T. L., Roden, E. E. & Boyd, E. S. Substrate preference, uptake kinetics and bioenergetics in a facultatively autotrophic, thermoacidophilic crenarchaeote. FEMS Microbiol. Ecol. 92, fiw069 (2016).
Article PubMed Google Scholar
Liu, Z. et al. Exploring eukaryotic formate metabolisms to enhance microbial growth and lipid accumulation. Biotechnol. Biofuels 10, 22 (2017).
Article PubMed PubMed Central Google Scholar
Gonzalez de la Cruz, J., Machens, F., Messerschmidt, K. & Bar-Even, A. Core catalysis of the reductive glycine pathway demonstrated in Yeast. ACS Synth. Biol. 8, 911–917 (2019).
Article CAS PubMed PubMed Central Google Scholar
Arantes, A. L. et al. Enrichment of anaerobic syngas-converting communities and isolation of a novel carboxydotrophic Acetobacterium wieringae strain JM. Front. Microbiol. 11, 58 (2020).
Article PubMed PubMed Central Google Scholar
Ergal, I. et al. Formate utilization by the crenarchaeon Desulfurococcus amylolyticus. Microorganisms 8, 454 (2020).
Article CAS PubMed PubMed Central Google Scholar
Sánchez-Andrea, I. et al. The reductive glycine pathway allows autotrophic growth of Desulfovibrio desulfuricans. Nat. Commun. 11, 5090 (2020).
Article ADS PubMed PubMed Central Google Scholar
Wood, G. E., Haydock, A. K. & Leigh, J. A. Function and regulation of the formate dehydrogenase genes of the methanogenic archaeon Methanococcus maripaludis. J. Bacteriol. 185, 2548–2554 (2003).
Article CAS PubMed PubMed Central Google Scholar
Lawson, C. E. et al. Autotrophic and mixotrophic metabolism of an anammox bacterium revealed by in vivo ¹³C and ²H metabolic network mapping. ISME J 15, 673–687 (2021).
Article CAS PubMed Google Scholar
Bang, J. & Lee, S. Y. Assimilation of formic acid and CO₂ by engineered Escherichia coli equipped with reconstructed one-carbon assimilation pathways. Proc. Natl Acad. Sci. USA. 115, E9271–E9279 (2018).
Article ADS CAS PubMed PubMed Central Google Scholar
Bang, J., Hwang, C. H., Ahn, J. H., Lee, J. A. & Lee, S. Y. Escherichia coli is engineered to grow on CO₂ and formic acid. Nat. Microbiol. 5, 1459–1463 (2020).
Article CAS PubMed Google Scholar
Kim, S. et al. Growth of E. coli on formate and methanol via the reductive glycine pathway. Nat. Chem. Biol. 16, 538–545 (2020).
Article CAS PubMed Google Scholar
Weinstock, M. T., Hesek, E. D., Wilson, C. M. & Gibson, D. G. Vibrio natriegens as a fast-growing host for molecular biology. Nat. Methods 13, 849–851 (2016).
Article CAS PubMed Google Scholar
Lee, H. H. et al. Functional genomics of the rapidly replicating bacterium Vibrio natriegens by CRISPRi. Nat. Microbiol. 4, 1105–1113 (2019).
Article CAS PubMed Google Scholar
Hoff, J. et al. Vibrio natriegens: an ultrafast-growing marine bacterium as emerging synthetic biology chassis. Environ. Microbiol. 22, 4394–4408 (2020).
Article PubMed Google Scholar
Thoma, F. & Blombach, B. Metabolic engineering of Vibrio natriegens. Essays Biochem. 65, 381–392 (2021).
Article PubMed PubMed Central Google Scholar
Xu, J. et al. Vibrio natriegens as a pET-compatible expression host complementary to Escherichia coli. Front. Microbiol. 12, 627181 (2021).
Article PubMed PubMed Central Google Scholar
Eagon, R. G. & Wang, C. H. Dissimilation of glucose and gluconic acid by Pseudomonas natriegens. J. Bacteriol. 83, 879–886 (1962).
Article CAS PubMed PubMed Central Google Scholar
Hoffart, E. et al. High substrate uptake rates empower Vibrio natriegens as production host for industrial biotechnology. Appl. Environ. Microbiol. 83, e01614-17 (2017).
Dalia, T. N. et al. Multiplex genome editing by natural transformation (MuGENT) for synthetic biology in Vibrio natriegens. ACS Synth. Biol. 6, 1650–1655 (2017).
Article CAS PubMed PubMed Central Google Scholar
Zhang, Y. et al. Systems metabolic engineering of Vibrio natriegens for the production of 1,3-propanediol. Metab. Eng. 65, 52–65 (2021).
Article CAS PubMed Google Scholar
Akram, M. Citric acid cycle and role of its intermediates in metabolism. Cell Biochem. Biophys. 68, 475–478 (2014).
Article CAS PubMed Google Scholar
Vuoristo, K. S., Mars, A. E., Sanders, J. P. M., Eggink, G. & Weusthuis, R. A. Metabolic engineering of TCA cycle for production of chemicals. Trends Biotechnol. 34, 191–197 (2016).
Article CAS PubMed Google Scholar
Kroll, R. G. & Booth, I. R. The relationship between intracellular pH, the pH gradient and potassium transport in Escherichia coli. Biochem. J. 216, 709–716 (1983).
Article CAS PubMed PubMed Central Google Scholar
Warnecke, T. & Gill, R. T. Organic acid toxicity, tolerance, and production in Escherichia coli biorefining applications. Microb. Cell Fact. 4, 25 (2005).
Article PubMed PubMed Central Google Scholar
Xu, Y. et al. An acid-tolerance response system protecting exponentially growing Escherichia coli. Nat. Commun. 11, 1496 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Suh, S. J. et al. Effect of rpoS mutation on the stress response and expression of virulence factors in Pseudomonas aeruginosa. J. Bacteriol. 181, 3890–3897 (1999).
Article CAS PubMed PubMed Central Google Scholar
Hale, C. A. et al. Identification of Escherichia coli ZapC (YcbW) as a component of the division apparatus that binds and bundles FtsZ polymers. J. Bacteriol. 193, 1393–1404 (2011).
Article CAS PubMed PubMed Central Google Scholar
Gimenez, R., Nuñez, M. F., Badia, J., Aguilar, J. & Baldoma, L. The gene yjcG, cotranscribed with the gene acs, encodes an acetate permease in Escherichia coli. J. Bacteriol. 185, 6448–6455 (2003).
Article CAS PubMed PubMed Central Google Scholar
Phaneuf, P. V., Gosting, D., Palsson, B. O. & Feist, A. M. ALEdb 1.0: a database of mutations from adaptive laboratory evolution experimentation. Nucleic Acids Res. 47, D1164–D1171 (2019).
Article PubMed Google Scholar
Hu, G. et al. Synergistic metabolism of glucose and formate increases the yield of short-chain organic acids in Escherichia coli. ACS Synth. Biol. 11, 135–143 (2022).
Article CAS PubMed Google Scholar
Wang, J., Anderson, K., Yang, E., He, L. & Lidstrom, M. E. Enzyme engineering and in vivo testing of a formate reduction pathway. Synth. Biol. 6, ysab020 (2021).
Article Google Scholar
Nattermann, M. et al. Engineering a new-to-nature cascade for phosphate-dependent formate to formaldehyde conversion in vitro and in vivo. Nat. Commun. 14, 2682 (2023).
Article ADS CAS PubMed PubMed Central Google Scholar
Yishai, O., Bouzon, M., Döring, V. & Bar-Even, A. In vivo assimilation of one-carbon via a synthetic reductive glycine pathway in Escherichia coli. ACS Synth. Biol. 7, 2023–2028 (2018).
Article CAS PubMed Google Scholar
Jakes, K. S. The colicin E1 TolC box: identification of a domain required for colicin E1 cytotoxicity and TolC binding. J. Bacteriol. 199, e00412–e00416 (2017).
Article CAS PubMed Google Scholar
Li, Q. et al. A modified pCas/pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochim. Biophys. Sin. 53, 620–627 (2021).
Article CAS PubMed Google Scholar
Banerjee, D. et al. Genome-scale metabolic rewiring improves titers rates and yields of the non-native product indigoidine at scale. Nat. Commun. 11, 5385 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Sun, X., Tan, Y., Yang, Z., Li, S. & Hoffman, R. M. A rapid HPLC method for the measurement of ultra-low plasma methionine concentrations applicable to methionine depletion therapy. Anticancer Res. 25, 59–62 (2005).
CAS PubMed Google Scholar

Download references

Acknowledgements

This research was supported by the National Key R&D Program of China (No. 2018YFA0901500 to Y.G.), the National Natural Science Foundation of China (No. 31921006 to W.J.), the Shanghai Science and Technology Commission (No. 21DZ1209100 to Y.G.), DNL Cooperation Fund, CAS (No. DNL202013 to Y.G.), and Tianjin Synthetic Biotechnology Innovation Capacity Improvement Project (TSBICIP-KJGG-016-01 to Y.G.). We are grateful to Wenli Hu and Xiaoyan Xu for HPLC and LC-MS/MS analyses.

Author information

These authors contributed equally: Jinzhong Tian, Wangshuying Deng.

Authors and Affiliations

CAS-Key Laboratory of Synthetic Biology, CAS Center for Excellence in Molecular Plant Sciences, Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, Shanghai, 200032, China
Jinzhong Tian, Wangshuying Deng, Ziwen Zhang, Guoping Zhao, Sheng Yang, Weihong Jiang & Yang Gu
Xianghu Laboratory, Hangzhou, 311231, China
Jinzhong Tian & Guiling Yang
University of Chinese Academy of Sciences, Beijing, China
Wangshuying Deng & Ziwen Zhang
ZJU-Hangzhou Global Scientific and Technological Innovation Center, Hangzhou, 311215, China
Jiaqi Xu

Authors

Jinzhong Tian
View author publications
You can also search for this author in PubMed Google Scholar
Wangshuying Deng
View author publications
You can also search for this author in PubMed Google Scholar
Ziwen Zhang
View author publications
You can also search for this author in PubMed Google Scholar
Jiaqi Xu
View author publications
You can also search for this author in PubMed Google Scholar
Guiling Yang
View author publications
You can also search for this author in PubMed Google Scholar
Guoping Zhao
View author publications
You can also search for this author in PubMed Google Scholar
Sheng Yang
View author publications
You can also search for this author in PubMed Google Scholar
Weihong Jiang
View author publications
You can also search for this author in PubMed Google Scholar
Yang Gu
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

J.T. conceived and performed strain modifications, adaptive laboratory evolution and isotopic labeling experiments; W.D. and Z.Z. constructed plasmids; J.T. and W.D. analyzed the phenotypic changes of the mutants; W.D. performed bioinformatics analyses and isotopic labeling experiments; Y.G. and W.J. supervised and directed the study. Y.G., W.J., J.T. and W.D. wrote the manuscript. G.Y., G.Z., S.Y., and J.X. discussed results and offered advices.

Corresponding authors

Correspondence to Jinzhong Tian, Weihong Jiang or Yang Gu.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Hyun Uk Kim, An-Ping Zeng and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Peer Review File

Supplementary Data

Reporting Summary

Supplementary Table

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Tian, J., Deng, W., Zhang, Z. et al. Discovery and remodeling of Vibrio natriegens as a microbial platform for efficient formic acid biorefinery. Nat Commun 14, 7758 (2023). https://doi.org/10.1038/s41467-023-43631-2

Download citation

Received: 16 May 2023
Accepted: 15 November 2023
Published: 27 November 2023
DOI: https://doi.org/10.1038/s41467-023-43631-2

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.