P-selectin mobility undergoes a sol-gel transition as it diffuses from exocytosis sites into the cell membrane

Hellen, Nicola; Mashanov, Gregory I.; Conte, Ianina L.; le Trionnaire, Sophie; Babich, Victor; Knipe, Laura; Mohammed, Alamin; Ogmen, Kazim; Martin-Almedina, Silvia; Török, Katalin; Hannah, Matthew J.; Molloy, Justin E.; Carter, Tom

doi:10.1038/s41467-022-30669-x

Download PDF

Article
Open access
Published: 31 May 2022

P-selectin mobility undergoes a sol-gel transition as it diffuses from exocytosis sites into the cell membrane

Nature Communications volume 13, Article number: 3031 (2022) Cite this article

1438 Accesses
4 Citations
1 Altmetric
Metrics details

Subjects

Abstract

In response to vascular damage, P-selectin molecules are secreted onto the surface of cells that line our blood vessels. They then serve as mechanical anchors to capture leucocytes from the blood stream. Here, we track individual P-selectin molecules released at the surface of live endothelial cells following stimulated secretion. We find P-selectin initially shows fast, unrestricted diffusion but within a few minutes, movement becomes increasingly restricted and ~50% of the molecules become completely immobile; a process similar to a sol-gel transition. We find removal of the extracellular C-type lectin domain (ΔCTLD) and/or intracellular cytoplasmic tail domain (ΔCT) has additive effects on diffusive motion while disruption of the adapter complex, AP2, or removal of cell-surface heparan sulphate restores mobility of full-length P-selectin close to that of ΔCT and ΔCTLD respectively. We have found P-selectin spreads rapidly from sites of exocytosis and evenly decorates the cell surface, but then becomes less mobile and better-suited to its mechanical anchoring function.

Fibroblast and myofibroblast activation in normal tissue repair and fibrosis

Article 08 April 2024

Quantification of absolute labeling efficiency at the single-protein level

Article Open access 24 April 2024

Universal recording of immune cell interactions in vivo

Article 06 March 2024

Introduction

P-selectin (CD62P) is a type I transmembrane protein that is stored in specialized sub-cellular granules called Weibel–Palade Bodies (WPBs) that are present in blood vessel endothelial cells. It is secreted from the WPBs into the plasma membrane in response to vascular damage and functions in the early stages of defense against infection by recruiting circulating leukocytes from the bloodstream to the vessel wall. To capture leukocytes, P-selectin binds to a receptor, P-selectin glycoprotein ligand-1 (PSGL-1) present on the leukocyte membrane¹. The P-selectin:PSGL-1 interaction has very fast binding (k_on) and fast unbinding (k_off) kinetics, thought to be important for efficient capture and subsequent rolling of leukocytes^2,3,4. Bond lifetime (determined by k_off) is load-dependent and shows a combination of catch- and slip-bond behavior⁵ and bound lifetime peaks at approximately ~10–20 pN force. Importantly, we do not understand how P-selectin can spread with ease across the plasma membrane of the endothelial cell and yet bear the high forces required for the catch-bond formation and efficient leukocyte capture. To address this, we used total internal reflection fluorescence (TIRF) video microscopy to study the movement of individual P-selectin molecules following stimulated release from WPBs in live human endothelial cells (HUVECs).

P-selectin is a modular protein consisting of a series of domains that determine its intracellular trafficking and its function on the cell surface (Supplementary Fig. 1). We reasoned that its structure was likely to impact its mobility at the plasma membrane. The extracellular portion consists of an N-terminal, Ca²⁺-dependent (C-type) lectin domain (CTLD) responsible for binding to PSGL-1, but which can also bind glycosaminoglycans (GAGs)⁶ found in the glycocalyx and basement membranes of endothelial cells⁷. Below the CTLD is an EGF-like domain and nine consensus repeat domains (CRs) that give an extended conformation of ~38 nm⁸. Removal of five or more CRs prevents leukocyte adhesion underflow, while disruption of the extracellular glycocalyx partially rescued the effect, indicating that the full-length CR region acts to project the CTLD through the surface glycocalyx⁹. Measurement of elasticity¹⁰ and bending rigidity¹¹ suggest the extracellular portion of the molecule behaves as a linear spring capable of sustaining large forces. The transmembrane region consists of a single-pass helix which is followed by a short, intracellular, cytoplasmic tail (CT) that contains sorting information to direct newly-synthesized P-selectin to WPBs¹². The WPB membrane, therefore, acts as a storage reservoir for P-selectin¹³, so large amounts can be rapidly delivered to the plasma membrane following stimulated exocytosis. After stimulation, cell-surface P-selectin levels increase, up to fourfold, peaking by 2–3 min before declining to low levels over 10–20 min¹⁴. The in vivo estimate of the average P-selectin density following stimulation (25–50 molecules/µm²)¹⁵ is similar to that required for leukocyte adhesion and rolling in vitro^16,17. Clustering of P-selectin is seen at later times after secretion¹⁶ that may arise through sequestration into clathrin-coated pits (CCPs)¹⁸ and/or into special microdomains close to CCPs in a CD63-dependent fashion¹⁹, although the precise mechanism remains unclear. Clustering may give rise to regions of high local density which may be important in preventing internalization and promoting cell-cell adhesion^18,19. The CT does not bind actin or actin-binding proteins²⁰, but its interaction with other molecules, such as the AP2 complex²¹ located at the plasma membrane may affect mobility.

In the current study, we use single fluorophore imaging to show how P-selectin molecules diffuse rapidly and in an unrestricted manner following release from sites of exocytosis, but over a period of several minutes, diffusive motion becomes anomalous and an increasing number of molecules become immobile. We present a simple mechanical model to describe the anomalous diffusive behavior and show that both intracellular and extracellular regions of P-selectin are important in progressively slowing and restricting P-selectin movement, making it better-suited to its known leukocyte anchoring function.

Results and discussion

Mobility of full-length P-selectin following exocytosis

We first investigated the mobility of full-length P-selectin-eGFP by imaging the movement of individual molecules released by histamine-evoked WPB exocytosis. Regions of interest (ROIs) in video recordings, centered on individual WPBs, were concatenated so that multiple secretion events could be analyzed (Supplementary Movie 1). Single molecules (SMs) were identified by their characteristic diffraction-limited spot-size, single GFP intensity level, and single-step photobleaching behavior²². SMs were localized with ~25 nm precision in each video frame and tracked from frame to frame using image analysis software²³ (Fig. 1a–d). We validated our ability to track individual molecules present at different surface densities and with different diffusion coefficients using simulated data sets with identical signal-to-noise to our real data sets as described previously²⁴.

**Fig. 1: Mobility of full-length P-selectin-eGFP slows and becomes more restricted with time after exocytosis from WPBs.**

Molecular trajectories were analyzed by plotting mean-squared displacement against time interval (MSD vs dT). For unconstrained diffusion, trajectories should follow a random Brownian walk and MSD vs dT plots will be linear with gradient 4D_lat (where D_lat is the two-dimensional lateral diffusion coefficient). Deviation from linearity indicates anomalous diffusion; downward-curvature indicates constrained motion, upward curvature convective flow or motorized motion²². For the first few seconds after exocytosis MSD vs dT plots were approximately linear, indicating unconstrained, diffusion (Fig. 1e). We found no evidence for motorized or convective motion. Each trajectory was color-coded according to its diffusion coefficient (D_lat), determined from the initial gradient of the MSD vs dT plot, and all trajectories were then overlaid in a single image as a heat-map (Fig. 1a–d). The median D_lat ~0.2 μm² s⁻¹ is similar to the value expected from the Saffman–Delbruck model for membrane protein diffusion²⁵. We noticed that constitutively-released P-selectin molecules, present at low density prior to stimulation, showed highly-restricted, anomalous diffusion (Fig. 1a and Supplementary Fig. 2) which was in marked contrast to the freshly released P-selectin molecules (Fig. 1b). Based on this observation we explored how the diffusive motion of P-selectin changed with time after secretion. After 2–3 min, P-selectin had spread out over the entire plasma membrane (Fig. 1c), but the diffusive motion was now slower and more constrained (Fig. 1e) with MSD vs dT plots showing distinct downward-curvature. Also, at later times, the number of immobile molecules increased significantly (Fig. 1d, f). These time-dependent changes in mobility appear similar to a sol-gel transition, like an agar solution gradually setting to a gel as it cools. Freshly released P-selectin molecules at first move freely but with time somehow become ensnared.

Molecular basis for time-dependent changes in P-selectin mobility

We compared a panel of P-selectin deletion mutants lacking specific functional domains, including the cytoplasmic tail (ΔCT), the C-type lectin domain (ΔCTLD), the CTLD and EGF-like domains (ΔCTLD-EGF), consensus repeat domains (Δ4CR and Δ8CR), and a highly-truncated molecule consisting of just the transmembrane helix, CR9 and EGF domains (which we term “TMD”) (Supplementary Fig. 3a). All of the mutants with the exception of TMD localized correctly to WPBs (Supplementary Fig. 3b-h) and SMs were released during histamine-evoked exocytosis (Fig. 2a–c). Both ΔCTLD and ΔCTLD-EGF mutants showed an identical increase in mobility at exocytosis (Fig. 2b–d), indicating the N-terminal CTLD hinders P-selectin movement even at the earliest time point. The TMD mutant, which was present constitutively at the plasma membrane, exhibited rapid and unconstrained diffusion (D_lat = 0.4 μm² s⁻¹, see Fig. 3a) similar to ΔCTLD and ΔCTLD-EGF mutants at the time of exocytosis (Fig. 2b). The ΔCT, Δ4CR, and Δ8CR mutants showed little difference compared to the parent molecule at the time of secretion (summarized in Fig. 2b-d). At later times, the MSD vs dT relationships for ΔCTLD and ΔCT showed much less-pronounced downward-curvature than the full-length molecule (Fig. 3a, b). Together, these findings indicate that the time-dependent changes in mobility are unlikely to be due to lipid mixing between WPB and plasma membranes, but instead are controlled by the independent and additive effects of the protruding CTLD and CT domains.

**Fig. 2: Deletion of CTLD increases P-selectin mobility at exocytosis sites.**

**Fig. 3: CT and CTLD independently shape P-selectin mobility at steady-state.**

A simple mechanical model for changes in diffusive behavior

The downward-curvature of MSD vs dT plots (Fig. 3a) is indicative of anomalous sub-diffusion which can arise from different physical phenomena; e.g., heterogeneity in lipid composition (e.g., lipid rafts) or interactions between P-selectin and components of cortical assemblies or the extracellular matrix leading to so-called “caged” or “hop-diffusion”²⁶. Since the motion of proteins in lipid bilayers is over-damped, inertial forces can be ignored and the balance of thermal, viscous, and elastic forces can be modeled empirically as a Kelvin–Voigt mechanical system of parallel viscous (β) and elastic (κ) elements. The model, shown in Fig. 3c, gives an expected MSD vs dT relationship given by ref. ²⁷ Eq. (1).

$${{{{{{{\mathrm{MSD}}}}}}}}_{\varDelta t}=\,\frac{4\cdot {k}_{B}T}{{{\kappa }}}\left(1-{e}^{\frac{-{{\kappa }}\Delta t}{{{\beta }}}}\right)$$

(1)

Where thermal energy is k_BT and β and κ are the sum of viscous and elastic elements (Fig. 3e). The derivative of Eq. (1) gives an initial gradient (at Δt = 0): $\frac{4\cdot {k}_{B}T}{\beta }=4{D}_{{{{{{{\mathrm{lat}}}}}}}}$ as expected for two-dimensional diffusion, while the limiting plateau amplitude ($\overline{{{{{{{\mathrm{MSD}}}}}}}}$ at Δt = ∞) is given by: $\overline{{{{{{{\mathrm{MSD}}}}}}}}=\frac{4\cdot {k}_{B}T}{\kappa }$.

MSD vs dT plots were fitted individually to Eq. 1 to give an estimate of the lumped κ and β for each protein tested and these values were then used to derive the diffusion coefficient, D_lat and $\overline{{{{{{{\mathrm{MSD}}}}}}}}$ (Fig. 3d). Global fitting (Microsoft Excel “Solver” function) to all of the MSD vs dT data sets by variance-weighted, least-squares minimization, using the equations given in Fig. 3e (line fits shown in Fig. 3a) gave estimates of κ_CT = 45 nN m⁻¹; κ_CTLD = 65 nN m⁻¹ and D_lat = (k_BT/β_CT) = 0.48 μm² s⁻¹; (k_BT/β_TMD) = 0.41 μm² s⁻¹; (k_BT/β_CTLD) > 10 μm² s⁻¹. The results are consistent with a simple visual inspection of the graphs which indicates the asymptotic diffusion distance, $\overline{{{{{{{\mathrm{MSD}}}}}}}}$, for the full-length protein (given by 4k_bT/(κ_CTLD + κ_CT) ≈0.15 μm²) increases by a similar amount (to ~0.35 μm²) when either the CT or CTLD regions are removed and when both regions are removed (TMD mutant) the $\overline{{{{{{{\mathrm{MSD}}}}}}}}$, becomes larger still (in our simple model tending to infinity). So, the simplest interpretation is that the CT and CTLD regions act as independent visco-elastic elements that are combined in parallel with viscous drag contributions dominated by the membrane-spanning helix (TMD) and CT regions (Fig. 3c).

High-resolution single fluorophore tracking reveals stochastic pausing

To gain a better understanding of the physical factors that might manifest as springs and dashpots in the model, thereby shaping the mobility of full-length P-selectin, we used the bright and photostable fluorophore, Cy3B, to perform high-precision SM localization over extended time periods. The P-selectin ectodomain was labeled using the anti-P-selectin antibody, AK6, covalently-conjugated to Cy3B (AK6-Cy3B), and as control Cy3B labeled isotype mouse IgG (IgG-Cy3B) using conditions that gave ~1:1 labeling stoichiometry (see Methods and Supplementary Fig. 4). AK6 is thought to bind within the CR region of P-selectin’s ectodomain and was chosen because it does not interfere with P-selectin function²⁸ or the internalization and intracellular trafficking of the molecule¹². Binding specificity in live cells was confirmed using IgG-Cy3B as a negative control (Supplementary Figs. 4h-k and 5a). SM tracking of AK6-Cy3B bound to P-selectin gave MSD vs dT relationships, estimates of D_lat and MF similar to full-length P-selectin-eGFP (Supplementary Fig. 5c, d). Two-color imaging confirmed single AK6-Cy3B and P-selectin-eGFP co-localized and moved together (Supplementary Fig. 5e). Using AK6-Cy3B we confirmed that the steady-state mobility of P-selectin on the apical membrane was identical to that on the basolateral membrane (Supplementary Fig. 6). Close inspection of the AK6-Cy3B data revealed that a small number of trajectories (3.4%) showed diffusive motion that was interspersed with distinct pauses (Fig. 4a). Pause durations showed an exponential distribution with a time constant of ~0.4 s (Fig. 4b). The stochastic stalling behavior may belie the cause of restricted anomalous diffusion observed for full-length P-selectin at steady-state.

**Fig. 4: P-selectin undergoes transient binding interactions during diffusion at steady-state.**

Identifying molecular interactions that limit P-selectin mobility

To further investigate the molecular basis for the independent contribution of the CT to P-selectin mobility we first disrupted the actin cytoskeleton using cytochalasin D. We found little effect on steady-state P-selectin mobility (Supplementary Fig. 7) consistent with previous studies indicating P-selectin does not bind actin or actin-binding proteins²⁰. The best-characterized plasma membrane-associated interactor for P-selectin CT is the μ2 subunit of AP2²¹. Binding to AP2 is thought to cluster P-selectin at the cell surface, a process that may facilitate its function as a leukocyte adhesion molecule¹⁸. In live cells, we observed a population of immobile eGFP puncta with intensities that were greater than expected for individual fluorophores. A histogram of the intensity distribution measured in the eGFP channel for these puncta showed a broad distribution with an average value equivalent to ~8 eGFP molecules suggesting they reflect regions of P-selectin clustering (Supplementary Fig. 8). Further analysis showed that a subset of P-selectin-eGFP puncta co-localize with endogenous AP2 at the cell surface in a CT-dependent fashion (Supplementary Fig. 9). To test the role of AP2 in shaping P-selectin mobility we disrupted the AP2 complex by siRNA (Supplementary Fig. 10), and found that both the MF and $\overline{{{{{{{\mathrm{MSD}}}}}}}}$ for P-selectin-eGFP significantly increased at steady-state (Fig. 5). A similar change was observed with the ΔCTLD mutant (Fig. 5). We next over-expressed AP2µ2-mCherry and confirmed that it co-localized with the endogenous AP2 complex and P-selectin-eGFP in a CT-dependent fashion (Supplementary Fig. 11). Overexpression of AP2µ2-mCherry was found to reduce $\overline{{{{{{{\mathrm{MSD}}}}}}}}$ but not mobility (Fig. 5b, c). The effects of either knocking down or over-expressing AP2 are consistent with its interactions with the CT region of P-selectin causing reduced mobility at steady-state. We noticed that disruption of the AP2 complex did not render the ΔCTLD mutant freely mobile (i.e., like TMD) and this may reflect the presence of residual AP2 in the siRNA-treated cells, although additional mechanisms may operate to restrict P-selectin diffusion. It is known that CD63 plays a role in leukocyte adhesion^19,29 and that it co-localizes with P-selectin in clusters distinct from CCPs on the plasma membrane¹⁹. In preliminary dual-color single fluorophore tracking experiments, we found that although the majority of individual eGFP-CD63 and Cy3B-labeled P-selectin molecules diffused independently, there was a small proportion (~0.5%) of freely-diffusing co-incident single-molecule tracks while about 5% of the total signal co-localized to immobile puncta which exhibited fluorescence greater than expected for a single eGFP:Cy3B fluorophore pair. Our estimates of CD63:P-selectin complex formation should be considered lower bounds because of the presence of unlabeled CD63 and P-selectin in the cells. Importantly, these experiments raise the possibility that some mobile P-selectin molecules might be chaperoned by CD63 while others¹⁹, might form static, multimeric, complexes with CD63 (Supplementary Fig. 12).

**Fig. 5: At steady-state P-selectin-CT shapes mobility via AP2.**

We next looked at the effects of the CTLD on P-selectin mobility. It is known that the CTLD can bind heparan sulfate (HS), the major extracellular glycan species⁶ present in the apical glycocalyx and basement membrane of endothelial cells⁷. So, we hypothesized that the binding of CTLD to HS might also shape the diffusive behavior of P-selectin. To test this, we removed cell-surface HS using heparanase III (Fig. 6a, b) and found an increase in D_lat and MF for P-selectin-eGFP to levels similar to ΔCTLD (Fig. 6g, h). Analysis of individual trajectories using AK6-Cy3B labeling showed a tenfold reduction in the frequency of pausing events following heparanase III treatment, (0.45%, n = 5431 molecular trajectories, six cells), although pause durations were similar (τ = 0.45 vs 0.46 s, respectively). Treatment of cells to remove chondroitin sulfate (chondroitinase ABC, Fig. 6c, d) or sialic acid (neuraminidase; Fig. 6e, f) did not alter P-selectin mobility (Fig. 6g, h). Finally, to test whether P-selectin mobility is altered in cells exposed to pro-inflammatory stimuli, we treated HUVEC with IL-1ß under conditions that upregulate cytokine expression³⁰ and found no significant change in steady-state mobility of full-length P-selectin (Supplementary Fig. 13).

**Fig. 6: Plasma membrane heparan sulfate slows P-selectin mobility.**

It is possible that the mixing of WPB membrane lipids with the plasma membrane at the time of exocytosis might generate a lipid microenvironment with distinct properties³¹. However, lipid released from the WPB envelope should mix and equilibrate rapidly with the plasma membrane lipids and the fast and unconstrained motion of the TMD mutant seen at steady-state, strongly suggests that changes in the lipid phase (reported by β_TMD in our model) cannot account for the time-dependent changes in the anomalous diffusion of P-selectin following exocytosis. Instead, our results show that the independent and additive interactions between the CT and CTLD regions with intra- and extracellular assemblies are the dominant contributors to the time-dependent restriction of P-selectin mobility. At steady-state we observed P-selectin-eGFP clustering into immobile puncta, that localized with the CCP-associated component AP2 (Supplementary Figs. 8 and 9). Clustering of secreted P-selectin into immobile structures may provide a way of increasing the local concentration of molecules thereby enhancing avidity by increasing the number of CTLD-PSGL-1 bonds providing a more stable platform to support leukocyte adhesion^18,19.

Restriction to mobility contributed by the ectodomain was mediated primarily by the CTLD region, whereas the length of the molecule (determined by the number of CR domains) played only a minor role, perhaps by positioning the CTLD within the extracellular environment. The restriction to mobility imposed by the CTLD region both at the time of exocytosis and later at steady-state, suggests CTLD interacts with the extracellular glycocalyx soon after secretion. It has been shown previously that the mobility of integral membrane proteins can be modified through extracellular interactions of their ectodomains^32,33. The apical and basolateral membranes of endothelial cells are covered by a complex assortment of membrane-bound or associated proteo- and lipido-glycans³⁴. HS is the major glycosaminoglycan (GAG; 50–90%) on the endothelial cell-surface³⁵ and plays a vital role in inflammation by presenting chemokines and growth factors to adherent leukocytes as they roll and sample the endothelial surface³⁴. The CTLD region binds HS⁶, and our observation that removal of HS (but not other extracellular GAGs) increased the mobility of full-length P-selectin close to that seen with ΔCTLD mutant provides strong evidence that this GAG shapes P-selectin mobility via interaction with CTLD. Brief pauses in P-selectin movement, consistent with transient binding events (Fig. 4), were dramatically reduced in frequency after HS removal, consistent with CTLD-HS interactions causing stalling. Our finding that HS removal enhances P-selectin mobility and reduces its anomalous diffusive behavior, is counter to the recent observation of enhanced diffusion through polymer gels³⁶. However, such gel network models (with different assumptions or working parameters) may provide a useful basis for better understanding our results.

In conclusion, we have found that time-dependent changes in mobility of P-selectin are controlled by both the CTLD and CT regions of the molecule. While the CTLD region impacts mobility via its interactions with cell-surface heparan sulfate, the CT contribution is relieved by knock-down and enhanced by overexpression of AP2. At steady-state, both regions, act independently and in parallel (Fig. 3c) tending to restrict mobility and thereby anchor P-selectin making it better-suited to its role in leukocyte capture. The relatively slow timescale of changes in mobility (i.e., t = 3 min) is important because it permits P-selectin to diffuse a reasonable linear distance, $\sqrt{{2D}_{{{{{{{\mathrm{lat}}}}}}}}t} \sim 10\mu m$, from the exocytosis site and spread out across the membrane before it becomes less mobile. We still do not understand the detailed chemical changes responsible for P-selectin immobilization.

Methods

Cell culture, transfection, and immunocytochemistry

Human pooled, primary Umbilical Vein Endothelial Cells (HUVEC) (catalog C12203, PromoCell GmbH, Heidelberg, Germany) were cultured (maximum passage, P4) in Medium 199 Earle’s salts + l-Glutamine (Catalog 11150059, Thermo Fisher), supplemented with 20% fetal calf serum, 30 µg/ml Endothelial Cell Growth Supplement, 10 U/ml heparin and 50 µg/ml gentamicin at 37 ^oC in a 5% CO₂ atmosphere. Transfection was by a Nucleofector 2b device (catalog AAB-1001, Lonza, Basel, Switzerland) according to manufacturers’ instructions^37,38,39. Dharmacon ON-TARGET-plus siControl oligonucleotides and pre-validated ON-TARGET-plus siAP2α (siAP2α2) specific oligonucleotide (AAGAGCATGTGCACGCTGGCCA, Horizon Discovery Bioscience, UK⁴⁰) with custom UU overhangs were used. Cells were transfected using 200 pMol siRNA, cultured for 48 h before the second round of transfection with 200 pMol siRNA and P-selectin-eGFP or mutant and 24 h later either fixed for immunocytochemistry or used for live-cell TIRFM imaging.

To remove surface glycans, cultured cells were treated with Heparanase III (3 U/ml, 1 h), Chondroitinase ABC (1 U/ml, 1 h) or Neuraminidase (0.1 U/ml, 1 h) (all reagents from Merck Life Science UK Limited, Gillingham, UK). Antibodies used for immunocytochemistry are in Supplementary Table 1. For immunolabelling, HUVECs were grown on porcine skin gelatin-coated 9 mm diameter, glass coverslips (Catalog G1890, Sigma), fixed with 3% paraformaldehyde in PBS supplemented with 0.2% (w/v) gelatin, 0.02% (w/v) saponin, 3 mM NaN₃, for 15 min prior to antibody labeling. Coverslips were mounted in Mowiol mounting media (Merck, Gillingham, Dorset, UK) and imaged 24 h later.

AK6-Cy3B conjugation and P-selectin labeling

For Cy3B conjugation to the anti-P-selectin Ab, AK6, or control IgG, the Amersham Cy^TM3B mono-reactive NHS ester dye labeling kit was used (GE Healthcare (Buckinghamshire, UK). About 1 mg of dye was dissolved in 100 µl of anhydrous DMSO and the dye concentration was determined by NanoDrop 1000 version 3.6.0 (Thermo Fisher Scientific) using a molar extinction coefficient for Cy3B of 130,000 M⁻¹ cm⁻¹ at 563 nm, after adjustment for the reported batch purities for the reactive NHS ester (lot number 9674850; 82.3%, lot number: 9762352; 86.0%). Mouse IgG (AK6 or control IgG) concentration was calculated using the NanoDrop’s preinstalled settings (210,000 M⁻¹ cm⁻¹ at 280 nm) and the Dye:Protein (Cy3B:IgG) ratio after conjugation, was determined using dual absorbance measurements for IgG and Cy3B. The conjugation reaction reactive dye:IgG molar ratio required to give an approximate 1:1 labeling stoichiometry was determined empirically as 7:1. The reaction was carried out for 60 min at pH 8.5 using sodium borate buffer in the dark and stopped by the addition of an equal volume of sodium dihydrogen orthophosphate (pH 6, 0.2 M). Dye-protein conjugates were separated from unconjugated Cy3B NHS ester using a 7000 molecular weight cut-off Zeba^TM Spin gel filtration desalting spin column (Thermo Scientific, Waltham, MA, United States) equilibrate with 2.5 mL of PBS. About 100 µl ultrapure water was added as a stacker prior to the addition of the reaction mixture before centrifuging at 16,100 × g for between ~12 min using an Eppendorf centrifuge (5415 D). Dye-protein conjugates were stored in the dark at 4 °C. For analysis of P-selectin labeling, internalization, and trafficking in live cells, AK6-Cy3B or control IgG-Cy3B (1:10 dilution) was added to live HUVEC 4 h post nucleofection with WT P-selectin-eGFP and then incubated for 24 h prior to fixation and processing for immuno-labeling with anti-GFP (secondary Cy2) and endogenous VWF (secondary Cy5). For labeling fixed cells with AK6-Cy3B or IgG-Cy3B (1:25), the conjugates were added alone or in combination with primary antibodies during the labeling protocol. For live-cell tracking experiments non-transfected, P-selectin-eGFP or eGFP-CD63 transfected HUVEC (24 h post-transfection) were incubated with AK6-Cy3B or control IgG-Cy3B (1:10 dilution) as appropriate, for 30 min at room temperature in the dark, before being carefully washed prior to imaging.

DNA constructs

WT P-selectin-eGFP, P-selectin-ΔCT-eGFP, and P-selectin-Δ8CR-eGFP were made as previously described^13,41. P-selectin-ΔCTLD-eGFP, P-selectin-ΔCTLD-EGF-eGFP, P-selectin-Δ4CR-eGFP (4CRs removed), and P-selectin-Δ8CR-eGFP (8CRs removed), were made by inverted PCR from the WT P-selectin–eGFP plasmid, utilizing primers with EcoRV site introduced for self-ligation. Primers used for each mutant are shown in Supplementary Table 2. The P-selectin-ΔCT–eGFP construct was generated by removal of the cytoplasmic tail (exons 15 and 16) using primers 5′-CAATTCATCTGTGACGAGGG-3′ (forward) and 5′-GCAAAGTCTGTTTTTCTACTACCCAGCTGATA-3′ (reverse, introducing SalI site). The PCR fragment was digested using PvuI and SalI and ligated into PvuI–SalI-digested P-selectin–eGFP. A different strategy was used to generate P-Selectin-ΔCT-8CR-eGFP; the P-selectin-Δ8CR-eGFP was digested with XcmI and XhoI restriction enzymes and the fragment obtained inserted into XhoI-XcmI digested P-selectin-ΔCT–eGFP. A similar strategy was employed to generate P-Selectin-TMD-eGFP; P-Selectin-ΔCT-eGFP was digested with XcmI and AgeI restriction enzymes and a short fragment was ligated into XcmI-AgeI digested P-Selectin-ΔCT-8CR-eGFP. All constructs were sequence verified. AP2u2-mCherry⁴² was a gift from Christien Merrifield (Addgene plasmid # 27672; http://n2t.net/addgene:27672; RRID:Addgene_27672). Clathrin-GFP⁴³ was from Prof. Margret Robinson (Cambridge University). eGFP-CD63 was a gift from Prof. Paul Luzio, Cambridge University, UK.

Fluorescence microscopy

Confocal microscopy was performed using a Leica TCS SP2 or Bio-Rad Radiance 2100 confocal microscope^39,44 equipped with PL APO 100 × 1.4 NA objective (SP2) or Nikon 60 × 1.4 NA objective lens (Bio-Rad). SM detection and tracking experiments were carried out using a custom-made objective-based Total Internal Reflection Fluorescence (TIRF) microscope^22,45. Dual-color imaging of eGFP and Cy3B was performed using 488 and 561 nm lasers (LightHUB, Omicron, Germany). The two fluorescence emission bands were separated using a dichroic mirror (FF552-Di02) angled at 45^o to the incident light path and the two resulting, orthogonal light paths were then directed via bandpass filters (FF01-525/50 and FF01-593/40, Semrock, NY) onto two separate EMCCD cameras (iXon897BV, Andor Technology Ltd., Belfast, UK). The pixel positions and image focus for the two cameras were co-aligned using a 3-axis positioning device and multi-colored, 100 nm diameter, fluorescent beads adhered to a microscope coverslip were used as fiducial markers (TetraSpeck, Thermo Fisher). Video data were acquired at either 30 or 40 frames s⁻¹ and analyzed using freeware custom software (“GMimPro” available at www.mashanov.uk). Analysis of single AK6-Cy3B fluorophore dwell times was carried out as previously described⁴⁶. The locations of individual eGFP or Cy3B fluorophores were tracked automatically with sub-pixel (~20 nm) resolution. The software tracking criteria were set so that objects had fluorescence intensity similar to a single fluorophore, a waist diameter of ~250 nm, movement <5 pixels (~500 nm) between adjacent frames, and a continuous track length spanning >15 frames. Data for several thousand individual molecules were obtained from multiple exocytosis events and multiple cells by pooling data sets so that MSD vs dT plots, histograms of D_lat estimates, and the immobile fraction for each experimental condition could be quantified. The mobile fraction (MF) was defined by the fraction of SMs with D_lat > 0.05 μm² s⁻¹. Cells were imaged 24–48 h after nucleofection. For analysis of steady-state mobilities, cells were imaged 24 h after nucleofection and selected on the basis of there being abundant single molecules at the plasma membrane but few or no WPBs. For analysis of mobilities during (0–40 s) and shortly after (120–180 s) exocytosis, cells were imaged 48 h after nucleofection and selected on the basis of well-spaced WPBs and few detectable molecules at the plasma membrane.

Statistical analysis

We carried out between three and nine replicate experiments for WT P-selectin and each of the various mutants. For the RNAi and AP2μ2 OE experiments, we carried out three and two replicates respectively. Data in each of the plots were pooled from three (or in the case of OE n = 2) replicate experiments, and are representative of the data from other replicate experiments. Data were plotted in Origin 2018 or GraphPad Prism 8.0.2. Linear and non-linear (exponential) fitting was carried out in Origin 2018 (OriginLabs, Northampton, MA), IGORPRO (WaveMetrics, Portland OR), or Microsoft Excel solver function. Statistical analysis was done by t-test (nonparametric), or by one-way ANOVA using Tukey or Dunnett’s multiple comparisons test as indicated (GraphPad Prism 8.0.2). Significance values (P) for t-test or adjusted P values for ANOVA comparisons are shown where appropriate. MSD vs dT plots were constructed by computing MSD for all pairwise dT intervals for every trajectory in the data set. The MSD estimate at each dT was plotted with s.e.m. shown as error bars. Estimates of D_lat and $\overline{{{{{{{\mathrm{MSD}}}}}}}}$ derived by non-linear least-squares fitting to the MSD vs dT plots are displayed as best fit value ±95% confidence interval. Mobile fractions are plotted as Box and Whisker diagrams (as described in the Figure legends).

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Data availability

Source Data is provided in MS Excel format accompanying this manuscript available online at Nature Communications. An example video, Supplementary Movie 1 is provided online. We find compressed video formats (e.g., AVI, MP4, MOV, WMV, FLV, etc) of mobile single molecules are of low quality as compression algorithms perform poorly with this type of video data. Raw video imaging data, consisting of many tens of gigabytes of separate video data files, are available from the corresponding authors upon reasonable request.

Code availability

The software used for video image analysis and simulation of single fluorophore dynamics is free to download (GMimPro 64-bit Ver 2022. http://www.mashanov.uk/) and used as described in earlier publications^23,24. Other software is either commercial or freeware: Origin 2018 sr1 (OriginLabs, One Roundhouse Plaza, Northampton, MA, USA); GraphPad Prism 9.0.2 (Northside Dr. San Diego, CA, USA); Adobe Photoshop CC vr 23.2.2; ImageJ ver1.53f, http://imagej.nih.gov/ij; MS Office Professional Plus 2019 with Solver add-in, GRG Non-linear, least-squares minimization (Frontline Systems, Inc. Incline Village, NV. USA); IgorPro 8.0, Wavemetrics (Lake Oswego, OR, USA).

References

Moore, K. L. et al. Identification of a specific glycoprotein ligand for P-selectin (CD62) on myeloid cells. J. Cell Biol. 118, 445–456 (1992).
Article CAS PubMed Google Scholar
Mehta, P., Cummings, R. D. & McEver, R. P. Affinity and kinetic analysis of P-selectin binding to P-selectin glycoprotein ligand-1. J. Biol. Chem. 273, 32506–32513 (1998).
Article CAS PubMed Google Scholar
McEver, R. P. Selectins: initiators of leucocyte adhesion and signalling at the vascular wall. Cardiovasc Res. 107, 331–339 (2015).
Article CAS PubMed PubMed Central Google Scholar
McEver, R. P. Rolling back neutrophil adhesion. Nat. Immunol. 11, 282–284 (2010).
Article CAS PubMed PubMed Central Google Scholar
Marshall, B. T. et al. Direct observation of catch bonds involving cell-adhesion molecules. Nature 423, 190–193 (2003).
Article ADS CAS PubMed Google Scholar
Varki, A. Selectin ligands. Proc. Natl Acad. Sci. USA 91, 7390–7397 (1994).
Article ADS CAS PubMed PubMed Central Google Scholar
Rzeniewicz, K. et al. L-selectin shedding is activated specifically within transmigrating pseudopods of monocytes to regulate cell polarity in vitro. Proc. Natl Acad. Sci. USA 112, E1461–E1470 (2015).
Article CAS PubMed PubMed Central Google Scholar
Ushiyama, S., Laue, T. M., Moore, K. L., Erickson, H. P. & McEver, R. P. Structural and functional characterization of monomeric soluble P-selectin and comparison with membrane P-selectin. J. Biol. Chem. 268, 15229–15237 (1993).
Article CAS PubMed Google Scholar
Patel, K. D., Nollert, M. U. & McEver, R. P. P-selectin must extend a sufficient length from the plasma membrane to mediate rolling of neutrophils. J. Cell Biol. 131, 1893–1902 (1995).
Article CAS PubMed Google Scholar
Marshall, B. T. et al. Measuring molecular elasticity by atomic force microscope cantilever fluctuations. Biophys. J. 90, 681–692 (2006).
Article ADS CAS PubMed Google Scholar
Fang, Y., Wu, J., McEver, R. P. & Zhu, C. Bending rigidities of cell surface molecules P-selectin and PSGL-1. J. Biomech. 42, 303–307 (2009).
Article PubMed Google Scholar
Harrison-Lavoie, K. J. et al. P-selectin and CD63 use different mechanisms for delivery to Weibel-Palade bodies. Traffic 7, 647–662 (2006).
Article CAS PubMed Google Scholar
Kiskin, N. I. et al. Protein mobilities and P-selectin storage in Weibel-Palade bodies. J. Cell Sci. 123, 2964–2975 (2010).
Article CAS PubMed PubMed Central Google Scholar
Hattori, R., Hamilton, K. K., Fugate, R. D., McEver, R. P. & Sims, P. J. Stimulated secretion of endothelial von Willebrand factor is accompanied by rapid redistribution to the cell surface of the intracellular granule membrane protein GMP-140. J. Biol. Chem. 264, 7768–7771 (1989).
Article CAS PubMed Google Scholar
McEver, R. P. Adhesive interactions of leukocytes, platelets, and the vessel wall during hemostasis and inflammation. Thromb. Haemost. 86, 746–756 (2001).
Article CAS PubMed Google Scholar
Moore, K. L. et al. P-selectin glycoprotein ligand-1 mediates rolling of human neutrophils on P-selectin. J. Cell Biol. 128, 661–671 (1995).
Article CAS PubMed Google Scholar
Patel, K. D., Moore, K. L., Nollert, M. U. & McEver, R. P. Neutrophils use both shared and distinct mechanisms to adhere to selectins under static and flow conditions. J. Clin. Invest. 96, 1887–1896 (1995).
Article CAS PubMed PubMed Central Google Scholar
Setiadi, H., Sedgewick, G., Erlandsen, S. L. & McEver, R. P. Interactions of the cytoplasmic domain of P-selectin with clathrin-coated pits enhance leukocyte adhesion under flow. J. Cell Biol. 142, 859–871 (1998).
Article CAS PubMed PubMed Central Google Scholar
Doyle, E. L. et al. CD63 is an essential co-factor to leukocyte recruitment by endothelial P-selectin. Blood 118, 4265–4273. (2011).
Kansas, G. S. & Pavalko, F. M. The cytoplasmic domains of E- and P-selectin do not constitutively interact with alpha-actinin and are not essential for leukocyte adhesion. J. Immunol. 157, 321–325 (1996).
CAS PubMed Google Scholar
Owen, D. J., Setiadi, H., Evans, P. R., McEver, R. P. & Green, S. A. A third specificity-determining site in mu 2 adaptin for sequences upstream of Yxx phi sorting motifs. Traffic 2, 105–110 (2001).
Article CAS PubMed Google Scholar
Mashanov, G. I., Tacon, D., Knight, A. E., Peckham, M. & Molloy, J. E. Visualizing single molecules inside living cells using total internal reflection fluorescence microscopy. Methods 29, 142–152 (2003).
Article CAS PubMed Google Scholar
Mashanov, G. I. & Molloy, J. E. Automatic detection of single fluorophores in live cells. Biophys. J. 92, 2199–2211 (2007).
Article ADS CAS PubMed PubMed Central Google Scholar
Mashanov, G. I. Single molecule dynamics in a virtual cell: a three-dimensional model that produces simulated fluorescence video-imaging data. J. R. Soc. Interface 11, 20140442 (2014).
Article PubMed PubMed Central Google Scholar
Saffman, P. G. & Delbruck, M. Brownian motion in biological membranes. Proc. Natl Acad. Sci. USA 72, 3111–3113 (1975).
Article ADS CAS PubMed PubMed Central Google Scholar
Fujiwara, T. K. et al. Confined diffusion of transmembrane proteins and lipids induced by the same actin meshwork lining the plasma membrane. Mol. Biol. Cell 27, 1101–1119 (2016).
Article CAS PubMed PubMed Central Google Scholar
Lukic, B. et al. Direct observation of nondiffusive motion of a Brownian particle. Phys. Rev. Lett. 95, 160601 (2005).
Article ADS CAS PubMed Google Scholar
Skinner, M. P., Lucas, C. M., Burns, G. F., Chesterman, C. N. & Berndt, M. C. GMP-140 binding to neutrophils is inhibited by sulfated glycans. J. Biol. Chem. 266, 5371–5374 (1991).
Article CAS PubMed Google Scholar
Toothill, V. J., Van Mourik, J. A., Niewenhuis, H. K., Metzelaar, M. J. & Pearson, J. D. Characterization of the enhanced adhesion of neutrophil leukocytes to thrombin-stimulated endothelial cells. J. Immunol. 145, 283–291 (1990).
CAS PubMed Google Scholar
Knipe, L. et al. A revised model for the secretion of tPA and cytokines from cultured endothelial cells. Blood 116, 2183–2191 (2010).
Article CAS PubMed PubMed Central Google Scholar
Kiskin, N. I., Babich, V., Knipe, L., Hannah, M. J. & Carter, T. Differential cargo mobilisation within Weibel-Palade bodies after transient fusion with the plasma membrane. PLoS ONE 9, e108093 (2014).
Article ADS PubMed PubMed Central CAS Google Scholar
Kusumi, A. et al. Dynamic organizing principles of the plasma membrane that regulate signal transduction: commemorating the fortieth anniversary of Singer and Nicolson’s fluid-mosaic model. Annu Rev. Cell Dev. Biol. 28, 215–250 (2012).
Article CAS PubMed Google Scholar
Jacobson, K., Liu, P. & Lagerholm, B. C. The lateral organization and mobility of plasma membrane components. Cell 177, 806–819 (2019).
Article CAS PubMed PubMed Central Google Scholar
Celie, J. W., Beelen, R. H. & van den Born, J. Heparan sulfate proteoglycans in extravasation: assisting leukocyte guidance. Front Biosci. 14, 4932–4949 (2009).
Article CAS Google Scholar
Yilmaz, O., Afsar, B., Ortiz, A. & Kanbay, M. The role of endothelial glycocalyx in health and disease. Clin. Kidney J. 12, 611–619 (2019).
Article CAS PubMed PubMed Central Google Scholar
Goodrich, C. P., Brenner, M. P. & Ribbeck, K. Enhanced diffusion by binding to the crosslinks of a polymer gel. Nat. Commun. 9, 4348 (2018).
Article ADS PubMed PubMed Central CAS Google Scholar
Blagoveshchenskaya, A. D., Hannah, M. J., Allen, S. & Cutler, D. F. Selective and signal-dependent recruitment of membrane proteins to secretory granules formed by heterologously expressed von Willebrand factor. Mol. Biol. Cell 13, 1582–1593 (2002).
Article CAS PubMed PubMed Central Google Scholar
Hannah, M. J. et al. Differential kinetics of cell surface loss of von Willebrand factor and its propolypeptide after secretion from Weibel-Palade bodies in living human endothelial cells. J. Biol. Chem. 280, 22827–22830 (2005).
Article CAS PubMed Google Scholar
Bierings, R. et al. The interplay between the Rab27A effectors Slp4-a and MyRIP controls hormone-evoked Weibel-Palade body exocytosis. Blood 120, 2757–2767 (2012).
Article CAS PubMed PubMed Central Google Scholar
Motley, A., Bright, N. A., Seaman, M. N. & Robinson, M. S. Clathrin-mediated endocytosis in AP-2-depleted cells. J. Cell Biol. 162, 909–918 (2003).
Article CAS PubMed PubMed Central Google Scholar
Babich, V. et al. Selective release of molecules from Weibel Palade bodies during a lingering kiss. Blood 111, 5282–5290 (2008).
Article CAS PubMed Google Scholar
Taylor, M. J., Perrais, D. & Merrifield, C. J. A high precision survey of the molecular dynamics of mammalian clathrin-mediated endocytosis. PLos Biol. 9, e1000604 (2011).
Royle, S. J., Bright, N. A. & Lagnado, L. Clathrin is required for the function of the mitotic spindle. Nature 434, 1152–1157 (2005).
Article ADS CAS PubMed PubMed Central Google Scholar
Conte, I. L. et al. Interaction between MyRIP and the actin cytoskeleton regulates Weibel-Palade body trafficking and exocytosis. J. Cell Sci. 129, 592–603 (2016).
CAS PubMed PubMed Central Google Scholar
Mashanov, G. I., Knipe, L., Molloy, J. E. & Carter, T. Single fluorophore tracking of P-selectin-EGFP during exocytosis of Weibel-Palade bodies. Eur. Biophy J. 36, S178 (2007).
Google Scholar
Mashanov, G. I., Nobles, M., Harmer, S. C., Molloy, J. E. & Tinker, A. Direct observation of individual KCNQ1 potassium channels reveals their distinctive diffusive behavior. J. Biol. Chem. 285, 3664–3675 (2010).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

UK MRC program grant: MC_PC_13053 (T.C.), Francis Crick Institute core funding from Cancer Research UK: FC001119 (JEM), UK Medical Research Council: FC001119 (J.E.M.), Wellcome Trust: FC001119 (J.E.M.), BBSRC grant: BB/S003894/1 (K.T. and T.C.). We thank Ms. Ayoni Medagoda and Mr. Acieb Karasi for help with Cy3B labeling of AK6 and associated immunocytochemistry.

Funding

Open Access funding provided by The Francis Crick Institute.

Author information

Authors and Affiliations

The Francis Crick Institute, London, UK
Nicola Hellen, Gregory I. Mashanov, Laura Knipe & Justin E. Molloy
Molecular and Clinical Sciences Research Institute, St Georges University of London, London, UK
Ianina L. Conte, Sophie le Trionnaire, Alamin Mohammed, Kazim Ogmen, Silvia Martin-Almedina, Katalin Török & Tom Carter
Mercy College of Health Sciences, Des Moines, IA, USA
Victor Babich
Microbiology Services Colindale, Public Health England, London, UK
Matthew J. Hannah

Authors

Nicola Hellen
View author publications
You can also search for this author in PubMed Google Scholar
Gregory I. Mashanov
View author publications
You can also search for this author in PubMed Google Scholar
Ianina L. Conte
View author publications
You can also search for this author in PubMed Google Scholar
Sophie le Trionnaire
View author publications
You can also search for this author in PubMed Google Scholar
Victor Babich
View author publications
You can also search for this author in PubMed Google Scholar
Laura Knipe
View author publications
You can also search for this author in PubMed Google Scholar
Alamin Mohammed
View author publications
You can also search for this author in PubMed Google Scholar
Kazim Ogmen
View author publications
You can also search for this author in PubMed Google Scholar
Silvia Martin-Almedina
View author publications
You can also search for this author in PubMed Google Scholar
Katalin Török
View author publications
You can also search for this author in PubMed Google Scholar
Matthew J. Hannah
View author publications
You can also search for this author in PubMed Google Scholar
Justin E. Molloy
View author publications
You can also search for this author in PubMed Google Scholar
Tom Carter
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

N.H., V.B., M.J.H., G.I.M, J.E.M., A.M., and K.T. generated vital reagents, software, or equipment. N.H., G.I.M., T.C., I.L.C, S.L.T, L.K. S.M.-A., and K.O., performed research. N.H., G.I.M, S.L.T., T.C., and J.E.M., analyzed data; J.E.M. and T.C. designed the research and wrote the paper. The authors report no disclosures.

Corresponding authors

Correspondence to Justin E. Molloy or Tom Carter.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Scott Simon and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Description of Additional Supplementary Files

Supplementary Movie 1

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Hellen, N., Mashanov, G.I., Conte, I.L. et al. P-selectin mobility undergoes a sol-gel transition as it diffuses from exocytosis sites into the cell membrane. Nat Commun 13, 3031 (2022). https://doi.org/10.1038/s41467-022-30669-x

Download citation

Received: 01 April 2021
Accepted: 10 May 2022
Published: 31 May 2022
DOI: https://doi.org/10.1038/s41467-022-30669-x

This article is cited by

The roles of P-selectin in cancer cachexia
- Tingting Ling
- Jing Liu
- Ju Liu
Medical Oncology (2023)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.