Mitochondrial matrix protein LETMD1 maintains thermogenic capacity of brown adipose tissue in male mice

Park, Anna; Kim, Kwang-eun; Park, Isaac; Lee, Sang Heon; Park, Kun-Young; Jung, Minkyo; Li, Xiaoxu; Sleiman, Maroun Bou; Lee, Su Jeong; Kim, Dae-Soo; Kim, Jaehoon; Lim, Dae-Sik; Woo, Eui-Jeon; Lee, Eun Woo; Han, Baek Soo; Oh, Kyoung-Jin; Lee, Sang Chul; Auwerx, Johan; Mun, Ji Young; Rhee, Hyun-Woo; Kim, Won Kon; Bae, Kwang-Hee; Suh, Jae Myoung

doi:10.1038/s41467-023-39106-z

Download PDF

Article
Open access
Published: 23 June 2023

Mitochondrial matrix protein LETMD1 maintains thermogenic capacity of brown adipose tissue in male mice

Nature Communications volume 14, Article number: 3746 (2023) Cite this article

5822 Accesses
3 Citations
14 Altmetric
Metrics details

Subjects

Abstract

Brown adipose tissue (BAT) has abundant mitochondria with the unique capability of generating heat via uncoupled respiration. Mitochondrial uncoupling protein 1 (UCP1) is activated in BAT during cold stress and dissipates mitochondrial proton motive force generated by the electron transport chain to generate heat. However, other mitochondrial factors required for brown adipocyte respiration and thermogenesis under cold stress are largely unknown. Here, we show LETM1 domain-containing protein 1 (LETMD1) is a BAT-enriched and cold-induced protein required for cold-stimulated respiration and thermogenesis of BAT. Proximity labeling studies reveal that LETMD1 is a mitochondrial matrix protein. Letmd1 knockout male mice display aberrant BAT mitochondria and fail to carry out adaptive thermogenesis under cold stress. Letmd1 knockout BAT is deficient in oxidative phosphorylation (OXPHOS) complex proteins and has impaired mitochondrial respiration. In addition, BAT-specific Letmd1 deficient mice exhibit phenotypes identical to those observed in Letmd1 knockout mice. Collectively, we demonstrate that the BAT-enriched mitochondrial matrix protein LETMD1 plays a tissue-autonomous role that is essential for BAT mitochondrial function and thermogenesis.

FAM210A is essential for cold-induced mitochondrial remodeling in brown adipocytes

Article Open access 10 October 2023

Nardilysin in adipocytes regulates UCP1 expression and body temperature homeostasis

Article Open access 02 March 2022

Cold-induction of afadin in brown fat supports its thermogenic capacity

Article Open access 07 May 2021

Introduction

Brown adipose tissue (BAT) differs from white adipose tissue (WAT) in that BAT is highly responsive to cold exposure for adaptive thermogenesis. BAT has abundant mitochondria that carry out its unique heat-generating function. Uncoupling protein 1 (UCP1), localized to the mitochondrial inner membrane of brown adipocytes, plays a major role in the thermogenic function of brown adipocytes. When BAT is activated by cold conditions, UCP1 dissipates proton (H⁺) motive force in the form of heat as a transporter of protons generated by the mitochondrial respiratory chain¹. In this respect, mitochondrial respiration in BAT has an essential role in regulating whole-body energy homeostasis through adaptive thermogenesis in cold stress.

BAT glucose uptake and mitochondrial oxidative activity are increased by cold exposure in rodents² and humans³. In activated BAT, a coordinated increase in aerobic energy metabolism and UCP1-mediated uncoupled respiration metabolize nutrients for heat production in non-shivering thermogenesis. BAT transplantation improves glucose tolerance and insulin resistance⁴, and counteracts obesity in mice⁵. Furthermore, in humans, BAT activation increases energy expenditure, reduces body fat mass, and improves whole-body glucose disposal and insulin sensitivity^6,7. Thus, therapeutic manipulation of BAT activity has emerged as a promising strategy for the treatment of obesity and metabolic disorders^8,9. To successfully implement this strategy, it is crucial to understand the molecular components that mediate the thermogenic function of BAT mitochondria induced by cold stimulus. However, aside from UCP1, other BAT mitochondrial factors required for uncoupled respiration and thermogenesis under cold stress are largely unknown.

In this study, we surveyed cold-inducible mitochondrial proteins in BAT and showed that LETM1 domain-containing protein 1 (LETMD1) is a BAT-enriched factor localized to the mitochondrial matrix of brown adipocytes. The Letmd1 gene was initially identified as an oncogene (HCCR1 or 2) associated with human cervical cancer and has been found to be highly expressed in various cancer cells, where it is linked to tumor suppressor function^{10,11,12,13,14}. Our analysis of Letmd1 knockout (KO) mice demonstrated that LETMD1 plays an essential role in cold-stimulated respiration and adaptive thermogenesis of BAT. Furthermore, LETMD1-deficient brown adipocytes exhibited dysmorphic mitochondrial ultrastructure and a significant reduction in OXPHOS complex protein levels. Elucidating the role of LETMD1 in BAT thermogenesis contributes to a deeper understanding of molecular mechanisms that enable the functional specialization of mitochondria in thermogenic BAT.

Results

Identification of cold-inducible mitochondrial proteins in BAT

To identify candidate genes involved in the thermogenic function of BAT mitochondria, we analyzed publicly available gene expression data for genes that are enriched in BAT, as compared to epididymal WAT (eWAT) (GSE92844)¹⁵, and induced by cold stimulus (GSE70437)¹⁶ (Supplementary Fig. 1a). From this analysis, we uncovered a cluster of 144 genes that were both enriched in BAT and induced by cold stimulation (Supplementary Fig. 1a). Among these 144 genes, a subgroup of 31 genes were annotated as mitochondrial genes including Ucp1 (Supplementary Figs. 1b and 2).

Mitochondrial gene transcript levels and protein levels are frequently discordant, so we performed a complementary analysis with proteomics data¹⁷. By analyzing the intersection of proteins that are BAT-enriched proteins and also induced by cold, we identified 26 mitochondrial proteins that showed concordant expression at the transcript level (Supplementary Figs. 1c and 2). After combining the results of the transcriptomic and proteomic analyses, three candidate genes, Ucp1, Letmd1, and Acsl5 were identified (Supplementary Fig. 1d). UCP1 is a well-established mitochondrial protein required for BAT thermogenesis and ACSL5 has also been reported as an important regulator of whole-body energy metabolism in previous studies¹⁸. However, in contrast to UCP1 and ACSL5, the role of LETMD1 in BAT has not been explored.

LETMD1 is a BAT-enriched protein that is induced by cold exposure

To begin to understand the role of LETMD1 in BAT, we examined Letmd1 gene expression during brown adipocyte differentiation in an immortalized brown preadipocyte (iBPA) cell culture model¹⁹. During iBPA differentiation into brown adipocytes, Letmd1 gene expression increased at both RNA and protein levels (Fig. 1a, b). In adult mice, LETMD1 protein was highly enriched in BAT relative to WAT and other tissues, including mitochondria-rich muscle, suggesting that tissue mitochondrial content is not a determinant of Letmd1 gene expression (Fig. 1c). We further investigated the temporal regulation of Letmd1 gene expression in mice and found that Letmd1 transcript and protein levels increased during the early postnatal period, when thermogenic demand is known to be high (Fig. 1d, e).

**Fig. 1: The *Letmd1* gene encodes a brown adipocyte-enriched and cold-inducible protein.**

We next compared Letmd1 gene expression in BAT from mice housed at thermoneutrality (30 °C), room temperature (23 °C), or cold (6 °C) conditions and observed an inverse relationship between Letmd1 gene expression and ambient temperature (Fig. 1f, g). To further investigate the regulation of LETMD1 expression, we intraperitoneally injected mice with CL316,243, a selective β3-adrenoreceptor agonist, and found that LETMD1 protein levels increased in the BAT of CL316,243-treated mice compared to controls (Supplementary Fig. 3). Notably, when cold-exposed mice were re-acclimated to room temperature (Fig. 1h, i), cold-induced expression of Letmd1 mRNA in BAT reverted to room temperature levels (Fig. 1j), a pattern also seen for the expression of Ucp1 mRNA (Fig. 1k). Taken together, LETMD1 is enriched in mature brown adipocytes and exhibits dynamic regulation as a function of external cues determining the physiological demand for BAT thermogenesis.

LETMD1 is a mitochondrial matrix protein

Next, we investigated the subcellular localization of LETMD1 protein in brown adipocytes. Sequence analysis with MitoFates²⁰ predicted a putative mitochondrial targeting sequence (MTS) (1-28aa) and a cleavage site by mitochondrial processing peptidases (MPP) (Fig. 2a). In agreement with sequence analysis, immunofluorescence imaging of LETMD1 overexpressing iBPA cells displayed a mitochondrial pattern of localization (Fig. 2b).

**Fig. 2: LETMD1 protein is localized to the mitochondrial matrix.**

To gain more information on the domain structure and cellular localization of LETMD1 protein, we analyzed the activity of a series of APEX2 fusion expression constructs. APEX2 is an engineered peroxidase whose subcellular localization is visualized by electron microscopy (EM) of staining patterns generated by peroxidase activity²¹. High-resolution details offered by EM analysis of APEX2 staining patterns have been successful in determining mitochondrial compartment-specific localization and protein domain topology^22,23,24,25 (Fig. 2c). EM imaging of HEK293 cells transfected with Letmd1-APEX2 (C-terminus APEX fusion) and APEX2-Letmd1 (N-terminus fusion) expression constructs both showed matrix staining patterns indicating that the N-terminus and C-terminus of LETMD1 are exposed to the matrix (Fig. 2d). While we observed a typical mitochondrial matrix pattern of peroxidase staining in cells expressing MTS-APEX2, APEX2 with an N-terminus MTS, cells expressing the Letmd1-APEX2 construct lacking the predicted MTS (1-28aa) abolished mitochondrial localization demonstrating the functionality of the LETMD1 MTS (Fig. 2d).

To further investigate the topological configuration of the LETMD1 protein, we performed TMHMM analysis²⁶ which revealed two putative transmembrane domains (82-97aa and 139-161aa) within LETMD1 (Fig. 2e). To experimentally confirm the presence of these predicted transmembrane domains for LETMD1 within the context of a living cell, we analyzed three additional LETMD1-APEX fusion proteins in which APEX was positioned internally at different sites (F79, L115, P148) within LETMD1 (Fig. 2f). Contrary to the predictions from TMHMM analysis, all three internal LETMD1-APEX fusion proteins showed a matrix pattern by EM analysis (Fig. 2g). In another approach, we tested whether LETMD1 protein can be labeled by APEX2 localized to compartments of the mitochondria other than the matrix. APEX2 was expressed in the matrix, intermembrane space (IMS), outer membrane of mitochondria (OMM) compartments and the co-expressed LETMD1-Flag protein was tested for proximity labeling by each mitochondrial compartment-specific APEX. The results showed that the LETMD1-Flag protein was labeled by matrix-APEX but not by OMM-APEX or IMS-APEX (Fig. 2h). Taken together, these results strongly suggest that endogenous LETMD1 protein is a soluble protein residing in the matrix compartment of mitochondria and does not possess a transmembrane domain in its native folded state.

LETMD1 is required for adaptive thermogenesis

To study the in vivo function of LETMD1, we generated Letmd1 knockout (KO) mice that are homozygous for a Letmd1 null allele. Compared to control mice, Letmd1 KO mice had increased body weight (Fig. 3a) in the absence of significant changes in food intake or physical activity (Fig. 3b, c). Gross examination of Letmd1 KO BAT revealed a striking whitened appearance and histological analysis revealed dramatically enlarged lipid droplets in Letmd1 KO BAT compared to littermate controls (Fig. 3d). Furthermore, the expression of Ucp1 and thermogenic genes was markedly reduced in Letmd1 KO BAT from adult mice (Fig. 3e, f). This reduction in UCP1 protein levels in Letmd1 KO BAT was observed immediately after birth and persisted through the perinatal period, when thermogenic demand first emerges (Fig. 3g). These observations led us to examine whether the thermogenic function of BAT is altered in Letmd1 KO mice. Indeed, we found that Letmd1 KO mice failed to maintain core body temperature during a cold challenge, indicating a defect in adaptive thermogenesis (Fig. 3h). Infrared imaging of Letmd1 KO mice further confirmed the inability of Letmd1 KO mice to activate BAT thermogenesis and maintain body temperature during a cold challenge (Fig. 3i). Although LETMD1 protein was induced in BAT during perinatal stages when thermogenic BAT is highly active, we did not observe any effect on neonatal survival rates due to LETMD1 deficiency under standard housing conditions (Supplementary Fig. 4).

**Fig. 3: LETMD1 is necessary for adaptive thermogenesis.**

To further characterize physiological alterations in Letmd1 KO mice, we performed indirect calorimetry of control and Letmd1 KO mice during a cold challenge. At 25 °C, we did not observe any difference in oxygen consumption (VO₂) and carbon dioxide production (VCO₂) between the groups. However, although both wild-type and Letmd1 KO mice initially increased VO₂ and VCO₂ in response to a cold challenge, Letmd1 KO mice failed to sustain elevated levels of VO₂ and VCO₂ which is necessary for a prolonged thermogenic response (Fig. 3j, k). This impaired response to cold stress in Letmd1 KO mice was accompanied by a failure to upregulate UCP1 protein in BAT tissue (Fig. 3l). These results demonstrate an obligate in vivo requirement for LETMD1 function in the adaptive thermogenic response of BAT upon a cold challenge.

LETMD1 is essential for BAT mitochondrial integrity and function

To investigate the molecular role of LETMD1 in brown adipocyte function and adaptive thermogenesis, we performed RNA-seq analysis of Letmd1 KO and wild-type BAT. Gene ontology (GO) analysis of transcriptome changes revealed down-regulation of a broad array of genes involved in processes that occur in the mitochondrial matrix compartment in Letmd1 KO BAT (Fig. 4a). At the ultrastructural level, Letmd1 KO BAT contained dysmorphic mitochondria with sparse distended cristae, a principal site of OXPHOS complex (Fig. 4b). These data led us to directly examine OXPHOS complex components and functions in Letmd1 KO BAT. At embryonic day 16.5, when thermogenic demand is absent, BAT OXPHOS complex proteins were unaffected by LETMD1 deficiency (Fig. 4c). However, during the early postnatal period, control BAT upregulated OXPHOS complex proteins in response to thermogenic demand but Letmd1 KO BAT failed to upregulate OXPHOS proteins during this critical period for BAT thermogenesis (Fig. 4d). The defective OXPHOS protein expression in Letmd1 KO BAT was further exacerbated in adult stages and showed a near complete loss of complex I and IV proteins (Fig. 4e).

**Fig. 4: LETMD1 supports mitochondrial respiration of stimulated brown adipocytes.**

To examine the functional consequence of OXPHOS complex deficiency in Letmd1 KO BAT, we measured respiratory function in scrambled control (SCR) and Letmd1 knockdown brown adipocytes (shLetmd1) in the presence or absence of forskolin stimulation. We found that there were no significant differences in basal respiration between control (SCR) and shLetmd1 brown adipocytes in the unstimulated state (Fig. 4f, g). However, upon forskolin (FSK) stimulation, we observed a dramatic reduction in both basal and maximal respiration of shLetmd1 cells, in contrast to control (SCR) cells (Fig. 4f, g). In forskolin-stimulated conditions, the proton leak of Letmd1 knockdown cells was also significantly reduced, indicating that Letmd1 knockdown leads to impaired UCP1 activity (Fig. 4g). Analysis of OXPHOS and UCP1 expression in Letmd1 knockdown cells showed a slight decrease in OXPHOS complex I and IV, as well as UCP1 protein levels (Fig. 4h). Additional experiments showed that Letmd1 knockdown impairs mitochondrial respiration and thermogenesis in brown adipocytes stimulated by isoproterenol (Supplementary Fig. 5a, b). Conversely, Ucp1 knockdown had no effect on either Letmd1 mRNA or protein expression levels but did result in decreased expression of OXPHOS components (Supplementary Fig. 6). These findings suggest that LETMD1 functions upstream of UCP1 in regulating mitochondrial function in brown adipocytes. Taken together, these results demonstrate the crucial role of LETMD1 in supporting brown adipocyte OXPHOS function in a stimulation-dependent manner.

LETMD1 functions in a BAT-autonomous manner

We next examined whether the structural and functional defects observed in Letmd1 KO mice were specific to BAT. To this end, we analyzed mitochondrial ultrastructure in metabolic tissues with high mitochondrial content such as heart and soleus muscle, and found no significant differences between Letmd1 KO and control (Fig. 5a, b). We also quantified OXPHOS complex proteins in metabolic tissues including iWAT, eWAT, liver, and muscle tissue lysates by western blot. In contrast to the reduced OXPHOS complex levels observed in BAT, the results show that other Letmd1 KO tissues have normal levels of OXPHOS complex expression (Fig. 5c–f). To thoroughly investigate the specific requirements of LETMD1 in BAT, we generated mice with a Letmd1 conditional knockout allele and crossed them with Ucp1-Cre mice to obtain Ucp1-Cre; Letmd1^flox/flox (Letmd1 BKO) (Fig. 6a), which were confirmed to have BAT-specific deletion of Letmd1 (Fig. 6b, c). Similar to Letmd1 KO BAT, gross examination of BAT from Letmd1 BKO BAT showed a whitened appearance (Fig. 6d) and histological analysis of BAT showed brown adipocytes with enlarged lipid droplets (Fig. 6e). There were no differences in body weight (Fig. 6f), fat and liver tissue weights (Fig. 6g), fat mass/lean mass ratios (Fig. 6h), and fasting blood glucose (Fig. 6i) between Letmd1 BKO and control mice. However, the key molecular phenotypes observed in Letmd1 KO mice such as mRNA expression of BAT thermogenic genes (Fig. 6j) and reduced expression of OXPHOS complex proteins and UCP1 (Fig. 6k) were recapitulated in Letmd1 BKO mice. These results strongly support the notion that LETMD1 plays a tissue-autonomous role that is specific to BAT mitochondria function and thermogenesis.

**Fig. 5: LETMD1 deficiency does not affect mitochondrial ultrastructure or OXPHOS complex expression in tissues other than BAT.**

**Fig. 6: Mice with BAT-specific deletion of *Letmd1* have abnormal brown fat and reduced OXPHOS complex expression similar to *Letmd1* KO mice.**

Discussion

Adaptive thermogenesis of BAT is critical for defending against cold stress and maintaining body temperature in mammals. A mitochondrial protein, UCP1, plays a key role in this process by uncoupling ATP production from the proton motive force generated by OXPHOS complex. However, additional mitochondrial factors required for BAT thermogenesis are largely unknown. In this study, we uncover an essential role for the BAT-enriched protein LETMD1 in mitochondrial respiration and adaptive thermogenesis.

LETMD1 is annotated as a mitochondrial protein in MitoCarta 1.0²⁷, MitoCarta 2.0²⁸ and MitoCarta 3.0²⁹. Furthermore, LETMD1 was categorized as one of the mitochondrial uncharacterized proteins (MXPs) in humans³⁰ but its specific molecular and physiological function in BAT has not been explored. Here, we demonstrate that LETMD1 has critical functions in regulating mitochondrial which is essential for maintaining BAT activation during adaptive thermogenesis.

Our proximity labeling enzyme-assisted topology studies demonstrate that LETMD1 is a mitochondrial matrix protein, which contradicts a previous study suggesting LETMD1 protein as an outer mitochondrial membrane protein³¹ (Q924L1, UniProt). In our experiments, LETMD1 proteins fused with APEX revealed that LETMD1 protein lacks transmembrane domains, and N and C termini are exposed to the mitochondrial matrix (Fig. 2). In Letmd1 knockdown iBPA brown adipocytes, LETMD1-APEX2 fusion protein restored UCP1 expression functionally like LETMD1 protein (Supplementary Fig. 7). While APEX insertion is unlikely to cause misfolding, it cannot be completely excluded. Despite these concerns, Letmd1-APEX proteins with APEX insertion demonstrate both catalytic activity and matrix-targeted localization, suggesting that both Letmd1 and APEX are properly folded in the Letmd1-APEX fusion protein (Fig. 2g).

Our results also reveal significant differences in topology between LETMD1 protein and the related LETM1. Unlike LETM1, which is reported to have two transmembrane domains and both termini are in the mitochondrial matrix²⁵, our results indicate that LETMD1 has a fully matrix-localized topology that suggests its role in mitochondrial function may differ from that claimed for LETM1. Despite these differences, LETMD1 and LETM1 function show similarities as LETM1 regulates mitochondrial swelling³², assembly of the respiratory chains³³, and cristae organization³⁴. Several studies have reported that LETM1 (SLC55A1) functions as a K⁺/H⁺ exchanger (KHE)^35,36,37 or Ca²⁺/H⁺ antiporter (CHE)^38,39,40,41. However, it is important to note that the proposed topology of these LETM1 and LETMD1 were derived from different analyses, and additional investigations will be required to comprehensively evaluate the functional and mechanistic differences between these two proteins.

The mitochondrial matrix is the key locale for coordinating the activity of the OXPHOS complex and UCP1 protein-mediated uncoupling, which together maintain the thermogenic program of brown adipocytes. We observed a slight decrease in OXPHOS complex I and IV associated with Letmd1 knockdown in cultured brown adipocytes (Fig. 4h), but this difference was not as pronounced as what was seen in the adult BAT of Letmd1 KO mice (Fig. 4e). These results suggest that the severely impaired OCR response in brown adipocytes by Letmd1 knockdown under forskolin or isoproterenol-treated conditions cannot be fully explained by decreased expression of OXPHOS complex proteins. Nevertheless, we consistently observed pronounced reduction of OXPHOS complex I and IV protein in Letmd1 KO BAT which would contribute to impaired BAT thermogenesis upon acute cold challenge (Fig. 3h, j). The reason for the difference between the effects of LETMD1 deficiency on OXPHOS complex protein levels in in vivo BAT versus in vitro brown adipocytes is an important topic for future research.

A notable observation from previous studies is that Ucp1 KO mice exhibit a marked decrease in OXPHOS complex expression, indicating a unique interdependence between UCP1 protein and OXPHOS function in BAT⁴². In the setting of UCP1 deficiency, cold-induced activation of BAT metabolism leads to a ~ 95% decrease in OXPHOS complex I and IV subunits. The study also demonstrates that environmental cold stimulus, rather than innate abnormalities in BAT development, is responsible for the diminished expression of electron transport chain components in Ucp1 KO mice⁴², which parallels the phenotype we observed in the BAT of Letmd1 KO mice (Figs. 3 and 4). In our study, we have demonstrated that UCP1 protein levels decrease in the BAT of Letmd1 KO mice and Letmd1 knockdown brown adipocytes (Fig. 3g and 4h), while a global proteomics analysis by Spiegelman and colleagues indicates that Ucp1 KO has no effect on LETMD1 protein levels⁴². Interestingly, we also found that Ucp1 knockdown in differentiated iBPA brown adipocytes had no effect on LETMD1 expression, but did lead to decreased OXPHOS protein levels (Supplementary Fig. 6). These results provide strong evidence that LETMD1 acts upstream of UCP1, although the precise mechanism through which LETMD1 regulates UCP1 expression remains unclear and warrants further investigation. However, we propose that the decrease in OXPHOS complex levels, particularly complex I and IV, in Letmd1 KO BAT is likely due to the downregulation of UCP1. Furthermore, we find that the observed effect of LETMD1 deficiency on OXPHOS complex levels is specific to BAT (Figs. 4 and 5), thereby highlighting a BAT-specific and BAT-autonomous role for LETMD1 in mitochondrial OXPHOS and uncoupled respiration. Finally, our demonstration that mice with a BAT-specific deletion of Letmd1 exhibit phenotypes identical to those observed in whole-body Letmd1 KO mice provides additional evidence for the BAT-autonomous requirement of LETMD1 (Fig. 6).

Increasing the activity of BAT in humans has emerged as a promising strategy to prevent obesity and metabolic disorders by enhancing energy expenditure^8,9. Consequently, the identification of novel molecular regulators of mitochondrial metabolism and BAT thermogenesis presents a significant opportunity for preventive and therapeutic interventions for obesity^43,44. In this context, we have demonstrated that LETMD1, a mitochondrial matrix protein that is specifically enriched in BAT and dynamically regulated in response to thermogenic stimuli, is a crucial component required for thermogenic BAT function. Moreover, analysis using our Gene-Module Association Determination (G-MAD)⁴⁵ approach reveals that LETMD1 is strongly associated with mitochondrial function in both mouse and human adipose tissues (Supplementary Fig. 8). These findings provide further support for the role of LETMD1 in regulating mitochondrial metabolism and BAT thermogenesis and highlight its potential as a therapeutic target for the treatment of obesity and metabolic diseases.

During the process of revising our manuscript, we came across several recently published reports that have also investigated the role of LETMD1 in BAT function^46,47,48,49. While these studies consistently demonstrated the upregulation of LETMD1 in response to cold stimulation and impaired thermogenic function in Letmd1 KO mice, each report describes distinct aspects of LETMD1 function. For instance, Choi et al.⁴⁶ demonstrated an interaction between LETMD1 and Brg1 in the nucleus, suggesting a potential link to transcriptional regulation of BAT thermogenesis. Snyder et al.⁴⁷ demonstrated that LETMD1 is essential for BAT structure and OXPHOS expression, even under thermoneutral conditions. Song et al.⁴⁸ observed perturbations in mitochondrial calcium homeostasis in brown adipocytes lacking LETMD1, while Xiao et al.⁴⁹ reported the localization of LETMD1 to the mitochondrial inner membrane. In contrast, our study provides conclusive evidence that LETMD1 functions autonomously within brown adipocytes, as demonstrated by the phenotype of brown adipocyte-specific Letmd1 KO mice. Moreover, our results show that LETMD1 is a mitochondrial matrix protein using proximity labeling techniques, providing a more accurate representation of LETMD1 protein topology in a live cell. Our findings complement and converge upon the growing body of literature underscoring the critical role of LETMD1 and its function in BAT thermogenesis.

Methods

Ethics statement

All animal studies were performed in compliance with the institutional guidelines of the Korean Research Institute of Biotechnology and Bioscience, and all mouse experiments were approved and performed under institutional guidelines.

Animal experiments

The ES cell clone 84278, which was generated by the International Knockout Mouse Consortium (IKMC) and contains a knockout-first allele of the Letmd1 gene, was purchased from The European Conditional Mouse Mutagenesis Program (EUCOMM). The Letmd1 knockout-first targeting vector contains a lacZ and a neomycin resistance gene cassette that is flanked by Flp recombinase target (FRT) sequences. This cassette was inserted into an intron between exon 2 and exon 3 of Letmd1 gene to disrupt endogenous LETMD1 expression. Exon 3 and exon 4 of Letmd1 gene are also flanked by loxP sites and there is a loxP site between the lacZ and neomycin resistance gene. Letmd1 heterozygous null mice (Letmd1 +/−) were obtained by microinjection of this ES cell clone into C57BL6/N mice (Macrogen). To generate Letmd1 conditional knockout mice that harbor a Letmd1 floxed allele, we bred mice with the Letmd1 knockout-first allele with ACTB-Flpe mice (JAX 003800). Mice containing the Letmd1 floxed allele were further bred to Ucp1-Cre mice (JAX 024670) to generate mice with BAT-specific deletion of the Letmd1 gene (Ucp1-Cre; Letmd^flox/flox). Unless otherwise specified, all experiments involving mice were conducted using male mice between 12 and 17 weeks of age. Mice were maintained in a specific pathogen-free animal facility under institutional guidelines of the Korean Research Institute of Biotechnology and Bioscience.

Cell culture, adipogenic differentiation, and Oil-Red-O staining

An immortalized brown preadipocyte (iBPA) cell line was kindly provided by Dr. Shingo Kajimura (UCSF, San Francisco, CA, USA) and grown in high glucose Dulbecco’s modified Eagle medium (DMEM, Gibco) containing 10% fetal bovine serum (Gibco) and 1% antibiotics at 37 °C in a humidified atmosphere with 5% CO₂. For brown adipocyte differentiation, cells were induced as previously described¹⁹. In brief, cells were cultured to confluence (day 0) in a maintenance medium containing 10% FBS, and 1% antibiotics, and then induced to differentiate in a differentiation medium (DMEM containing 10% FBS) supplemented with 0.5 mM isobutylmethylxanthine (IBMX, Sigma I5879), 0.5 µM dexamethasone (Sigma D1756), 20 nM insulin (Santa cruz sc-360248), 1 nM 3,3′,5-Triiodo-L-thyronine (T3, Sigma T2877), and 125 µM indomethacin (Sigma I7378) for 2 days, after which (day 2) the cells were further induced to differentiate and maturate for 4 days in the growth medium composed of DMEM,10% FBS, 20 nM insulin and 1 nM T3.

Generation of stable overexpression or knockdown cell lines

To construct iBPA cells stably expressing FLAG-tagged mouse LETMD1, a retroviral infection system was used. For LETMD1 expression, DNA encoding the FLAG-tagged Letmd1 was inserted into the pRetroX-IRES-ZsGreen1 vector (Clontech Laboratories, Mountain View, CA, USA). For virus production, GP2-293 packaging cells (Clontech, 631458) were transfected using TransIT®-LT1 Transfection Reagent (Mirus, MIR2300), and infected cells were selected using a FACSAria cell sorter (BD Biosciences) and maintained in high glucose Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum (Gibco). To knockdown endogenous LETMD1 expression, we used a retrovirus-mediated shRNA system. Short-hairpin shRNAs were designed by selecting a target sequence for the mouse Letmd1 gene according to Knockout RNAi systems user manual (Clontech). The shRNA against Letmd1 was inserted into the multi-cloning site of the pSIREN-RetroQ-DsRed vector (Clontech). The following shRNA sequences targeting the coding region of Letmd1 mRNA were used to knockdown Letmd1 expression: 5ʹ- GATCCGCAACTGCTAGTCAAGCATTTCAAGAGAATGCTTGACTAGCAGTTGCTTTTTTG-3ʹ and 5ʹ- AATTCAAAAAAGCAACTGCTAGTCAAGCATTCTCTTGAAATGCTTGACTAGCAGTTGCG-3ʹ. Control shRNA (scrambled) vector was provided by Clontech.

Indirect calorimetry

For indirect calorimetry studies, mice were housed individually in metabolic cages (CLAMS12, Columbus Instruments) with ad libitum access to food and water. Oxygen consumption rates and carbon dioxide production rates were measured for 48 h. The activity was monitored simultaneously with metabolic measurements.

Core body temperature measurement and Infrared camera imaging

For measuring core temperature of cold exposed mice, mice were exposed to 8 °C in slow-temperature chamber (DHIN02-0034, DBL) and core body temperature was monitored using a rectal thermometer (Testo 925, Testo). The surface temperature of mice was measured with an infrared camera (Fortric 228, Fortric precision instruments) and analyzed with AnalyzIR (Fortric precision instruments) software.

Histology analysis

Mouse tissues were fixed in 10% neutral buffered formalin (Sigma, HT501128) for 24 h and embedded in paraffin by an automated tissue processor (Leica, TP1020). In total, 4 μm-thick tissue sections were obtained, deparaffinized, rehydrated, and stained with hematoxylin and eosin.

Extracellular flux assays

Oxygen consumption rate (OCR) was measured using the XFe96 extracellular flux analyzer (Seahorse Bioscience). On the day before the experiment, the sensor cartridge was placed into the calibration buffer (Seahorse Bioscience) and incubated at 37 °C in a non-CO₂ incubator. Prior to measurement, cells were equilibrated in an assay medium containing 25 mM D-glucose, 4 mM L-glutamine, and 1 mM sodium pyruvate for 1 h. To measure OCR by mitochondrial respiration, cells were treated sequentially with 2.5 µM oligomycin, 5 µM Carbonyl cyanide m-chlorophenyl hydrazone (CCCP), and 2 µM rotenone/5 µM antimycin A. OCR was measured 4 h after 10 µM forskolin or 1 h after 1 µM isoproterenol treatment. At the end of each assay, cells were lysed with ice-cold RIPA buffer, and the protein contents were measured by Bradford assay. The OCR values were normalized to the protein levels of each well. The data were analyzed using Wave 2.6.1 software (Agilent).

RNA sequencing

Total RNA was isolated using Trizol reagent (Invitrogen). RNA quality was assessed by Agilent 2100 bioanalyzer using the RNA 6000 Nano Chip (Agilent Technologies, Amstelveen, The Netherlands), and RNA quantification was performed using ND-2000 Spectrophotometer (Thermo Inc., DE, USA). For control and test RNAs, the construction of library was performed using QuantSeq 3ʹ mRNA-Seq Library Prep Kit (Lexogen, Inc., Austria) according to the manufacturer’s instructions. In brief, each 500 ng total RNA were prepared and an oligo-dT primer containing an Illumina-compatible sequence at its 5ʹ end was hybridized to the RNA and reverse transcription was performed. After degradation of the RNA template, second strand synthesis was initiated by a random primer containing an Illumina-compatible linker sequence at its 5ʹ end. The double-stranded library was purified by using magnetic beads to remove all reaction components. The library was amplified to add the complete adapter sequences required for cluster generation. The finished library is purified from PCR components. High-throughput sequencing was performed as single-end 75 sequencing using NextSeq 500 (Illumina, Inc., USA). QuantSeq 3ʹ mRNA-Seq reads were aligned using Bowtie2⁵⁰. Bowtie2 indices were either generated from genome assembly sequence or the representative transcript sequences for aligning to the genome and transcriptome. The alignment file was used for assembling transcripts, estimating their abundances and detecting differential expression of genes. Differentially expressed gene were determined based on counts from unique and multiple alignments using coverage in Bedtools⁵¹. The RC (Read Count) data were processed based on quantile normalization method using EdgeR within R⁵² using Bioconductor⁵³. Gene classification was based on searches done by DAVID (http://david.abcc.ncifcrf.gov/) and Medline databases (http://www.ncbi.nlm.nih.gov/). Data mining and graphic visualization were performed using ExDEGA (Ebiogen Inc., Korea).

Biotin-phenol labeling in live cells

APEX2-fusion expression vectors were introduced into HEK 293 T (CRL-3216, ATCC), or iBPA cells for biotin-phenol labeling experiments. Viral expression of either the LETMD1-APEX fusion protein or the wild-type LETMD1 protein in 3ʹ UTR-targeted Letmd1 shRNA knockdown iBPA cells restored Ucp1 expression to a similar extent, indicating that LETMD1-APEX fusion protein retains the functional properties of the wild-type LETMD1 protein (Supplementary Fig. 7). To prepare iBPA cells for biotin-phenol labeling, we introduced APEX2-fusion expression constructs to iBPA cells through electroporation and induced their differentiation into brown adipocytes. At day 6 of differentiation, the culture medium was replaced with fresh growth medium containing 500 µM desthiobiotin-phenol (DBP), followed by incubation at 37 °C under CO₂ for 30 min. The cells were then treated with 1 mM H₂O₂ and gently agitated for 1 min at room temperature. To terminate the reaction, the cells were washed thrice with ice-cold DPBS containing 5 mM trolox, 10 mM sodium ascorbate, and 10 mM sodium azide. Subsequently, the cells were lysed for western blot analysis or fixed for imaging analysis. We performed western blot analysis, fluorescence microscope imaging, and transmission electron microscope (TEM) imaging of DBP-labeled cells as described previously^54,55.

Western blot analysis

Homogenized tissue or cells were lysed with ice-cold RIPA buffer (Pierce, 89900) containing 1X protease inhibitor cocktail (GenDEPOT, P3100) and incubated at 4 °C for 30 min. After centrifugation at 15,000 × g for 15 min, the supernatant was moved to a new tube. Protein concentrations were measured using the Bradford assay (Bio-Rad, 5000001). Protein samples were directly analyzed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with SDS sample buffer (60 mM Tris-Cl (pH 6.8), 10% sodium lauryl sulfate, 25% glycerol, 100 mM dithiothreitol, 0.04% Bromophenol blue) without boiling. Western blot analysis was performed according to standard methods. Antibodies used in immunoblot analyses included those against LETMD1 (LSBio, LS-C384640, 1:1000); UCP1 (Abcam, ab10983, 1:1000); HSP90 (Santa Cruz, sc-7947, 1:2000); α-Tubulin (Sigma-Aldrich, sc-8035, 1:3000); OXPHOS cocktail (Abcam, ab110413, 1:1000); Streptavidin-HRP (Thermo Scientific, S911, 1:3000); and Flag (Sigma-Aldrich, F3165, 1:3000). The specific signals were amplified by horseradish peroxidase-conjugated secondary anti-rabbit or anti-mouse antibody (Santa Cruz, 1:3000).

mRNA expression analysis by qRT-PCR

Total RNA was extracted from tissue or cultured cells using TRIzol Reagent (Invitrogen, 15596026) according to manufacturer instructions, and first-strand cDNA was synthesized from total RNA using the reverse transcriptase M-MLV (Promega, M1701) and a random primer (Promega, C1181) according to manufacturer protocols. Real-time PCR was performed using 2X Real-time PCR Smart mix kit (SolGent, SRH91-R500) according to the manufacturer protocols. The data were analyzed using CFX Maestro software 2.0 (Bio-Rad). Gene expression levels were normalized to 60 S ribosomal protein L32 (Rpl32). Primers used for qRT-PCR are listed in Supplementary Table 1.

Statistics and reproducibility

Statistical analysis was performed using Prism 8.4 software (GraphPad). All statistics are described in figure legends. In general, comparisons between two groups were performed using the two-tailed Student’s t test and multiple group comparisons were performed by one-way ANOVA followed by Tukey-Kramer post-hoc test. Data are expressed as mean ± standard error of the mean (SEM). Results with P values less than 0.05 were considered statistically significant.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

We analyzed publicly available gene expression data for genes that are enriched in BAT, as compared to epididymal WAT (eWAT) (GSE92844) and induced by cold stimulus (GSE70437). RNA sequencing data are deposited in Gene Expression Omnibus (GEO) under accession number GSE232223. The source data for this study are provided with this paper. Source data are provided with this paper.

References

Klingenberg, M. Mechanism and evolution of the uncoupling protein of brown adipose tissue. Trends Biochem. Sci. 15, 108–112 (1990).
Article CAS PubMed Google Scholar
Labbé, S. M. et al. In vivo measurement of energy substrate contribution to cold‐induced brown adipose tissue thermogenesis. FASEB J. 29, 2046–2058 (2015).
Article PubMed Google Scholar
Blondin, D. P. et al. Increased brown adipose tissue oxidative capacity in cold-acclimated humans. J. Clin. Endocrinol. Metab. 99, E438–E446 (2014).
Article CAS PubMed PubMed Central Google Scholar
Stanford, K. I. et al. Brown adipose tissue regulates glucose homeostasis and insulin sensitivity. J. Clin. Invest. 123, 215–223 (2013).
Article CAS PubMed Google Scholar
Liu, X. et al. Brown adipose tissue transplantation reverses obesity in Ob/Ob mice. Endocrinology 156, 2461–2469 (2015).
Article CAS PubMed Google Scholar
Yoneshiro, T. et al. Recruited brown adipose tissue as an antiobesity agent in humans. J. Clin. Invest. 123, 3404–3408 (2013).
Article CAS PubMed PubMed Central Google Scholar
Chondronikola, M. et al. Brown adipose tissue improves whole-body glucose homeostasis and insulin sensitivity in humans. Diabetes 63, 4089–4099 (2014).
Article CAS PubMed PubMed Central Google Scholar
Chechi, K., Nedergaard, J. & Richard, D. Brown adipose tissue as an anti‐obesity tissue in humans. Obes. Rev. 15, 92–106 (2014).
Article CAS PubMed Google Scholar
Saito, M. Human brown adipose tissue: regulation and anti-obesity potential. Endocr. J. 61, 409–416 (2014).
Article CAS PubMed Google Scholar
Ko, J. et al. Identification and differential expression of novel human cervical cancer oncogene HCCR-2 in human cancers and its involvement in p53 stabilization. Oncogene 22, 4679–4689 (2003).
Article CAS PubMed Google Scholar
Xu, Z. et al. Epidermal growth factor induces HCCR expression via PI3K/Akt/mTOR signaling in PANC-1 pancreatic cancer cells. BMC Cancer 10, 161 (2010).
Article PubMed PubMed Central Google Scholar
Meng, K. et al. Human cervical cancer oncogene-1 over expression in colon cancer and its clinical significance. Int. J. Clin. Exp. Med. 8, 939–943 (2015).
PubMed PubMed Central Google Scholar
Ha, S. A. et al. Oncoprotein HCCR-1 expression in breast cancer is well correlated with known breast cancer prognostic factors including the HER2 overexpression, p53 mutation, and ER/PR status. BMC Cancer 9, 51 (2009).
Article PubMed PubMed Central Google Scholar
Zhu, L. F. et al. HCCR-1 is a novel prognostic indicator for gastric cancer and promotes cell proliferation. J. Cancer 10, 3533–3542 (2019).
Article CAS PubMed PubMed Central Google Scholar
Mo, Q. et al. Identification and characterization of a supraclavicular brown adipose tissue in mice. JCI Insight 2, e93166 (2017).
Article PubMed PubMed Central Google Scholar
Marcher, A. B. et al. RNA-seq and mass-spectrometry-based lipidomics reveal extensive changes of glycerolipid pathways in brown adipose tissue in response to cold. Cell Rep. 13, 2000–2013 (2015).
Article CAS PubMed Google Scholar
Forner, F. et al. Proteome differences between brown and white fat mitochondria reveal specialized metabolic functions. Cell Metab. 10, 324–335 (2009).
Article CAS PubMed Google Scholar
Bowman, T. A. et al. Acyl CoA synthetase 5 (ACSL5) ablation in mice increases energy expenditure and insulin sensitivity and delays fat absorption. Mol. Metab. 5, 210–220 (2016).
Article CAS PubMed PubMed Central Google Scholar
Uldry, M. et al. Complementary action of the PGC-1 coactivators in mitochondrial biogenesis and brown fat differentiation. Cell Metab. 3, 333–341 (2006).
Article CAS PubMed Google Scholar
Fukasawa, Y. et al. MitoFates: improved prediction of mitochondrial targeting sequences and their cleavage sites. Mol. Cell. Proteom. 14, 1113–1126 (2015).
Article CAS Google Scholar
Martell, J. D. et al. Engineered ascorbate peroxidase as a genetically encoded reporter for electron microscopy. Nat. Biotechnol. 30, 1143–1148 (2012).
Article CAS PubMed PubMed Central Google Scholar
Rhee, H. W. et al. Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging. Science 339, 1328–1331 (2013).
Article ADS CAS PubMed PubMed Central Google Scholar
Hung, V. et al. Proteomic mapping of the human mitochondrial intermembrane space in live cells via ratiometric APEX tagging. Mol. Cell 55, 332–341 (2014).
Article CAS PubMed PubMed Central Google Scholar
Hung, V. et al. Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation. Elife 6, e24463 (2017).
Article PubMed PubMed Central Google Scholar
Lee, S. Y. et al. Architecture mapping of the inner mitochondrial membrane proteome by chemical tools in live cells. J. Am. Chem. Soc. 139, 3651–3662 (2017).
Article CAS PubMed Google Scholar
Krogh, A., Larsson, B., Von Heijne, G. & Sonnhammer, E. L. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305, 567–580 (2001).
Article CAS PubMed Google Scholar
Pagliarini, D. J. et al. A mitochondrial protein compendium elucidates complex I disease biology. Cell 134, 112–123 (2008).
Article CAS PubMed PubMed Central Google Scholar
Calvo, S. E., Clauser, K. R. & Mootha, V. K. MitoCarta2.0: an updated inventory of mammalian mitochondrial proteins. Nucleic Acids Res. 44, D1251–D1257 (2016).
Article CAS PubMed Google Scholar
Rath, S. et al. MitoCarta3.0: an updated mitochondrial proteome now with sub-organelle localization and pathway annotations. Nucleic Acids Res. 49, D1541–D1547 (2021).
Article CAS PubMed Google Scholar
Floyd, B. J. et al. Mitochondrial protein interaction mapping identifies regulators of respiratory chain function. Mol. Cell 63, 621–632 (2016).
Article CAS PubMed PubMed Central Google Scholar
Cho, G. W. et al. HCCR-1, a novel oncogene, encodes a mitochondrial outer membrane protein and suppresses the UVC-induced apoptosis. BMC Cell Biol. 8, 50 (2007).
Article PubMed PubMed Central Google Scholar
Hasegawa, A. & van der Bliek, A. M. Inverse correlation between expression of the Wolfs Hirschhorn candidate gene Letm1 and mitochondrial volume in C. elegans and in mammalian cells. Hum. Mol. Genet. 16, 2061–2071 (2007).
Article CAS PubMed Google Scholar
Tamai, S. et al. Characterization of the mitochondrial protein LETM1, which maintains the mitochondrial tubular shapes and interacts with the AAA-ATPase BCS1L. J. Cell. Sci. 121, 2588–2600 (2008).
Article CAS PubMed Google Scholar
Nakamura, S. et al. The mitochondrial inner membrane protein LETM1 modulates cristae organization through its LETM domain. Commun. Biol. 3, 99 (2020).
Article CAS PubMed PubMed Central Google Scholar
Nowikovsky, K. et al. The LETM1/YOL027 gene family encodes a factor of the mitochondrial K+ homeostasis with a potential role in the Wolf-Hirschhorn syndrome. J. Biol. Chem. 279, 30307–30315 (2004).
Article CAS PubMed Google Scholar
Froschauer, E. et al. Electroneutral K+/H+ exchange in mitochondrial membrane vesicles involves Yol027/Letm1 proteins. Biochim. Biophys. Acta 1711, 41–48 (2005).
Article CAS PubMed Google Scholar
Austin, S. et al. LETM1-mediated K+ and Na+ homeostasis regulates mitochondrial Ca2+ efflux. Front. Physiol. 8, 839 (2017).
Article PubMed PubMed Central Google Scholar
Jiang, D. et al. Genome-wide RNAi screen identifies Letm1 as a mitochondrial Ca2+/H+ antiporter. Science 326, 144–147 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Jiang, D. et al. Letm1, the mitochondrial Ca2+/H+ antiporter, is essential for normal glucose metabolism and alters brain function in Wolf–Hirschhorn syndrome. Proc. Natl. Acad. Sci. USA 110, E2249–E2254 (2013).
Article CAS PubMed PubMed Central Google Scholar
Doonan, P. J. et al. LETM1-dependent mitochondrial Ca2+ flux modulates cellular bioenergetics and proliferation. FASEB J. 28, 4936 (2014).
Article CAS PubMed PubMed Central Google Scholar
Shao, J. et al. Leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) forms a Ca 2+/H+ antiporter. Sci. Rep. 6, 34174 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Kazak, L. et al. UCP1 deficiency causes brown fat respiratory chain depletion and sensitizes mitochondria to calcium overload-induced dysfunction. Proc. Natl. Acad. Sci. USA 114, 7981–7986 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Kajimura, S. & Saito, M. A new era in brown adipose tissue biology: molecular control of brown fat development and energy homeostasis. Annu. Rev. Physiol. 76, 225–249 (2014).
Article CAS PubMed Google Scholar
Hussain, M. F. et al. Regulation of adipocyte thermogenesis: mechanisms controlling obesity. FEBS J. 287, 3370–3385 (2020).
Article CAS PubMed Google Scholar
Li, H. et al. Identifying gene function and module connections by the integration of multispecies expression compendia. Genome Res. 29, 2034–2045 (2019).
Article CAS PubMed PubMed Central Google Scholar
Choi, K. M. et al. Defective brown adipose tissue thermogenesis and impaired glucose metabolism in mice lacking Letmd1. Cell Rep. 37, 110104 (2021).
Article CAS PubMed Google Scholar
Snyder, M. M. et al. LETMD1 is required for mitochondrial structure and thermogenic function of brown adipocytes. FASEB J. 35, e21965 (2021).
Article CAS PubMed Google Scholar
Song, R. et al. Deletion of Letmd1 leads to the disruption of mitochondrial function in brown adipose tissue. Biochimie 201, 100–115 (2022).
Article CAS PubMed Google Scholar
Xiao, H. et al. Architecture of the outbred brown fat proteome defines regulators of metabolic physiology. Cell 185, 4654–4673 (2022).
Article CAS PubMed Google Scholar
Langmead, B. et al. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012).
Article CAS PubMed PubMed Central Google Scholar
Quinlan, A. R. et al. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).
Article CAS PubMed PubMed Central Google Scholar
Georges, N. T. et al. Frequentist model averaging and applications to bernoulli trials. Open J. Stat. 6, 545–553 (2016).
Gentleman, R. C. et al. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 5, R80 (2004).
Article PubMed PubMed Central Google Scholar
Lee, S. Y. et al. APEX fingerprinting reveals the subcellular localization of proteins of interest. Cell Rep. 15, 1837–1847 (2016).
Article CAS PubMed Google Scholar
Hung, V. et al. Spatially resolved proteomic mapping in living cells with the engineered peroxidase APEX2. Nat. Protoc. 11, 456–475 (2016).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We gratefully acknowledge Hye-Young Um, Hee-Saeng Jung, and Ju Eun Kim for administrative and technical support. We thank Shingo Kajimura for providing iBPA cells and Hail Kim, Seyun Kim, and Min-Woo Lee for providing reagents and helpful discussion. The J.A. lab received funding from the EPFL, the European Research Council under the European Union’s Horizon 2020 research and innovation program (ERC-AdG-787702), the Swiss National Science Foundation (SNSF 31003A_179435 and Sinergia CRSII5_202302), and a GRL grant from the National Research Foundation of Korea (NRF 2017K1A1A2013124). W.K.K. was supported by the Korea Drug Development Fund funded by Ministry of Science and ICT, Ministry of Trade, Industry, and Energy, and Ministry of Health and Welfare (HN22C0120), and National Research Foundation of Korea (2020R1A2C2007111, 2019R1A2C1006035). J.M.S. was supported by the KRIBB (KGM5392212, CRC22011), KAIST (N11230003), Korea Evaluation Institute of Industrial Technology (1415181231), and National Research Foundation of Korea (2021R1A2C2007573).

Author information

These authors contributed equally: Anna Park, Kwang-eun Kim.

Authors and Affiliations

Metabolic Regulation Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon, 34141, Republic of Korea
Anna Park, Su Jeong Lee, Eun Woo Lee, Kyoung-Jin Oh, Sang Chul Lee, Won Kon Kim & Kwang-Hee Bae
Graduate School of Medical Science and Engineering, KAIST, Daejeon, 34141, Republic of Korea
Kwang-eun Kim, Sang Heon Lee, Kun-Young Park & Jae Myoung Suh
Department of Chemistry, Seoul National University, Seoul, 08826, Republic of Korea
Kwang-eun Kim, Isaac Park & Hyun-Woo Rhee
Neural Circuit Research Group, Korea Brain Research Institute, Daegu, 41068, Republic of Korea
Minkyo Jung & Ji Young Mun
Laboratory of Integrative Systems Physiology, École polytechnique fédérale de Lausanne (EPFL), CH-1015, Lausanne, Switzerland
Xiaoxu Li, Maroun Bou Sleiman & Johan Auwerx
Department of Functional Genomics, KRIBB School of Bioscience, Korea University of Science and Technology (UST), Daejeon, 34141, Republic of Korea
Su Jeong Lee, Dae-Soo Kim, Eui-Jeon Woo, Eun Woo Lee, Baek Soo Han, Kyoung-Jin Oh & Won Kon Kim
Digital Biotech Innovation Center, KRIBB, Daejeon, 34141, Republic of Korea
Dae-Soo Kim
Department of Biological Sciences, KAIST, Daejeon, 34141, Republic of Korea
Jaehoon Kim
National Creative Research Center for Cell Plasticity, KAIST Stem Cell Center, Department of Biological Sciences, KAIST, Daejeon, 34141, Republic of Korea
Dae-Sik Lim
Disease Target Structure Research Center, KRIBB, Daejeon, 34141, Republic of Korea
Eui-Jeon Woo
Biodefense Research Center, KRIBB, Daejeon, 34141, Republic of Korea
Baek Soo Han
School of Medicine, Sungkyunkwan University, Suwon, 16419, Republic of Korea
Won Kon Kim
Department of Developmental and Cell Biology, School of Biological Sciences, University of California, Irvine, CA, 92697, USA
Kwang-Hee Bae

Authors

Anna Park
View author publications
You can also search for this author in PubMed Google Scholar
Kwang-eun Kim
View author publications
You can also search for this author in PubMed Google Scholar
Isaac Park
View author publications
You can also search for this author in PubMed Google Scholar
Sang Heon Lee
View author publications
You can also search for this author in PubMed Google Scholar
Kun-Young Park
View author publications
You can also search for this author in PubMed Google Scholar
Minkyo Jung
View author publications
You can also search for this author in PubMed Google Scholar
Xiaoxu Li
View author publications
You can also search for this author in PubMed Google Scholar
Maroun Bou Sleiman
View author publications
You can also search for this author in PubMed Google Scholar
Su Jeong Lee
View author publications
You can also search for this author in PubMed Google Scholar
Dae-Soo Kim
View author publications
You can also search for this author in PubMed Google Scholar
Jaehoon Kim
View author publications
You can also search for this author in PubMed Google Scholar
Dae-Sik Lim
View author publications
You can also search for this author in PubMed Google Scholar
Eui-Jeon Woo
View author publications
You can also search for this author in PubMed Google Scholar
Eun Woo Lee
View author publications
You can also search for this author in PubMed Google Scholar
Baek Soo Han
View author publications
You can also search for this author in PubMed Google Scholar
Kyoung-Jin Oh
View author publications
You can also search for this author in PubMed Google Scholar
Sang Chul Lee
View author publications
You can also search for this author in PubMed Google Scholar
Johan Auwerx
View author publications
You can also search for this author in PubMed Google Scholar
Ji Young Mun
View author publications
You can also search for this author in PubMed Google Scholar
Hyun-Woo Rhee
View author publications
You can also search for this author in PubMed Google Scholar
Won Kon Kim
View author publications
You can also search for this author in PubMed Google Scholar
Kwang-Hee Bae
View author publications
You can also search for this author in PubMed Google Scholar
Jae Myoung Suh
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

A.P., K.K., I.P., H.-W.R., W.K.K., K.-H.B. and J.M.S. conceived the study and interpreted data. A.P., K.K., I.P., S.H.L., K.Y.P. and S.-J.L. performed experiments. M.J. and J.Y.M. performed electron microscopy analysis. X.L., M.B.S. and J.A. performed systems genetics analysis. A.P, K.K, W.K.K, K.-H.B. and J.M.S. wrote the manuscript. D.-S.K., J.K., D.-S.L., J.Y.M., H.-W.R., E.-J.W., K.-J.O., E.W.L., B.S.H. and S.C.L. critically reviewed the study and provided helpful discussion. All authors read and approved the final version of the manuscript.

Corresponding authors

Correspondence to Won Kon Kim, Kwang-Hee Bae or Jae Myoung Suh.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Park, A., Kim, Ke., Park, I. et al. Mitochondrial matrix protein LETMD1 maintains thermogenic capacity of brown adipose tissue in male mice. Nat Commun 14, 3746 (2023). https://doi.org/10.1038/s41467-023-39106-z

Download citation

Received: 03 November 2021
Accepted: 31 May 2023
Published: 23 June 2023
DOI: https://doi.org/10.1038/s41467-023-39106-z

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.