Intranasal delivery of a rationally attenuated SARS-CoV-2 is immunogenic and protective in Syrian hamsters

Liu, Shufeng; Stauft, Charles B.; Selvaraj, Prabhuanand; Chandrasekaran, Prabha; D’Agnillo, Felice; Chou, Chao-Kai; Wu, Wells W.; Lien, Christopher Z.; Meseda, Clement A.; Pedro, Cyntia L.; Starost, Matthew F.; Weir, Jerry P.; Wang, Tony T.

doi:10.1038/s41467-022-34571-4

Download PDF

Article
Open access
Published: 10 November 2022

Intranasal delivery of a rationally attenuated SARS-CoV-2 is immunogenic and protective in Syrian hamsters

Nature Communications volume 13, Article number: 6792 (2022) Cite this article

2552 Accesses
8 Citations
10 Altmetric
Metrics details

Subjects

Abstract

Few live attenuated severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) vaccines are in pre-clinical or clinical development. We seek to attenuate SARS-CoV-2 (isolate WA1/2020) by removing the polybasic insert within the spike protein and the open reading frames (ORFs) 6–8, and by introducing mutations that abolish non-structural protein 1 (Nsp1)-mediated toxicity. The derived virus (WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A) replicates to 100- to 1000-fold-lower titers than the ancestral virus and induces little lung pathology in both K18-human ACE2 (hACE2) transgenic mice and Syrian hamsters. Immunofluorescence and transcriptomic analyses of infected hamsters confirm that three-pronged genetic modifications attenuate the proinflammatory pathways more than the removal of the polybasic cleavage site alone. Finally, intranasal administration of just 100 PFU of the WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A elicits robust antibody responses in Syrian hamsters and protects against SARS-CoV-2-induced weight loss and pneumonia. As a proof-of-concept study, we demonstrate that live but sufficiently attenuated SARS-CoV-2 vaccines may be attainable by rational design.

A single dose of replication-competent VSV-vectored vaccine expressing SARS-CoV-2 S1 protects against virus replication in a hamster model of severe COVID-19

Article Open access 22 July 2021

Ad26 vaccine protects against SARS-CoV-2 severe clinical disease in hamsters

Article Open access 03 September 2020

Intranasal vaccination of hamsters with a Newcastle disease virus vector expressing the S1 subunit protects animals against SARS-CoV-2 disease

Article Open access 20 June 2022

Introduction

The rapid development of multiple vaccines has afforded mankind powerful tools to curb the severe coronavirus disease 2019 (COVID-19) pandemic. Among the eleven vaccines granted emergency use by the World Health Organization (WHO), seven of them, including the Pfizer and Moderna mRNA vaccines, three adenovirus-vector-based vaccines (AstraZeneca/Oxford, AstraZeneca/Serum Institute of India, J&J), and two protein-based vaccines (Novavax and Covovax with Novavax formulation), all express SARS-CoV-2 spike protein as the immunogen. The other three inactivated, whole virus vaccines (SinoPharm, Sinovac, and Bharat Biotech) appear to be less immunogenic in inducing neutralizing antibodies^1,2,3. The efficacy of existing vaccines in preventing symptomatic infections, especially against new variants of concern, declines considerably over a period of six months^{4,5,6,7,8,9,10,11}. The stringent storage conditions and requirement of medical supplies to administer the vaccines put additional constraints on the worldwide distribution of some vaccines. For these reasons, new vaccines that are potent, broadly protective, and elicit durable immunity, as well as being easy to administer, store, and transport must be continuously pursued.

Live attenuated viral vaccines (LAV) utilize a living but weakened virus as immunogen, and there are many examples of effective LAVs including the measles, mumps, and rubella vaccine, oral polio vaccine, yellow fever virus vaccine, chickenpox vaccine, and one influenza vaccine. LAV causes a real, but often asymptomatic infection in vaccinees, and hence usually elicits both humoral and cellular immune responses. In addition, an intranasally administered LAV will not only avoid needle sticks but may be more effective in eliciting immunity at the mucosal membrane. The latter is especially desirable for prevention of COVID-19 because the human upper respiratory airway tends to be less protected by existing vaccines that are administered intramuscularly¹². An obvious obstacle to the development of LAVs against SARS-CoV-2 is the safety of the vaccine virus. Multi-layer attenuation of pathogenesis is expected to ensure a LAV does not revert back to virulence. To date, the only LAV that is in clinical development against COVID-19 is a genetically recoded virus with a segment of the viral spike protein being codon-pair deoptimized (clinicaltrials.gov Identifier: NCT04619628)¹³.

It is worth noting that SARS-CoV-2 attenuation does occur naturally and in cell culture. The most common mechanism of attenuation is the loss of the polybasic insert (PRRA) or the furin cleavage site^14,15, which impairs the ability for the virus to infect the lung^16,17. SARS-CoV-2 is also known to encode several powerful viral proteins that subvert the host innate immunity, especially interferons and interferon-stimulated genes (ISGs), and hence promote infection¹⁸. Numerous studies have reported that non-structural protein 1 (Nsp1), and accessory proteins ORF6, 7, and 8 are potent interferon (IFN) antagonists^{19,20,21,22,23}. Nsp1 is also cytopathic in cells of human lung origin²⁴. Clinical isolates containing a 382-nucleotide deletion in ORF8 seem to be associated with a milder infection²⁵. Taken together, there is a strong rationale to explore further development of attenuated SARS-CoV-2 vaccines and sufficient information currently available to provide a basis for the rational attenuation.

Here, we demonstrate a generic strategy to attenuate SARS-CoV-2 through reverse genetics. The derived virus (WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A) replicates to 100- to 1000-fold-lower titers than the ancestral virus, induces robust antibody responses in Syrian hamsters and protects against SARS-CoV-2 challenge.

Results

Rational Attenuation of SARS-CoV-2

Although a single mutation may attenuate a virus, a LAV that differs from the wild-type virus by only one or two mutations poses an inherent safety concern due to the possibility of reversion. For that reason, we made the following modifications to the ancestral WA1/2020 viral genome: First, the polybasic insert (PRRA) immediately upstream of the furin cleavage site was removed from the virus. Such a modification abolishes the S1/S2 cleavage of the spike protein and significantly reduces infection of the lung^16,26. Second, known IFN antagonists, ORFs6-8, were deleted from the viral genome. Thirdly, a pair of mutations (K164A/H165A) was introduced into the C-terminus of Nsp1 as we previously showed that these mutations significantly reduced cytotoxicity of SARS-CoV-2²⁷. The three-pronged genetic modifications are to decrease infection of the lung, reduce inflammation and interferon antagonism, alleviate Nsp1-mediated toxicity. Ultimately, a recombinant virus termed “WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A” was obtained. For comparison purpose, we also generated two other recombinant viruses, WA1-ΔPRRA and WA1-ΔPRRA-ΔORF6-8-Nsp1^N128S/K129E, respectively (Fig. 1a). WA1-ΔPRRA only has the polybasic insert removed, whereas WA1-ΔPRRA-ΔORF6-8-Nsp1^N128S/K129E has both the polybasic insert and ORFs6-8 deleted and then contains a pair of mutations (N128S/K129E) that did not efficiently abolish Nsp1-mediated cytotoxicity as did K164A/H165A²⁷. All recombinant viruses formed plaques in Vero E6 cells and reached titers to 10⁷ pfu/ml (Fig. 1b). For brevity, the three recombinant viruses are also referenced as “ΔPRRA”, “Nsp1-K164A/H165A”, and “Nsp1-N128S/K129E” throughout the text. To monitor the genome stability, recombinant Nsp1-K164A/H165A virus was passaged five times in Vero E6 cells and human lung cell line H1299/hACE2 before viral genome sequencing. Passaging in H1299/hACE2 did not result in any new mutations, whereas passaging in Vero E6 cells led to a few single nucleotide variants (SNVs) outside the designed region of mutations (Supplementary Fig. 1). Sanger sequencing was also performed to detect the presence of K164A/H165A in Nsp1 after passage 5 (Fig. 1c). Overall, no reversion was found, and the genome of recombinant viruses appeared to be stable after cell passages in H1299/hACE2 cells. The three recombinant viruses grew with similar kinetics in A549-hACE2 cells to comparable titers (Fig. 1d). Compared to the ancestral virus (WA1/2020), all three recombinant viruses poorly infected primary human airway cells that were cultured at the air-liquid interface except that ΔPRRA mutant yielded infectious virus after 4 days. Nsp1-K164A/H165A and Nsp1-N128S/K129E displayed nearly no infectivity on primary cells over a period of 5 days (Fig. 1e, f).

Attenuation of Nsp1-K164A/H165A in K18-hACE2 transgenic mice

To test attenuation in vivo, adult K18-hACE2 transgenic mice were divided into five groups (n = 10/group) and intranasally inoculated with 10⁵ plaque forming unit (PFU) of WA1/2020, ΔPRRA, Nsp1-K164A/H165A, and Nsp1-N128S/K129E or left uninoculated. Weight, survival, and clinical signs of illness were monitored for eight days. Notably, all infected mice succumbed to the infection by day 8 (Fig. 2a–d). Because encephalitis following SARS-CoV-2 infection is known to cause lethality in this model^{28,29,30,31,32,33,34}, possible attenuation of the virus in the respiratory tract could have been masked by the lethality caused by encephalitis. To compensate for the limitations of the K18-hACE2 mouse model, we quantified the viral loads in nasal turbinates, lungs, and brains at 2, 4, 6 days post infection (dpi). In nasal turbinates, the median log₁₀-transformed infectious titers peaked by 2 dpi at 5.3 [interquartile range (IQR), 5.0 to 5.7], 3.8 (IQR, 2.6 to 5.7), 3.2 (IQR, 2.2 to 3.7), and 4.3 (IQR, 2.8 to 4.7) for WA1/2020, ΔPRRA, Nsp1-K164A/H165A, and Nsp1-N128S/K129E infected mice, respectively. Infectious titers subsided to approximately the lower limit of quantification by 4 dpi (Fig. 2e, f). In the lungs of Nsp1-K164A/H165A infected mice, infectious viral titers were ∼2log₁₀ lower compared to WA1/2020-infected animals at 2 and 6 dpi (Fig. 2g–j). The lung viral loads in Nsp1-K164A/H165A infected mice also trended lower than those from ΔPRRA and Nsp1-N128S/K129E groups, reaching statistical significance at 4 and 6 dpi. The viral loads in the brain, however, were largely comparable among the four infected groups except that at 6 dpi the Nsp1-K164A/H165A group had the lowest viral titers (Fig. 2k–m). Interestingly, at 2 dpi, there was very little detectable infectious virus in the brain, but the viral load in the brains rose in delayed kinetics as opposed to that in the respiratory tract. High viral loads in the brains of the Nsp1-K164A/H165A group at 6 dpi were coupled with a lack of pathology in lung tissues. Haematoxylin and eosin (H&E) staining (Fig. 2n–w) found lung lesions in WA1/2020, ΔPRRA, and Nsp1-N128S/K129E infected mice. Generally, there were peribronchiolar and perivascular immune infiltration. By contrast, Nsp1-K164A/H165A infected lungs had less than 1% impacted area with little pathology, which are nearly indistinguishable from the uninfected mice. Altogether, these results demonstrated that the Nsp1-K164A/H165A virus was primarily attenuated in the lower respiratory tract of K18-hACE2 mice but was still neuroinvasive in this highly sensitive mouse model.

**Fig. 2: Attenuation of Nsp1-K164A/H165A in the respiratory tract of K18-hACE2 mice.**

Attenuation of Nsp1-K164A/H165A in Syrian hamsters

Syrian hamsters are highly susceptible to SARS-CoV-2 and have been widely used in COVID-19 research^35,36,37. Given the intrinsic shortcomings of the K18-hACE2 mouse model due to fatal neuroinvasion, we further evaluated the possible attenuation of Nsp1-K164A/H165A in hamsters. To this end, five groups of 6-month-old Syrian hamsters were intranasally inoculated with 10⁴ PFU of each virus or left uninoculated. This inoculum has consistently yielded weight loss, clinical signs, and lung pathology in Syrian hamsters³⁸. Shown in Fig. 3a, WA1/2020-infected hamsters showed 18% weight loss on 7 dpi, whereas ΔPRRA, and Nsp1-N128S/K129E groups displayed no more than 5% weight loss over a period of 14 days. Nsp1-K164A/H165A infected animals (n = 8), like the uninfected group, had no weight loss at all through the study. During the first four days following infection, the log₁₀-transformed infectious viral titers in nasal wash samples were measured by a TCID₅₀ assay. Shown in Fig. 3b, the infectious titers from Nsp1-K164A/H165A infected animals were about two log₁₀ lower than that of WA1/2020-infected hamsters at 1 and 2 dpi and trended lower than those from ΔPRRA and Nsp1-N128S/K129E-infected animals. Infectious nasal viral titers from all groups subsided to just above the limit of quantification at 4 dpi. Similarly, subgenomic RNA (sgRNA) titers in nasal turbinates from all groups were just above limit of quantification at 4 dpi (Fig. 3c). Log₁₀-transformed sgRNA copies per ml in lung homogenates were 5.5 (IQR, 5.1 to 6.1), 4.0 (IQR 3.5 to 4.4), 3.5 (IQR 3.3 to 4.3), 4.5 (IQR 4.0 to 4.9), for WA1/2020, ΔPRRA, Nsp1-K164A/H165A, and Nsp1-N128S/K129E infected hamsters, respectively, at 4 dpi (Fig. 3c); median log₁₀-transformed infectious viral titers in lung homogenates were 7.1 (IQR 7.0 to 7.2), 6.0 (5.8 to 6.1), 4.3 (IQR 3.7 to 5.3), 6.1 (IQR 5.4 to 6.4) for WA1/2020, ΔPRRA, Nsp1-K164A/H165A, and Nsp1-N128S/K129E infected hamsters, respectively (Fig. 3d). RNAscope revealed that viral RNA was present only along the bronchial epithelium in Nsp1-K164A/H165A-infected hamsters and the amount of staining was much less than the other three infected groups (Supplementary Fig. 2). Overall, viral loads of Nsp1-K164A/H165A-infected hamsters were 100–1000-fold lower than WA1/2020-infected animals and were half-log lower than ΔPRRA and Nsp1-N128S/K129E-infected animals. The lung pathology was subsequently scored. Once again, Nsp1-K164A/H165A-infected hamsters had minimal histopathological changes in the lung at 4 dpi (Fig. 3e). By contrast, WA1/2020 infection induced massive peribronchiolar edema and perivascular immune cell infiltrates, which led to significant consolidation (Fig. 3f–t). ΔPRRA and Nsp1-N128S/K129E groups occasionally had areas where type II hyperplasia and immune infiltration were found. Nsp1-K164A/H165A infected hamsters showed minimal pathological changes in the lung, sometimes indistinguishable from uninfected animals. The pathology of trachea followed the same trend observed in the lung with Nsp1-K164A/H165A infected animals showing only minimal submucosal lymphoplasmacytic infiltrates (Supplementary Fig. 3). None of the infections led to noticeable changes in heart and other critical organs as we have previously reported³⁸.

Immunofluorescence analyses showed that regions of consolidation in WA1/2020-infected lungs were dominated by Iba1-expressing macrophages (Fig. 4). Consolidated Iba1 staining was not detected or minimal in uninfected, ΔPRRA and Nsp1-K164A/H165A groups while consolidated Iba1 regions were visible in Nsp1-N128S/K129E-infected animals. Prominent staining for viral nucleocapsid was present in alveolar epithelium surrounding consolidated regions and within affected bronchioles in WA1/2020 (Fig. 4a, b). Nucleocapsid staining was limited to bronchiolar epithelium in Nsp1-K164A/H165A group (Fig. 4a), but reached alveolar epithelium in ΔPRRA and Nsp1-N128S/K129E infected animals. Reduced staining for RAGE and ProSPC, markers of type 1 and type 2 epithelial cells, respectively, highlighted the excessive epithelial damage in regions of consolidation (Fig. 4f, g).

**Fig. 4: Attenuation of virus propagation, macrophage accumulation, and epithelial damage in Nsp1-K164A/H165A-infected hamster lungs.**

To further assess changes at the molecular level, we isolated RNA from both nasal turbinates and lung homogenates at 4 dpi and performed RNAseq analyses. In nasal turbinates, comparison between WA1/2020 and ΔPRRA, Nsp1-N128S/K129E and Nsp1-K164A/H165A infected animals showed that WA1/2020 upregulated 34 and downregulated 17 genes in pathways of inflammation, upregulated 33 and downregulated 25 genes of pathways of type I IFN responses, and then upregulated 39 and downregulated 8 genes in pathways of type II IFN responses (Fig. 5). Most noticeably, Nsp1-K164A/H165A infection had least effects on the expressions of proinflammatory markers, such as Mx2, Ifit3, Tlr6, Cxcl10, and Nfkb1 (Fig. 5a). Nsp1-K164A/H165A infection upregulated least numbers of genes of the interferon-alpha and gamma responses (Fig. 5b, c), presumably due to the lowest viral load among all tested groups. In some cases, gene expression profiles of Nsp1-K164A/H165A-infected hamsters were indistinguishable from those of uninfected hamsters. Strikingly, Nsp1-K164A/H165A specifically upregulated genes like Irf8, Tap1, and Stat1, all of which are important for antiviral defense (Fig. 5b). In the lungs, WA1-2020 induced 50 proinflammatory genes, 14 TLR signaling genes, 25 genes of the type I IFN and 37 genes of type II IFN pathways to higher levels than in ΔPRRA, Nsp1-K164A/H165A, and Nsp1-N128S/K129E infected hamsters. For those genes that were significantly downregulated in WA1/2020-infected animals, their expressions were restored in ΔPRRA, Nsp1-K164A/H165A, and Nsp1-N128S/K129E infected hamsters (Supplementary Fig. 4). Notably, we did not observe significant differences in terms of gene expression profiles in the lungs between ΔPRRA, Nsp1-K164A/H165A, and Nsp1-N128S/K129E infected animals, which may be a result of limited numbers of samples or an overall very low viral loads in the lungs.

**Fig. 5: Heatmap analysis of interferon and inflammation signaling pathways in nasal turbinates.**

Intranasal immunization of Syrian hamsters with Nsp1-K164A/H165A induced potent humoral response and protected against WA1/2020 challenge

Based on the data obtained from above studies, Nsp1-K164A/H165A appears to be the most attenuated recombinant virus and hence was chosen for subsequent evaluation of immunogenicity and efficacy as a LAV candidate. To this end, adult Syrian hamsters were intranasally immunized with 10², 10³, and 10⁴ PFU Nsp1-K164A/H165A. For comparison, we also inoculated hamsters with 10⁴ PFU WA1/2020, ΔPRRA, and Nsp1-N128S/K129E and housed animals until convalescence (Fig. 6a). A single dose of Nsp1-K164A/H165A induced binding and neutralizing antibodies (Fig. 6b, c) to levels that are comparable to those from WA1/2020-infected hamsters at 14 or 28 days after immunization. Interestingly, a dose of 100 PFU was just as potent as a dose of 10⁴ PFU regarding induction of antibodies. Immunized and convalescent hamsters were subsequently challenged with 10⁴ PFU WA1/2020 virus and monitored for 7 days before necropsy. Mock vaccinated hamsters lost more than 15% body weight by day 7 post-challenge (dpc), whereas immunized hamsters from all three dosage groups did not lose any weight (Fig. 6d). At 1- and 2-days post-challenge, infectious viral titers in nasal wash samples collected from immunized animals were 3 to 4 log₁₀ lower than those from unvaccinated but challenged animals (Fig. 6e, f) and largely resolved by 4 dpc (Fig. 6g, h). Infectious viral titers and sgRNA titers in trachea and lungs were frequently below limit of quantification in many of the immunized and convalescent hamsters at 4 and 7 dpc (Fig. 6i–l). Viral loads in the nasal turbinates of the immunized and convalescent hamsters were at least 4 logs lower at 4 dpc and then went undetectable at 7 dpc. Lastly, single-dose immunization with Nsp1-K164A/H165A completely protected hamsters from developing pneumonia upon challenge, with nearly 0% consolidation and no histopathological changes at 4 and 7 dpc (Fig. 7a–c and Supplementary Fig. 5). Interestingly, we did not observe anamnestic antibody response in the Nsp1-K164A/H165A-vaccinated hamsters (Supplementary Fig. 6), likely reflecting the robust protection and minimal viral replication in these animals, as we have found in convalescent animals³⁸.

**Fig. 6: Intranasal immunization of Syrian hamsters with Nsp1-K164A/H165A induced potent humoral responses and protected against WA1/2020 challenge.**

**Fig. 7: Syrian hamsters immunized with Nsp1-K164A/H165A displayed minimal lung pathology upon WA1/2020 challenge.**

Discussion

For a pandemic respiratory pathogen like SARS-CoV-2, an important factor to consider when evaluating a LAV is safety, i.e., how pathogenic the vaccine virus is. Naturally, a poorly replicating virus is likely to be less immunogenic. We presented a rational approach to attenuate SARS-CoV-2 and abolish its pathogenicity while preserving immunogenicity. In K18-hACE2 transgenic mice and Syrian hamsters, viral loads of WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A infected animals were 100−1000-fold lower in the nose and the lungs than those of WA1/2020-infected animals and were also noticeably lower than two comparators, WA1-ΔPRRA and WA1-ΔPRRA-ΔORF6-8-Nsp1^N128S/K129E-infected animals. The attenuation of WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A pathogenesis was further confirmed by the absence of lung pathology in infected animals. The mechanism of attenuation is likely threefold: (1) removal of the polybasic insert (PRRA) rendered the virus less infectious in the lung^{26,39,40,41,42,43,44}; (2) removal of ORF6-8 and the introduction of Nsp1^K164A/H165A further weakened the ability of the virus to antagonize IFNs; (3) K164A/H165A mutations also alleviated Nsp1-mediated cytotoxicity as we have recently reported²⁷. In consistence, WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A-infected hamsters showed more pronounced attenuation of proinflammatory genes in the nasal turbinates compared to WA1-ΔPRRA and WA1-ΔPRRA-ΔORF6-8-Nsp1^N128S/K129E-infected animals. Infection with WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A was limited to bronchiolar epithelium and hence recruited nearly no macrophages into the lung. As we did not create a recombinant virus that only lacks ORFs6-8, we are unable to quantify the contribution of each modification to the observed attenuation in vivo. Nonetheless, WA1-ΔPRRA-ORF6-8-Nsp1^K164A/H165A appears to be the least pathogenic among the three recombinant viruses in animal models in terms of overall tissue viral load and pathology. Splitting attenuating modifications in three regions within the viral genome, rather than concentrating them, is likely to reduce the chances of reversion to virulence through a single recombinational event. Therefore, WA1-ΔPRRA-ORF6-8-Nsp1^K164A/H165A may be a safer candidate for a LAV or a challenge virus in human challenge studies than those attenuated SARS-CoV-2 with only one or two-mutation difference from the wild type.

Unlike vaccines that express only the spike protein as immunogen, LAVs confer broader and/or more durable protection because the whole organism is recognized by the host immune system. As to the humoral immune response, profiling antibody binding in 40 COVID-19 convalescent patients identified B cell epitopes derived from many viral proteins, including S, M, N, ORF1ab, ORF3a, ORF6, and ORF8⁴⁵. In this study, as low as an inoculum of 100 PFU WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A elicited potent humoral immune response and prevented hamsters from developing lung pathology. The observed protection was accompanied by more than 5-log₁₀ reductions in viral loads in the lung and trachea following challenge. Impressively, immunized animals also displayed over 4-log₁₀ reductions in nasal viral load. It is known that natural infection by SARS-CoV-2 induces both mucosal antibody responses and systemic antibody responses⁴⁶. Secretory immunoglobulin A (IgA) is thought to play a major role in protecting the upper and lower respiratory tract from acute infection. Unfortunately, vaccines that are administered intramuscularly or intradermally potently induce IgG but not much secretory IgA^12,47. By contrast, intranasal administration of a vaccine likely induces more potent mucosal immunity^48,49,50. Ongoing efforts in our group are the development of appropriate reagents and assays to reliably determine mucosal antibody titers in hamsters and to evaluate cellular immunity induced by WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A. Future studies are also warranted to directly assess the effectiveness of intranasal delivery of WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A against SARS-CoV-2 transmission in comparison to mRNA or protein-based vaccines.

We expect that administration of WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A will activate broader cellular immunity that is cross-protective against variants of concern than spike-based vaccines^51,52 because replication of WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A offers many more targets to derive T cell epitopes. While this area of research is currently under investigation, if needed, variant-specific LAVs can be rapidly generated using our attenuation strategy. The furin cleavage site, ORFs 6–8, and the Nsp1-K164/H165 residues are conserved among all major SARS-CoV-2 variants of concern.

Although a single intranasal administration of WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A protected against SARS-CoV-2-induced pneumonia in Syrian hamsters, we noted some limitations in the study. First, WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A remains neurovirulent in K18-hACE2 mice at an inoculum of 10⁵ PFU. Whether this reflects an intrinsic neurovirulence of the virus or the limitation of the mouse model will need to be investigated. Second, we and others have shown that immunity acquired through natural infection does not lead to sterilizing immunity in nasal cavity^53,54,55,56. Hence, even if immunization with WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A significantly reduces SARS-CoV-2 infection and pathology, to achieve sterilizing immunity in the upper respiratory tract may not be a realistic goal. Finally, studies are needed to monitor immune responses over time to establish the durability of the protective response after intranasal vaccination with WA1-ΔPRRA-ΔORF6-8-Nsp1^K164A/H165A.

In summary, our studies demonstrate the value of rationally attenuated SARS-CoV-2 in facilitating the development of new vaccines. Intranasal delivery of the attenuated SARS-CoV-2 induces potent humoral immunity, provides excellent protection, and possibly promotes sterilizing immunity in the lung. Our results support intranasal delivery of rationally attenuated SARS-CoV-2 as a promising platform for preventing COVID-19 and thus warrants further exploration.

Methods

Research described here complies with all relevant ethical regulations and has been approved by the US Food and Drug Aministration Institutional Biosafety Committee. All critical reagents are listed in Supplementary Table 1.

Cells and viruses

Vero E6 cell line (Cat # CRL-1586) was purchased from American Type Cell Collection (ATCC) and cultured in Eagle’s minimal essential medium (MEM) supplemented with 10% fetal bovine serum (Invitrogen) and 1% penicillin/streptomycin and L-glutamine. A549-hACE2 (NR-53821) cells were obtained from BEI Resources and maintained in DMEM supplemented with 5% penicillin and streptomycin, and 10% fetal bovine serum (FBS) at 37 °C with 5% CO₂. Lenti-X cell line was purchased from Takarabio (Cat No. 632180) and maintained in DMEM supplemented with 5% penicillin and streptomycin, and 10% fetal bovine serum (FBS) at 37 °C with 5% CO₂.

EpiAirway cells (AIR-100-HCF) and culturing media were purchased from MatTek. EpiAirway is a ready-to-use, 3D mucociliary tissue model consisting of normal, human-derived tracheal/bronchial epithelial cells cultured at the air-liquid interface (ALI). Cells were cultured in MatTek proprietary media for 2 days prior to usage. Mucus was washed off at the time of infection.

The SARS-CoV-2 isolate WA1/2020 (NR-52281, lot 70033175) was obtained from BEI Resources, NIAID, NIH, and had been passed three times on Vero cells and 1 time on Vero E6 cells prior to acquisition. It was further passed once on Vero E6 cells in our lab. The virus has been sequenced and verified to contain no mutation to its original seed virus.

Production of SARS-CoV-2 recombinant virus

SARS-CoV-2 recombinant virus was generated using a 7-plasmid reverse genetic system which was based on the virus strain (2019-nCoV/USA_WA1/2020) isolated from the first reported SARS-CoV-2 case in the U.S.⁵⁷. The initial 7 plasmids were generous gifts from Dr. P-Y Shi (UTMB). Upon receival, fragment 4 was subsequently subcloned into a low-copy plasmid pSMART LCAmp (Lucigen) to increase stability. To introduce Nsp1^N128S/K129E and K164A/H165A mutations, pUC57-CoV2-F1 plasmids containing mutated Nsp1 were first created by using overlap PCR method with the following primers:

M13F: gtaaaacgacggccagt

N128S/K129Ef: taagaacggtAGTGAGggagctggtggccatagtta

N128S/K129E r: caccagctccCTCACTaccgttcttacgaagaagaa

K164A/H165Af: aaaactggaacactGCcGCcagcagtggtgttacccgtga

K164A/H165Ar: gggtaacaccactgctgGCgGCagtgttccagttttcttgaa

NheIr: cacgagcagcctctgatgca

PCR fragments were digested by Bgl II/Nhe I and ligated into Bgl II/Nhe I digested F1 plasmid. The spike ΔPRRA mutation was introduced in to pUC57-CoV2-F6 by using overlap PCR with primers:

M13F: gtaaaacgacggccagt

ΔPRRA-f: actcagactaattctcgtagtgtagctagtcaatc

ΔPRRA-r: actagctacactacgagaattagtctgagtctgat

BglIIr: cagcatctgcaagtgtcact

PCR fragments were digested by Kpn I/Bgl II and ligated into Kpn I/Bgl II digested F6 plasmid.

To delete the ORF6-ORF8 region, an overlap PCR was performed using the following primers:

Mf: ttaattttagccatggcaga

ORF68f: tttgcttgtacagtaaacgaacaaactaaaatgtc

ORF68r: ttttagtttgttcgtttactgtacaagcaaagcaa

AvrIIr: gaagtccagcttctggccca

PCR fragments were digested by Mlu I/Avr II and ligated into Mlu I/Avr II digested pCC1-CoV-2-F7 plasmid. The resulted plasmids were validated by restriction enzyme digestion and Sanger sequencing.

In vitro transcription and electroporation were carried following procedures that were detailed elsewhere⁵⁸. To recover the virus, the RNA transcript was electroporated into Vero E6 cells. Virus after passage 1 was titrated by plaque forming assay in Vero E6 cells and verified by deep sequencing.

Hamster challenge experiments

Adult male outbred Syrian hamsters were previously purchased from Envigo and held at FDA vivarium. All experiments were performed within the biosafety level 3 (BSL-3) suite on the White Oak campus of the U.S. Food and Drug Administration. The animals were implanted subcutaneously with IPTT-300 transponders (BMDS), randomized, and housed 2 per cage in sealed, individually ventilated rat cages (Allentown). Hamsters were fed irradiated 5P76 (Lab Diet) ad lib, housed on autoclaved aspen chip bedding with reverse osmosis-treated water provided in bottles, and all animals were acclimatized at the BSL3 facility for 4–6 days or more prior to the experiments. The study protocol details were approved by the White Oak Consolidated Animal Care and Use Committee and carried out in accordance with the PHS Policy on Humane Care & Use of Laboratory Animals.

For challenge studies, adult (6–12 months old) Syrian hamsters were anesthetized with 3–5% isoflurane following procedures as described previously^38,59. Intranasal inoculation was done by pipetting 10⁴ PFU or desirable doses of SARS-CoV-2 in 50 µl volume dropwise into the nostrils of the hamster under anesthesia. Following infection, hamsters were monitored daily for clinical signs and weight loss. Nasal wash samples taken on days 1-, 2-, 3-, and 4-day post infection to test for sgRNA by RT-qPCR and infectious virus by TCID50 in Vero E6 cells. Nasal washes were collected by pipetting ~160 µl sterile phosphate-buffered saline into one nostril when hamsters were anesthetized by 3–5% isoflurane. For tissue collection, a subset of hamsters was humanely euthanized by intraperitoneal injection of pentobarbital at 200 mg/kg and lungs for histopathology. Blood collection was performed under anesthesia (3–5% isoflurane) through gingival vein puncture or cardiac puncture when animals were euthanized.

Mouse infection experiments

Female adult K18-hACE2 mice (12 weeks ago) were previously purchased from the Jackson laboratory and held at FDA vivarium. All experiments were performed within the biosafety level 3 (BSL-3) suite on the White Oak campus of the U.S. Food and Drug Administration. The study protocol details were approved by the White Oak Consolidated Animal Care and Use Committee and carried out in accordance with the PHS Policy on Humane Care & Use of Laboratory Animals.

For infection studies, mice were first anesthetized by 3–5% isoflurane. Intranasal inoculation was done by pipetting 10⁵ PFU SARS-CoV-2 in 50 µl volume dropwise into the nostrils of the mouse. Mice were weighed and observed daily. For tissue collections, mice were euthanized by CO₂ overdose on days 2, 4, 6 as necessary.

SARS-CoV-2 pseudovirus production and neutralization assay

Procedures as described previously^38,59. In brief, 50 μL of SARS-CoV-2 S pseudovirions were pre-incubated with an equal volume of medium containing serum at varying dilutions at room temperature for 1 h, then virus-antibody mixtures were added to Vero E6 cells in a 96-well plate. After a 3 h incubation, the inoculum was replaced with fresh medium. Cells were lysed 48 h later, and luciferase activity was measured using luciferin-containing substrate. Controls included cell only control, virus without any antibody control, and positive control sera. The end-point titers were calculated as the last serum dilution resulting in at least 50% SARS-CoV-2 neutralization. A NIBSC anti-SARS-CoV-2 antibody (20/130) was included as a positive control.

RNA isolation and qRT-PCR

Procedures as described previously^38,59. In brief, RNA was extracted from 50 μl NW or 0.1 g tissue homogenates using QIAamp vRNA mini kit or the RNeasy 96 kit (QIAGEN) and eluted with 60 μl of water. 5 μL RNA was used for each reaction in real-time RT-PCR. When graphing the results in Prism 8, values below the limit of quantification (LoQ) were arbitrarily set to half of the LoQ values. Unless otherwise specified, the unit for RNA copies are as presented as Log₁₀ RNA copies/5 μl nasal wash or Log₁₀ RNA copes/0.1 g tissue homogenates,

RNAseq

To prepare sequencing libraries, RNA was first extracted using the Trizol-chloroform method from the lung homogenates and nasal turbinates. The aqueous portion was further purified using RNeasy mini kit (Qiagen, Gaithersburg, MD). RNA quality was assessed using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA), and the RNA integration numbers (RIN) were all greater than 9. An aliquot (1 μg) of each sample of total RNA was used to prepare sequencing libraries using Illumina Stranded Messenger RNA Prep (ligation based). The cDNA libraries were normalized and loaded onto a NovaSeq 6000 sequencer (Illumina, San Diego, CA) for deep sequencing of paired-end reads of 2 × 100 cycles. The sequencing reads for each sample were mapped to the respective reference genomes of Mesocricetus auratus (BCM_Maur_2.0) by Tophat (v2.1.2). Cufflinks (v2.2.1) was then used to assemble transcripts, estimate abundances and test for differential expression. The sequencing and initial data analysis using Qiagen CLC Genomics Workbench (version 21) was performed by FDA Next Generation Sequencing Core Facility. The sequencing and initial data analysis using Qiagen CLC Genomics Workbench (version 21) was performed by FDA Next Generation Sequencing Core Facility. Raw and processed data have been deposited to NCBI (GEO accession number GSE199922s).

Further data analysis was done using R Studio 1.4.1106 (http://www.R-project.org). Heatmaps were constructed using heatmap library. The gene list for signaling pathways was obtained from hallmark gene sets in Molecular Signatures Database (MSigDB)⁶⁰. The figures were assembled in Adobe Photoshop. This work utilized the computational resources of the NIH HPC Biowulf cluster (http://hpc.nih.gov).

Histopathology analyses

Procedures as described previously^38,59. Tissues (hearts, brains, lungs, trachea, and nasal turbinates) were fixed in 10% neural buffered formalin overnight and then processed for paraffin embedding. The 5-μm sections were stained with hematoxylin and eosin for histopathological examinations. Images were scanned using an Aperio ImageScope. For hamster tissues, blinded samples were graded by a licensed pathologist for the following twelve categories: consolidation, alveolar wall thickening, alveolar airway infiltrates, perivascular infiltrates, perivascular edema, type II pneumocyte hyperplasia, atypical pneumocyte hyperplasia, bronchiole mucosal hyperplasia, bronchiole airway infiltrates, proteinaceous fluid, hemorrhage, vasculitis. Grading: 0 = none, 1 = mild, 2 = moderate, 3 = severe. A graph was prepared by summing up the score in each category. Mouse tissues were scored based on the following categories: consolidation, alveolar wall thickening, alveolar airway infiltrates, perivascular Infiltrates, perivascular edema, peribronchiolar infiltrates, type II pneumocyte hyperplasia, necrosis (alveoli and bronchiole), bronchiole mucosal hyperplasia, bronchiole airway infiltrates, proteinaceous fluid, hemorrhage, vasculitis. Grading scale: 0 = none, 1 = mild, 2 = moderate, 3 = severe.

In situ hybridization (RNAscope)

To detect SARS-CoV-2 genomic RNA in FFPE tissues, ISH was performed using the RNAscope 2.5 HD RED kit, a single plex assay method (Advanced Cell Diagnostics; Catalog 322373) according to the manufacturer’s instructions. Briefly, Mm PPIB probe detecting peptidylprolyl isomerase B gene (housekeeping gene) (catalog 313911, positive-control RNA probe), dapB probe detecting dihydrodipicolinate reductase gene from Bacillus subtilis strain SMY (a soil bacterium) (catalog 310043, negative-control RNA probe) and V-nCoV2019-orf1ab (catalog 895661) targeting SARS-CoV-2 positive-sense (genomic) RNA. Tissue sections were deparaffinized with xylene, underwent a series of ethanol washes and peroxidase blocking, and were then heated in kit-provided antigen retrieval buffer and digested by kit-provided proteinase. Sections were exposed to ISH target probes and incubated at 40 °C in a hybridization oven for 2 h. After rinsing, ISH signal was amplified using kit-provided pre-amplifier and amplifier conjugated to alkaline phosphatase and incubated with a fast-red substrate solution for 10 min at room temperature. Sections were then stained with 50% hematoxylin solution followed by 0.02% ammonium water treatment, dried in a 60 °C dry oven, mounted, and stored at 4 °C until image analysis.

Lung immunofluorescence analyses

Formalin-fixed paraffin-embedded (FFPE) lung sections 4 µm thick were dewaxed, rehydrated, and heat-treated in a microwave oven for 15 min in 10 mM Tris/1 mM EDTA buffer (pH 9.0). After cooling for 30 min at room temperature, heat-retrieved sections were blocked in PBST with 2.5% bovine serum albumin (BSA) for 30 min at RT followed by overnight incubation at 4 °C with primary antibodies in 1% BSA. Primary antibodies used included SARS nucleocapsid protein (1:800, Sino Biologicals, 40143-MM05), prosurfactant protein C (1:200, EMD Millipore, AB3786), Iba1 (1:100, Abcam, ab5076), and RAGE (1:400, Abcam, ab216329). Sections were rinsed and incubated with 1:500 secondary antibodies congujated with Alexa Fluor 488 (A-21206) and Alexa Fluor 647 (A-31571, A-21447) for 1 h at RT (ThermoFisher, Waltham, MA). Nuclei were counterstained with Hoechst 33342. For double labeling experiments, primary antibodies were mixed and incubated overnight at 4 °C. For negative controls, sections were incubated without the primary antibody or mouse and rabbit isotype antibody controls. Sections stained with conjugated secondary antibodies alone showed no specific staining. Whole-slide fluorescence imaging was performed using a Hamamatsu NanoZoomer 2.0-RS whole-slide digital scanner equipped with a ×20 objective and a fluorescence module #L11600. Analysis software NDP.view2 was used for image processing (Hamamatsu Photonics, Japan).

TCID₅₀

Procedures as described previously^38,59. In brief, Vero E6 cells were plated the day before infection into 96-well plates at 1.5 × 10⁴ cells/well. On the day of the experiment, serial dilutions of 20 μl nasal wash samples were made in media and a total of six to eight wells were infected with each serial dilution of the virus. After 48 h incubation, cells were fixed in 4% PFA followed by staining with 0.1% crystal violet. The TCID₅₀ was then calculated using the formula: log(TCID₅₀) = log(do) + log(R) (f + 1). Where do represents the dilution giving a positive well, f is a number derived from the number of positive wells calculated by a moving average, and R is the dilution factor.

Plaque assay

Nasal wash samples were 10-fold serially diluted and added to a 24-well plate containing freshly confluent with Vero E6 cells. For tissue samples, entire trachea or nasal turbinates or the left lobe of the lung (~0.2 g) were resuspended in 1 milliliter MEM and homogenized on a Precellys Evolution tissue homogenizer with a Cooling Unit (Bertin). Tissue homogenates were then 10-fold serially diluted and added to Vero E6. After 1 h the mixture was removed and replenished with Tragacanth gum overlay (final concentration 0.3%). Cells were incubated at 37 °C and 5% CO₂ for 2 days, then fixed with 4% paraformaldehyde, followed by staining of cells with 0.1% crystal violet in 20% methanol for 5–10 min. The infectious titers were then calculated and plotted as plaque forming units per milliliter (PFU/ml).

Focus-forming assay

ALI cell culture supernatants were 10-fold serially diluted in 96-well plates and dilutions added to 96-well black-well plates for fluorescent focus-forming assays in H1299-hACE2 cells. After 1 h the Tragacanth gum overlay (final concentration 0.3%) was added. Cells were incubated at 37 °C and 5% CO2 for 1 day, then fixed with 4% paraformaldehyde, followed by staining of cells with primary rabbit anti-nucleocapsid Wuhan-1 antibody (custom made by Genscript) overnight followed by secondary anti-rabbit Alexa-488 conjugated antibody and DAPI staining. The infectious titers were then counted using Gen5 software on a Cytation7 machine and calculated and plotted as focus-forming units per milliliter (FFU/ml).

Measurement of antibody by ELISA

SARS-CoV-2 S and RBD antigens for ELISA were prepared in a baculovirus expression system using procedures as published elsewhere⁶¹. Briefly, Immunlon 2HB plates were coated with recombinant S or RBD protein at 1 µg/mL overnight at 4 °C. Test serum samples were pre-diluted in assay diluent (PBS containing 0.05% Tween-20 [PBST] and 10% fetal bovine serum), followed by serial two-fold dilutions of each sample in duplicates across the plate. Plates were incubated with the test serum samples for 2 h at 37 °C. After rigorous plate washes in a microplate washer, a secondary antibody (anti-hamster IgG) conjugated to HRP (6060-05, SouthernBiotech, Birmingham, AL) was added to wells at 1:4000 dilution (hamster IgG ELISA). Plates were incubated with secondary antibody for 1 h, washed, and ABTS/H₂O₂ peroxidase substrate (SeraCare, Gaithersburg, MD) was added to assay wells. After 20 to 30 min at ambient temperature, reactions were stopped with 1% SDS, and OD₄₀₅ values were captured on the Versamax microplate reader with the Softmax Pro 7 software installed (Molecular Devices, San Jose, CA). The assay endpoint was a mean OD₄₀₅ of 0.05 for duplicate wells for the full-length S ELISA and a mean OD₄₀₅ of 0.01 for the RBD ELISA. The reciprocal of the highest serum dilution at which the mean OD₄₀₅ value averaged ≥0.05 (full-length S ELISA) or ≥0.01 (RBD ELISA) was the IgG titer. To determine the serum IgA antibody titers, each test serum sample was diluted from 1:160. The sandwich Rabbit anti-hamster IgA antibody (sab 3001a, Brookwood Biomedical, Jemison, Alabama) was added at 1:4000 dilution followed by 1:4000 Goat anti-rabbit-HRP (4030-05, Southern Biotech, Birmingham, AL).

Statistical analysis

One-way ANOVA was used to calculate statistical significance through GraphPad Prism (9.1.2) software for Windows, GraphPad Software, San Diego, California, USA.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The RNA-seq datasets have been submitted to The National Center for Biotechnology Information. Raw and processed data have been deposited to NCBI (GEO accession number GSE199922s). Metadata file submitted for GEO submission along with the fastq files are included in Supplementary Data File. All unique/stable reagents generated in this study are available from the Lead Contact with a completed Materials Transfer Agreement. Source data are provided with this paper.

References

Ella, R. et al. Efficacy, safety, and lot-to-lot immunogenicity of an inactivated SARS-CoV-2 vaccine (BBV152): interim results of a randomised, double-blind, controlled, phase 3 trial. Lancet 398, 2173–2184 (2021).
Article CAS PubMed PubMed Central Google Scholar
Mok, C. K. P. et al. Comparison of the immunogenicity of BNT162b2 and CoronaVac COVID-19 vaccines in Hong Kong. Respirology https://doi.org/10.1111/resp.14191 (2021).
Khoury, D. S. et al. Neutralizing antibody levels are highly predictive of immune protection from symptomatic SARS-CoV-2 infection. Nat. Med. 27, 1205–1211 (2021).
Article CAS PubMed Google Scholar
Tartof, S. Y. et al. Effectiveness of mRNA BNT162b2 COVID-19 vaccine up to 6 months in a large integrated health system in the USA: a retrospective cohort study. Lancet 398, 1407–1416 (2021).
Article CAS PubMed PubMed Central Google Scholar
Abu-Raddad, L. J. et al. Effect of mRNA vaccine boosters against SARS-CoV-2 omicron infection in Qatar. N. Engl. J. Med. https://doi.org/10.1056/NEJMoa2200797 (2022).
Andrews, N. et al. Covid-19 vaccine effectiveness against the omicron (B.1.1.529) variant. N. Engl. J. Med. https://doi.org/10.1056/NEJMoa2119451 (2022).
Chenchula, S., Karunakaran, P., Sharma, S. & Chavan, M. Current evidence on efficacy of COVID-19 booster dose vaccination against the Omicron variant: A systematic review. J. Med. Virol. https://doi.org/10.1002/jmv.27697 (2022).
Tseng, H. F. et al. Effectiveness of mRNA-1273 against SARS-CoV-2 Omicron and Delta variants. Nat. Med. https://doi.org/10.1038/s41591-022-01753-y (2022).
Minka, S. O. & Minka, F. H. A tabulated summary of the evidence on humoral and cellular responses to the SARS-CoV-2 Omicron VOC, as well as vaccine efficacy against this variant. Immunol. Lett. 243, 38–43 (2022).
Article CAS PubMed PubMed Central Google Scholar
Cele, S. et al. Omicron extensively but incompletely escapes Pfizer BNT162b2 neutralization. Nature 602, 654–656 (2022).
Article ADS CAS PubMed Google Scholar
Zinatizadeh, M. R. et al. Efficacy of mRNA, adenoviral vector, and perfusion protein COVID-19 vaccines. Biomed. Pharmacother. 146, 112527 (2022).
Article CAS PubMed Google Scholar
Krammer, F. SARS-CoV-2 vaccines in development. Nature 586, 516–527 (2020).
Article ADS CAS PubMed Google Scholar
Wang, Y. et al. Scalable live-attenuated SARS-CoV-2 vaccine candidate demonstrates preclinical safety and efficacy. Proc. Natl Acad. Sci. USA 118, https://doi.org/10.1073/pnas.2102775118 (2021).
Wang, P. et al. Characterization of an attenuated SARS-CoV-2 variant with a deletion at the S1/S2 junction of the spike protein. Nat. Commun. 12, 2790 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Lau, S. Y. et al. Attenuated SARS-CoV-2 variants with deletions at the S1/S2 junction. Emerg. Microbes Infect. 9, 837–842 (2020).
Article CAS PubMed PubMed Central Google Scholar
Johnson, B. A. et al. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature 591, 293–299 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Sasaki, M. et al. SARS-CoV-2 bearing a mutation at the S1/S2 cleavage site exhibits attenuated virulence and confers protective immunity. mBio 12, e0141521 (2021).
Article PubMed Google Scholar
Jouvenet, N., Goujon, C. & Banerjee, A. Clash of the titans: interferons and SARS-CoV-2. Trends Immunol. 42, 1069–1072 (2021).
Article CAS PubMed PubMed Central Google Scholar
Xia, H. et al. Evasion of Type I Interferon by SARS-CoV-2. Cell Rep. 33, 108234 (2020).
Article CAS PubMed PubMed Central Google Scholar
Finkel, Y. et al. SARS-CoV-2 uses a multipronged strategy to impede host protein synthesis. Nature 594, 240–245 (2021).
Article ADS CAS PubMed Google Scholar
Kamitani, W., Huang, C., Narayanan, K., Lokugamage, K. G. & Makino, S. A two-pronged strategy to suppress host protein synthesis by SARS coronavirus Nsp1 protein. Nat. Struct. Mol. Biol. 16, 1134–1140 (2009).
Article CAS PubMed PubMed Central Google Scholar
Lokugamage, K. G. et al. Middle east respiratory syndrome coronavirus nsp1 inhibits host gene expression by selectively targeting mRNAs transcribed in the nucleus while sparing mRNAs of cytoplasmic origin. J. Virol. 89, 10970–10981 (2015).
Article CAS PubMed PubMed Central Google Scholar
Schroeder, S. et al. Interferon antagonism by SARS-CoV-2: a functional study using reverse genetics. Lancet Microbe 2, e210–e218 (2021).
Article CAS PubMed PubMed Central Google Scholar
Yuan, S. et al. Nonstructural protein 1 of SARS-CoV-2 is a potent pathogenicity factor redirecting host protein synthesis machinery toward viral RNA. Mol. Cell 80, 1055–1066 e1056 (2020).
Article CAS PubMed PubMed Central Google Scholar
Young, B. E. et al. Effects of a major deletion in the SARS-CoV-2 genome on the severity of infection and the inflammatory response: an observational cohort study. Lancet 396, 603–611 (2020).
Article CAS PubMed PubMed Central Google Scholar
Liu, S. et al. The PRRA insert at the S1/S2 site modulates cellular tropism of SARS-CoV-2 and ACE2 usage by the closely related Bat RaTG13. J. Virol. https://doi.org/10.1128/JVI.01751-20 (2021).
Liu, S., Chou, C. K., Wu, W. W., Luan, B. & Wang, T. T. Stable cell clones harboring self-replicating SARS-CoV-2 RNAs for drug screen. J. Virol. https://doi.org/10.1128/jvi.02216-21 (2022).
Winkler, E. S. et al. SARS-CoV-2 infection of human ACE2-transgenic mice causes severe lung inflammation and impaired function. Nat. Immunol. 21, 1327–1335 (2020).
Article CAS PubMed PubMed Central Google Scholar
Oladunni, F. S. et al. Lethality of SARS-CoV-2 infection in K18 human angiotensin-converting enzyme 2 transgenic mice. Nat. Commun. 11, 6122 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Rathnasinghe, R. et al. Comparison of transgenic and adenovirus hACE2 mouse models for SARS-CoV-2 infection. Emerg. Microbes Infect. 9, 2433–2445 (2020).
Article CAS PubMed PubMed Central Google Scholar
Golden, J. W. et al. Human angiotensin-converting enzyme 2 transgenic mice infected with SARS-CoV-2 develop severe and fatal respiratory disease. JCI Insight 5, https://doi.org/10.1172/jci.insight.142032 (2020).
Yinda, C. K. et al. K18-hACE2 mice develop respiratory disease resembling severe COVID-19. PLoS Pathog 17, e1009195 (2021).
Rathnasinghe, R. et al. Comparison of transgenic and adenovirus hACE2 mouse models for SARS-CoV-2 infection. Emerg Microbes Infect 9, 2433–2445 (2020).
Bao, L. et al. The pathogenicity of SARS-CoV-2 in hACE2 transgenic mice. Nature 583, 830–833 (2020).
Article ADS CAS PubMed Google Scholar
Sia, S. F. et al. Pathogenesis and transmission of SARS-CoV-2 in golden hamsters. Nature 583, 834–838 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Chan, J. F. et al. Simulation of the clinical and pathological manifestations of coronavirus disease 2019 (COVID-19) in a golden Syrian hamster model: implications for disease pathogenesis and transmissibility. Clin. Infect. Dis. 71, 2428–2446 (2020).
Article CAS PubMed Google Scholar
Imai, M. et al. Syrian hamsters as a small animal model for SARS-CoV-2 infection and countermeasure development. Proc. Natl Acad. Sci. USA 117, 16587–16595 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Selvaraj, P. et al. SARS-CoV-2 infection induces protective immunity and limits transmission in Syrian hamsters. Life Sci. Alliance 4, https://doi.org/10.26508/lsa.202000886 (2021).
Shirato, K., Kawase, M. & Matsuyama, S. Wild-type human coronaviruses prefer cell-surface TMPRSS2 to endosomal cathepsins for cell entry. Virology 517, 9–15 (2018).
Article CAS PubMed Google Scholar
Bestle, D. et al. TMPRSS2 and furin are both essential for proteolytic activation of SARS-CoV-2 in human airway cells. Life Sci. Alliance 3, https://doi.org/10.26508/lsa.202000786 (2020).
Zhou, P. et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579, 270–273 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Hoffmann, M. et al. Chloroquine does not inhibit infection of human lung cells with SARS-CoV-2. Nature 585, 588–590 (2020).
Article ADS CAS PubMed Google Scholar
Hoffmann, M. et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell 181, 271–280 e278 (2020).
Article CAS PubMed PubMed Central Google Scholar
Shang, J. et al. Cell entry mechanisms of SARS-CoV-2. Proc. Natl Acad. Sci. USA 117, 11727–11734 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Heffron, A. S. et al. The landscape of antibody binding in SARS-CoV-2 infection. PLoS Biol. 19, e3001265 (2021).
Article CAS PubMed PubMed Central Google Scholar
Smith, N. et al. Distinct systemic and mucosal immune responses during acute SARS-CoV-2 infection. Nat. Immunol. 22, 1428–1439 (2021).
Article CAS PubMed PubMed Central Google Scholar
Azzi, L. et al. Mucosal immune response in BNT162b2 COVID-19 vaccine recipients. EBioMedicine 75, 103788 (2022).
Article CAS PubMed Google Scholar
King, R. G. et al. Single-dose intranasal administration of AdCOVID elicits systemic and mucosal immunity against SARS-CoV-2 and fully protects mice from lethal challenge. Vaccines 9, https://doi.org/10.3390/vaccines9080881 (2021).
Alu, A. et al. Intranasal COVID-19 vaccines: from bench to bed. EBioMedicine 76, 103841 (2022).
Article CAS PubMed PubMed Central Google Scholar
Hassan, A. O. et al. A single-dose intranasal ChAd vaccine protects upper and lower respiratory tracts against SARS-CoV-2. Cell 183, 169–184 e113 (2020).
Article CAS PubMed PubMed Central Google Scholar
Tarke, A. et al. SARS-CoV-2 vaccination induces immunological T cell memory able to cross-recognize variants from Alpha to Omicron. Cell 185, 847–859 e811 (2022).
Article CAS PubMed PubMed Central Google Scholar
Liu, J. et al. Vaccines elicit highly conserved cellular immunity to SARS-CoV-2 Omicron. Nature 603, 493–496 (2022).
Article ADS CAS PubMed PubMed Central Google Scholar
Stauft, C. B., Selvaraj, P., Lien, C. Z., Starost, M. F. & Wang, T. T. Long-term immunity in convalescent Syrian hamsters provides protection against new-variant SARS-CoV-2 infection of the lower but not upper respiratory tract. J. Med. Virol. https://doi.org/10.1002/jmv.27641 (2022).
Chandrashekar, A. et al. Prior infection with SARS-CoV-2 WA1/2020 partially protects rhesus macaques against reinfection with B.1.1.7 and B.1.351 variants. Sci. Transl. Med. 13, eabj2641 (2021).
Article CAS PubMed PubMed Central Google Scholar
Deng, W. et al. Primary exposure to SARS-CoV-2 protects against reinfection in rhesus macaques. Science 369, 818–823 (2020).
Article ADS CAS PubMed Google Scholar
Chandrashekar, A. et al. SARS-CoV-2 infection protects against rechallenge in rhesus macaques. Science 369, 812–817 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Xie, X. et al. An infectious cDNA Clone of SARS-CoV-2. Cell Host Microbe 27, 841–848 e843 (2020).
Article CAS PubMed PubMed Central Google Scholar
Xie, X. et al. Engineering SARS-CoV-2 using a reverse genetic system. Nat. Protoc. 16, 1761–1784 (2021).
Article CAS PubMed PubMed Central Google Scholar
Stauft, C. B., Lien, C. Z., Selvaraj, P., Liu, S. & Wang, T. T. The G614 pandemic SARS-CoV-2 variant is not more pathogenic than the original D614 form in adult Syrian hamsters. Virology 556, 96–100 (2021).
Article CAS PubMed Google Scholar
Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl Acad. Sci. USA 102, 15545–15550 (2005).
Article ADS CAS PubMed PubMed Central Google Scholar
Meseda, C. A. et al. MVA vector expression of SARS-CoV-2 spike protein and protection of adult Syrian hamsters against SARS-CoV-2 challenge. NPJ Vaccines 6, 145 (2021).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We would like to thank the White Oak FDA Animal Program staff and veterinarians for their assistance in the study. We are grateful to Dr. Pei-Yong Shi (UTMB) for the original 7 plasmids to perform SARS-CoV-2 reverse genetics. The following reagents were deposited by the Centers for Diseases Control and Prevention and obtained through Biodefense and Emerging Infections Research Resources Repository, NIAID, NIH: SARS-Related Coronavirus 2, Isolate USA-WA1/2020, NR-52281. We thank Drs. Major and Levis for critical review of the manuscript. The work described in this manuscript was supported by US FDA intramural research funds. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The content of this publication does not reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the US Government.

Author information

These authors contributed equally: Shufeng Liu, Charles B. Stauft, Prabhuanand Selvaraj, Prabha Chandrasekaran, Felice D’Agnillo.

Authors and Affiliations

Division of Viral Products, Center for Biologics Evaluation and Research, Food and Drug Administration, Silver Spring, MD, USA
Shufeng Liu, Charles B. Stauft, Prabhuanand Selvaraj, Christopher Z. Lien, Clement A. Meseda, Cyntia L. Pedro, Jerry P. Weir & Tony T. Wang
Laboratory of Clinical Investigation, National Institutes of Aging, National Institutes of Health, Baltimore, USA
Prabha Chandrasekaran
Laboratory of Biochemistry and Vascular Biology, Center for Biologics Evaluation and Research, Food and Drug Administration, Silver Spring, MD, USA
Felice D’Agnillo
Facility for Biotechnology Resources, Center for Biologics Evaluation and Research, Food and Drug Administration, Silver Spring, MD, USA
Chao-Kai Chou & Wells W. Wu
Division of Veterinary Resources, Diagnostic and Research Services Branch, National Institutes of Health, Rockville Pike, USA
Matthew F. Starost

Authors

Shufeng Liu
View author publications
You can also search for this author in PubMed Google Scholar
Charles B. Stauft
View author publications
You can also search for this author in PubMed Google Scholar
Prabhuanand Selvaraj
View author publications
You can also search for this author in PubMed Google Scholar
Prabha Chandrasekaran
View author publications
You can also search for this author in PubMed Google Scholar
Felice D’Agnillo
View author publications
You can also search for this author in PubMed Google Scholar
Chao-Kai Chou
View author publications
You can also search for this author in PubMed Google Scholar
Wells W. Wu
View author publications
You can also search for this author in PubMed Google Scholar
Christopher Z. Lien
View author publications
You can also search for this author in PubMed Google Scholar
Clement A. Meseda
View author publications
You can also search for this author in PubMed Google Scholar
Cyntia L. Pedro
View author publications
You can also search for this author in PubMed Google Scholar
Matthew F. Starost
View author publications
You can also search for this author in PubMed Google Scholar
Jerry P. Weir
View author publications
You can also search for this author in PubMed Google Scholar
Tony T. Wang
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

S.L. and T.T.W. designed the attenuation strategy; S.L. generated the constructs, characterized the recombinant viruses, and developed methods; C.B.S., P.S., C.Z.L., and T.T.W. performed the in vivo studies and analyzed data; F.D. performed lung immunofluorescence analyses; C.C. and W.W.W. performed RNAseq and wrote methods; P.C. analyzed RNAseq data and wrote methods; C.A.M., C.L.P., and J.P.W. measured antibody titers; M.F.S. assessed pathology; S.L., C.B.S., F.D., and T.T.W. wrote the paper.

Corresponding author

Correspondence to Tony T. Wang.

Ethics declarations

Competing interests

S.L., C.B.S, P.S., C.Z.L., and T.T.W. are inventors on a patent filed by the U.S. FDA based on the results described in this manuscript. The remaining authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Kai Dallmeier and the other anonymous reviewer(s) for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Supplementary Data File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Liu, S., Stauft, C.B., Selvaraj, P. et al. Intranasal delivery of a rationally attenuated SARS-CoV-2 is immunogenic and protective in Syrian hamsters. Nat Commun 13, 6792 (2022). https://doi.org/10.1038/s41467-022-34571-4

Download citation

Received: 10 May 2022
Accepted: 31 October 2022
Published: 10 November 2022
DOI: https://doi.org/10.1038/s41467-022-34571-4

This article is cited by

Clinical characteristics and host immunity responses of SARS-CoV-2 Omicron variant BA.2 with deletion of ORF7a, ORF7b and ORF8
- Zhizhong Tang
- Pei Yu
- Tianxing Ji
Virology Journal (2023)
Intranasal or airborne transmission-mediated delivery of an attenuated SARS-CoV-2 protects Syrian hamsters against new variants
- Charles B. Stauft
- Prabhuanand Selvaraj
- Tony T. Wang
Nature Communications (2023)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.