Control of TGFβ signalling by ubiquitination independent function of E3 ubiquitin ligase TRIP12

Keyan, Kripa S; Salim, Safa; Gowda, Swetha; Abdelrahman, Doua; Amir, Syeda Sakina; Islam, Zeyaul; Vargas, Claire; Bengoechea-Alonso, Maria Teresa; Alwa, Amira; Dahal, Subrat; Kolatkar, Prasanna R.; Da’as, Sahar; Torrisani, Jerome; Ericsson, Johan; Mohammad, Farhan; Khan, Omar M

doi:10.1038/s41419-023-06215-y

Download PDF

Article
Open access
Published: 20 October 2023

Control of TGFβ signalling by ubiquitination independent function of E3 ubiquitin ligase TRIP12

Cell Death & Disease volume 14, Article number: 692 (2023) Cite this article

1737 Accesses
2 Altmetric
Metrics details

Subjects

Abstract

Transforming growth factor β (TGFβ) pathway is a master regulator of cell proliferation, differentiation, and death. Deregulation of TGFβ signalling is well established in several human diseases including autoimmune disorders and cancer. Thus, understanding molecular pathways governing TGFβ signalling may help better understand the underlying causes of some of those conditions. Here, we show that a HECT domain E3 ubiquitin ligase TRIP12 controls TGFβ signalling in multiple models. Interestingly, TRIP12 control of TGFβ signalling is completely independent of its E3 ubiquitin ligase activity. Instead, TRIP12 recruits SMURF2 to SMAD4, which is most likely responsible for inhibitory monoubiquitination of SMAD4, since SMAD4 monoubiquitination and its interaction with SMURF2 were dramatically downregulated in TRIP12^-/- cells. Additionally, genetic inhibition of TRIP12 in human and murine cells leads to robust activation of TGFβ signalling which was rescued by re-introducing wildtype TRIP12 or a catalytically inactive C1959A mutant. Importantly, TRIP12 control of TGFβ signalling is evolutionary conserved. Indeed, genetic inhibition of Drosophila TRIP12 orthologue, ctrip, in gut leads to a reduced number of intestinal stem cells which was compensated by the increase in differentiated enteroendocrine cells. These effects were completely normalised in Drosophila strain where ctrip was co-inhibited together with Drosophila SMAD4 orthologue, Medea. Similarly, in murine 3D intestinal organoids, CRISPR/Cas9 mediated genetic targeting of Trip12 enhances TGFβ mediated proliferation arrest and cell death. Finally, CRISPR/Cas9 mediated genetic targeting of TRIP12 in MDA-MB-231 breast cancer cells enhances the TGFβ induced migratory capacity of these cells which was rescued to the wildtype level by re-introducing wildtype TRIP12. Our work establishes TRIP12 as an evolutionary conserved modulator of TGFβ signalling in health and disease.

Transient loss of Polycomb components induces an epigenetic cancer fate

Article Open access 24 April 2024

Targeting DCAF5 suppresses SMARCB1-mutant cancer by stabilizing SWI/SNF

Article 27 March 2024

Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities

Article Open access 03 January 2022

Introduction

TGFβ family is a group of multifunctional cytokines involved in various cellular processes including embryogenesis, immune cell function, cell cycle regulation, tissue homoeostasis, extracellular matrix production, and tissue remodelling and repair [1,2,3]. TGFβ exerts its function via binding to and activating specific heteromeric serine-threonine activin receptor like kinases (ALK4/5) also known as type I and type II serine-threonine kinases [4]. The active TGFβ/Activin type I receptor directly phosphorylate the receptor-regulated SMADs (R-SMADs), SMAD2 and SMAD3 respectively. Phosphorylated R-SMADs interact with the common interacting partner and the major regulator of TGFβ/BMP signalling, SMAD4. The R-SMADs/SMAD4 heteromeric complex translocates to the nucleus leading to robust activation of downstream TGFβ pathway genes [5, 6].

In healthy tissues, TGFβ pathway activation leads to cell cycle arrest and apoptosis [7]. Due to its strong cytostatic ability, TGFβ is a potent tumour suppressor, and several members of TGFβ signalling pathway are frequently mutated in human cancers including colon and pancreatic cancer [8, 9]. Additionally, TGFβ may promote cancer growth by promoting epithelial-to-mesenchymal transition (EMT), cancer metastasis and invasion, and modulation of tumour microenvironment [10, 11]. Thus, TGFβ activity is tightly regulated by different mechanisms. For example, SMAD7, one of the downstream TGFβ pathway genes, contributes to the resolution of TGFβ activity by recruiting of E3 ubiquitin ligase SMURF2 to the TGFβR1 thereby facilitating its polyubiquitination and proteasome mediated degradation [12]. In addition, monoubiquitination of SMAD4 leads to its dissociation from the active R-SMADs complex and termination of TGFβ response [13]. Different E3 ubiquitin ligases including SMURF2 and TRIM33 have been implicated in inhibitory SMAD4 monoubiquitination [14,15,16].

The thyroid hormone receptor interactor protein 12 (TRIP12), also known as the E3 ubiquitin ligase for Arf, is a HECT-domain E3 ubiquitin ligase. TRIP12 is involved in DNA damage response, oncogenic stress, cell cycle control, and neurodegeneration [17,18,19,20,21]. Additionally, TRIP12 regulates response to PARP inhibitors in breast cancer cells [22] and we have shown that the genetic inhibition of TRIP12 leads to the stabilisation of FBW7 protein, mitotic arrest, and enhanced cell death in response to Taxol treatment [23, 24]. Moreover, Trip12 is essential for embryogenesis since Trip12 mutant mice are not viable [25]. Interestingly, TRIP12 variants are associated with intellectual disability and autism spectrum disorder [26, 27]. In addition, TRIP12 mutations of unknown significance are reported in approximately 1–2% of human cancers [28, 29]. Despite the significance of TRIP12 in health and disease, the overall functional and cellular biology of TRIP12 is largely unknown.

Here, we show that TRIP12 interacted with SMAD4 and facilitated its inhibitory monoubiquitination by recruiting SMURF2. This interaction is necessary for efficient TGFβ mediated response. In the absence of TRIP12, SMURF2 recruitment to SMAD4 and its monoubiquitination is inhibited. This led to sustained activation of TGFβ pathway and upregulation of TGFβ mediated gene expression. These effects are seen in multiple mammalian cell lines including HEK293T, HepG2, and NIH3T3 fibroblasts. Interestingly, trip12 deletion using CRISPR/Cas9 method in zebrafish embryos led to increased mortality and developmental defects in crTrip12 chimeras and genetic inhibition of Drosophila orthologue of TRIP12 (ctrip) in intestinal stem cells (ISCs), led to a reduced number of ISCs and an increased number of Prospero positive differentiated enteroendocrine (EE) cells. The reduction in ISCs was rescued by simultaneous genetic inhibition of both ctrip and Drosophila orthologue of SMAD4, Medea. Finally, Trip12 deletion enhanced TGFβ inhibitory effects in a mouse 3D intestinal organoid culture and, CRISPR/Cas9 mediated genetic inhibition of TRIP12 in MDA-MB-231 cells enhanced TGFβ induced cell migration. Overall, our data suggest that regulation of TGFβ pathway by TRIP12 is evolutionarily conserved and understanding the mechanisms underlying this interaction can provide valuable insights into the intricate regulatory network of TGFβ signalling and its implications in various biological contexts.

TRIP12 interacts with TGFβ/BMP pathway mediator SMAD4

To understand the molecular pathways governed by TRIP12, we studied the TRIP12 interactome by performing TRIP12 immunoprecipitation using an antibody specific for endogenous TRIP12 followed by mass spectrometric (MS) analysis. We found that SMAD4—the major regulator of TGFβ/BMP signalling specifically interacted with TRIP12 (Fig. 1A). In addition, SMAD2 and c-SKI, two other major components of TGFβ signalling were also eluted with TRIP12 albeit at levels below our stringent criteria for TRIP12 specific interactors (Fig. 1A). Consistent with that, gene ontology (GO) analysis performed on TRIP12 interacting proteins also showed TGFβ pathway to be the topmost enriched pathway in our GO analysis (Fig. 1B). Further, we validated the MS data and confirmed that endogenous as well as a Myc-tagged TRIP12 both interacted with endogenous SMAD4 as confirmed by coimmunoprecipitation followed by Western blots (Fig. 1C, D). Conversely, GST-pulldown experiments confirmed direct interaction of GST-SMAD4 with endogenous TRIP12 while GST alone and GST-SMAD2 did not interact (Fig. 1E). SMAD4 interacted with TRIP12 via its MH2 domain, as SMAD4/TRIP12 interaction was significantly reduced when SMAD4 lacking MH2 domain (GST-ΔMH2) was used in pulldown experiments (Fig. 1F–H). Finally, to map SMAD4 interacting region on TRIP12, we generated several TRIP12 deletion mutants (Fig. 1I) and performed TRIP12/SMAD4 coimmunoprecipitations. Our data suggest that TRIP12 most likely interacted with SMAD4 via its internally disorganised region (IDR) as TRIP12 deletion mutants lacking IDR but not any other domains, failed to interact with endogenous SMAD4 (Fig. 1I, J). Thus, we demonstrate that TRIP12 interacts with SMAD4, and this interaction most likely occurs at the interface of SMAD4’s MH2 domain and TRIP12’s IDR region.

**Fig. 1: TRIP12 interacts with SMAD4 via its IDR and SMAD4’s MH2 domain.**

TRIP12 is required for recruitment of E3 ubiquitin ligase SMURF2 to monoubiquitinate SMAD4

To functionally characterise the epistasis between TRIP12 and SMAD4, we investigated the endogenous levels of SMAD4 protein in TRIP12^-/- cell lines compared to the wildtype controls. We noticed a subtle increase in SMAD4 protein levels in both HEK293T and HCT116 TRIP12^-/- cell lines (Fig. 2A). To check if TRIP12 regulates SMAD4 protein stability, we performed cycloheximide protein chase assays. Surprisingly, SMAD4 protein stability was largely unaffected in response to cycloheximide regardless of TRIP12 status (Fig. 2B), whereas TRIP12 itself and an additional control c-MYC, showed robust protein degradation over time in cycloheximide treated cells albeit at different time kinetics as expected for two largely distinct class of proteins (Fig. 2B). Additionally, Myc-SMAD4 protein stability was neither affected by treatment with a proteasomal inhibitor (MG132) nor by co-overexpression of TRIP12 wildtype, ΔHECT, ARM, and HECT domains (Supplementary Fig. 1A). Next, we looked at the possibility that TRIP12 might regulate SMAD4 protein levels in response to TGFβ signalling. For this, we co-overexpressed a constitutively active ALK5 (TGFβRI) mutant and GFP-SMAD4 and performed Western blots to check the protein levels of both endogenous as well as GFP-SMAD4 proteins. We reasoned that, if TRIP12 controls SMAD4 protein stability, both endogenous and GFP-tagged, SMAD4 proteins must be altered in TRIP12^-/- cells. However, if TRIP12 deletion causes increase in SMAD4 protein due to transcriptional or posttranscriptional changes then only endogenous protein should be altered. GFP-SMAD4 was largely unaffected in TRIP12^-/- knockout cells and ALK5 overexpression had little to no effect on its levels (Fig. 2C). We confirmed ALK5 activity with pSMAD2 and found a strong induction of pSMAD2 in HA-ALK5 overexpressing samples (Fig. 2C). However, we found consistent increase in endogenous SMAD4 levels in the absence of TRIP12 which was also unaffected by ALK5 overexpression in TRIP12^-/- cells (Fig. 2C). Interestingly, SMAD4 mRNA was significantly increased in TRIP12 knockdown cells suggesting that the increase in SMAD4 protein in the absence of TRIP12 is most likely a transcriptional event (Fig. 2D), that is, increased SMAD4 mRNA most likely leads to the subtle increase in SMAD4 protein levels in TRIP12^-/- cells and TRIP12 does not regulate SMAD4 protein stability.

**Fig. 2: *TRIP12* inhibition does not affect SMAD4 protein stability but reduces its monoubiquitination.**

Monoubiquitination of SMAD proteins including SMAD4 is required to control their cellular localisation, protein-protein interactions, and TGFβ signalling [30, 31]. Largely, monoubiquitination inhibits association of SMAD4 with R-SMADs to prevent formation of a stable transcriptional complex and inhibit TGFβ signalling. Several E3 ubiquitin ligases including β-TRCP1, SMURF2, and TRIM33 are known to ubiquitinate SMAD4 [31], with E3 ligase SMURF2 proposed to only monoubiquitinate SMAD4 to restrain TGFβ pathway activation [32]. TRIP12 depletion near completely blocked monoubiquitination of SMAD4 protein (Fig. 2E, F). In these experiments we detected low levels of SMAD4 polyubiquitylation as well which was unaffected between the wildtype and TRIP12^-/- cells. Thus, we hypothesised that TRIP12 regulated SMAD4 monoubiquination must be mediated by SMURF2. To test that, we performed co-immunoprecipitation of SMURF2 and SMAD4 and found that the SMURF2 recruitment on SMAD4 was significantly downregulated in TRIP12^-/- cells (Fig. 2G, H). Strikingly, not only SMAD4 monoubiquitination but also SMURF2 interaction with SMAD4 was restored by re-introducing wildtype as well as a catalytically dead TRIP12-C1959A mutant in TRIP12 knockout cells (Fig. 2I, J and Supplementary Fig. 1B).

To this end, our data suggest a model where TRIP12 recruits SMURF2 to carry out SMAD4 ubiquitination. But it is possible that TRIP12 may directly ubiquitinate SMAD4 and even the C1959A mutant possess ubiquitin ligase activity sufficient to monoubiquitinate SMAD4. Thus, to overrule this possibility, we first validated the plasmid sequences of TRIP12 wildtype and C1959A mutant via sanger sequencing and confirmed that Cysteine 1959 is indeed mutated to Alanine in this construct (Supplementary Fig. 1C). Second, to exclude the possibility that a nearby ‘Cys’ or any other residue in TRIP12 HECT domain might compensate for ubiquitin ligase activity in TRIP12 C1959A mutant, we purified wildtype and C1959A HECT domains (Supplementary Fig. 1D) and performed in vitro ubiquitination assay. Indeed, wildtype TRIP12 efficiently ubiquitinated free ubiquitin in collaboration with two different E2 enzymes whereas C1959A mutant largely lacked this activity (Supplementary Fig. 1E). In agreement with that, TRIP12 HECT domain failed to directly ubiquitinate SMAD4 in an in vitro ubiquitination reaction carried out in presence of multiple combinations of UBE1/UBE2 with TRIP12-HECT domain (Supplementary Fig. 1F). Thus, the E3 ubiquitin ligase activity of TRIP12 is not required for SMAD4 monoubiquitination rather TRIP12 recruits SMURF2 to carry out SMAD4 monoubiquitination.

TRIP12 controls TGFβ transcriptional activity via SMAD4

Having established the epistasis between TRIP12 and SMAD4, we set to understand the function of TRIP12 in TGFβ signalling. TGFβ treatment leads to robust phosphorylation of SMAD2 (p-SMAD2) but TRIP12 deletion does not affect the levels and duration of p-SMAD2 in two different cell lines (Fig. 3A and Supplementary Fig. 2A). Next, we performed cytoplasmic and nuclear subcellular fractionation and found that both exogenous and endogenous SMAD4 protein levels were higher in nuclear extracts of TRIP12^-/- cells compared to wildtype controls regardless of TGFβ treatment (Fig. 3B), which could be a result of reduced SMAD4 monoqubiquitination as previously suggested [32]. Although cytoplasmic/nuclear SMAD4 protein shuttling was unaffected by TGFβ treatment, the total- and p-SMAD2 levels in nuclear extracts of TRIP12^-/- cells were higher compared to the wildtype controls (Fig. 3B). The nuclear accumulation of p-SMAD2 in TRIP12^-/- cells most likely led to sustained activation of SMAD2/3/4 complex in TRIP12 knockdown HepG2 cells (Fig. 3C, D). Consistent with this result, a TGFβ responsive synthetic 12XCAGA promoter luciferase reporter (Luc:CAGA) assay showed more than two-fold transcriptional activity in TRIP12^-/- cells in response to TGFβ, which was normalised to wildtype levels by transient overexpression of human wildtype- as well as C1959A mutant TRIP12 (Fig. 3E), and endogenous overexpression of TRIP12 using CRISPR/Cas9-guided synergistic activation mediator from our previously published HEK293T cells [23] completely blocked Luc:CAGA TGFβ reporter activity (Supplementary Fig. 2B, C). Similar results were obtained with another TGFβ responsive Luc:PAI reporter assay (Supplementary Fig. 2D). Strikingly, a HECT domain deleted TRIP12 mutant (TRIP12-ΔHECT) was sufficient to block TGFβ reporter Luc:CAGA activity (Fig. 3F). Enhanced Luc:CAGA activity was also observed in TGFβ responsive- human HepG2 cells, and murine NIH3T3 fibroblasts expressing lentivirus mediated shTRIP12 and shTrip12 respectively (Supplementary Fig. 2E–G). Additionally, TGFβ3 from a different vendor also induced higher Luc:CAGA promotor activity in TRIP12^-/- cells, confirming that the increase in TGFβ signalling in TRIP12^-/- cells is not restricted only to TGFβ1 (Supplementary Fig. 2H). Finally, Luc:CAGA transcriptional activity was significantly reduced in cells with co-inhibition of TRIP12 and SMAD4 (Fig. 3G–I), confirming the requirement of SMAD4 in enhanced TGFβ signalling in TRIP12^-/- cells. These results indicate that TRIP12 controls TGFβ activity independent of its E3 ubiquitin ligase activity and via negative regulation of SMAD4 by recruiting E3 ligase SMURF2, and the deletion of TRIP12 leads to sustained activation of TGFβ signalling (Fig. 3J).

**Fig. 3: *TRIP12* inhibition increases TGFβ induced luciferase transcriptional response via SMAD4.**

TRIP12 depletion leads to enhanced TGFβ target gene expression and developmental defects in a zebrafish model

To this end, we established that TRIP12 controls TGFβ signalling via its ubiquitination independent function. To confirm if TRIP12 regulates endogenous TGFβ target gene expression, we checked the levels of six well characterised TGFβ targets in control and TRIP12-knockdown cells in response to TGFβ [33]. Consistent with sustained activation of TGFβ signalling in TRIP12 depleted cells, four out of six TGFβ target genes ADAM19, CTGF, PAI, and SMAD7 showed significant and sustained upregulation in TRIP12-knockdown cells (Fig. 4A). TMEPAI mean expression was significantly increased at 4-h timepoint, while P21 gene expression levels were unaffected by TRIP12 knockdown (Fig. 4A). Similar result of enhanced TGFβ target gene expression was obtained in NIH3T3 shTrip12 mouse fibroblasts compared to the controls (Supplementary Fig. 3A). These results strongly suggest that TRIP12 regulate TGFβ signalling in both human and murine cells.

**Fig. 4: *TRIP12* controls endogenous TGFβ pathway gene regulation.**

To test if TRIP12 controls TGFβ/BMP gene expression in vivo, we used a zebrafish model to study TGFβ signalling as TGFβ/BMP signalling is required for the early development of vertebrates [34]. While genetic inhibition of Trip12 is embryonic lethal in mice [25] and Drosophila (our unpublished data), its effect on zebrafish development is not known. Thus, to study the impact of TRIP12 deletion in development, we employed the zebrafish model and targeted TRIP12 orthologue of zebrafish, trip12 (ENSDARG00000061397, ENSG00000153827), by CRISPR/Cas9 system and generated zebrafish trip12 crispants (Supplementary Fig. 3D, E). The zebrafish mortality rate increased in trip12 crispants; additionally, only trip12 crispants (~20%) but not control showed developmental defects (Fig. 4B–E). The developmental defects of trip12 crispants were most likely due to deregulated TGFβ signalling given that two well-established TGFβ target genes gsc and ntl1 were significantly upregulated in trip12 crispants group (Fig. 4F). Thus, TRIP12 controls TGFβ signalling both in mammalian cells as well as in a zebrafish model.

ctrip controls tissue homoeostasis in Drosophila gut via negative regulation of TGFβ signalling

Drosophila is a useful model to study adult gut tissue homoeostasis [35]. The pathways that control ISCs renewal and differentiation are relatively conserved between Drosophila and mammals [36]. Having established the requirement of TRIP12 in TGFβ signalling in vitro and in vivo we set to test the cellular biology of TRIP12 in the context of adult tissue homoeostasis in Drosophila. First, we explored the gene expression pattern of ctrip and Medea genes, the Drosophila orthologues of human TRIP12 and SMAD4 respectively. For this, we used a previously published singe-cell RNA sequencing dataset of Drosophila intestine (https://www.flyrnai.org/scRNA/gut/) [37]. We found a strikingly similar pattern of co-expression of both genes from the highest to the lowest expression in the order of EE, ISCs and enteroblasts (EB), and enterocytes (EC) (Fig. 5A). Second, to understand the functional biology of TRIP12, we used a temperature sensitive Gal4-UAS based RNAi system which allowed simultaneous expression of ctrip RNAi and labelling of ISCs and EBs with GFP [38]. Interestingly, ctrip knockdown in the ISCs of adult fly led to a sharp reduction in number of ISCs/EBs compared to controls as judged by immunofluorescence microscopy and flow cytometric analyses (Fig. 5B, C). Conversely, ctrip inhibition increased the number of Prospero positive EE cells compared to the controls suggesting a possibility that enhanced differentiation of ISCs/EBs rather than a proliferation defect is responsible for the reduction of ISCs/EBs in ctrip inhibited Drosophila gut (Fig. 5D).

**Fig. 5: *Drosophila* Trip12 regulates gut homoeostasis via control of TGFβ signalling in vivo.**

To understand the molecular pathways governed by ctrip in Drosophila cell fate decisions, we used the Drosophila wing as a model. The development and growth of Drosophila wing is maintained by an intricate balance between several well conserved pathways including the WNT, Notch, & TGFβ/BMP signalling (Fig. 5E) [39,40,41]. Interestingly, wing specific ctrip knockdown using Tub-Gal4 based RNAi in Drosophila led to increase in Drosophila wing length as judged by quantification of wing length (Fig. 5F, G). The absence of a classical WNT or Notch phenotype in ctrip knockdown Drosophila wing suggests a possibility that ctrip controls wing growth either by TGFβ/BMP pathway or via an unknown mechanism.

To test this hypothesis, we generated Drosophila lines in which we either inhibited ctrip alone or in combination with Medea. Strikingly, ctrip/Medea double RNAi-based knockdown restored the reduced number of ISCs/EBs in Drosophila and reversed the differentiated cell phenotype back to the control levels (Fig. 6A–C). In Drosophila gut, high TGFβ/BMP signalling maintains low Notch levels and this arm of signalling favours differentiation of progenitors to EE [42, 43]. Our data suggest that ctrip in Drosophila ISCs and EBs maintain a threshold of BMP signalling just about enough to establish gut homoeostasis. In the absence of ctrip, this balance tilts towards higher differentiation of ISCs and EBs to EE lineage (Fig. 6D). These results suggest that ctrip controls TGFβ/BMP signalling in vivo, and this is required for the maintenance of Drosophila gut biology.

**Fig. 6: Inhibition of *Drosophila* SMAD4 orthologue *Medea* restores ISCs number in *ctrip* deficient *Drosophila* gut.**

Trip12 inhibition potentiates TGFβ induced proliferation arrest and apoptosis in mouse intestinal organoids

To check if TRIP12 also mediates TGFβ activities in mammalian intestinal cells, we used CRISPR/Cas9 based genetic targeting of mouse Trip12 gene in intestinal organoids and studied their cellular biology. We used two independent sgRNA to target Trip12 locus and confirmed the genetic manipulation of Trip12 gene by a T7 restriction endonuclease method (Supplementary Fig. 4A, B). Interestingly, incubation of low dose TGFβ which is well tolerated by the control organoids, led to dramatic regression of sgTrip12 organoids by 48 h and they appeared as apoptotic looking circular bodies with dark black central core typical of lumen full of dead cells (Fig. 7A, B). At higher dose of 10 ng/ml TGFβ, all organoids regardless of Trip12 status regressed to appear like apoptotic bodies (Supplementary Fig. 4C). To test if the change in morphology of sgTrip12 organoids is indeed due to the inhibition of proliferating ISCs, we pulsed the organoid culture with EdU for 2 h and performed the Click-IT chemistry assay followed by immunofluorescence microscopy. As expected, TGFβ treatment led to robust reduction of EdU incorporation in sgTrip12 organoids compared to the controls (Fig. 7C, D). Consistent with this observation, the number of cleaved caspase-3 (CC3) positive cells was also increased in sgTrip12 organoids suggestive of increased apoptosis in those organoids in response to low dose TGFβ (Fig. 7E, F). Thus, our data suggest that TRIP12 is an essential mediator of TGFβ signalling in Drosophila as well as murine intestinal cells.

**Fig. 7: *Trip12* deletion potentiates TGFβ response in primary mouse intestinal organoids.**

TRIP12 inhibits cancer cell migration

To this end, we established TRIP12 as a modulator of TGFβ signalling in normal healthy tissues. To check if TRIP12 can potentially regulate TGFβ mediated cancer cell migration, we generated CRISPR/Cas9 targeted crTRIP12 pools of MDA-MB-231 cells (Supplementary Fig. 5). When stimulated with TGFβ in a transwell chamber assay, crTRIP12 cells migrated approximately 2–3-fold higher than their wildtype counterparts (Fig. 8A, B). Furthermore, reintroducing wildtype TRIP12 in crTRIP12 MDA-MB-231 cells, normalised the increased migration of those cells to the wildtype levels (Fig. 8C–E). Thus, TRIP12 regulates TGFβ signalling in normal as well as cancer cells.

**Fig. 8: TRIP12 controls metastasis of MDA-MB-231 cells.**

Discussion

TGFβ pathway is the master regulator of cell proliferation and death. Deregulation TGFβ signalling contributes to developmental disorders and cancer. Understanding the molecular mechanisms of TGFβ pathway deregulation may help in understanding the underlying causes of some of these conditions. Previous work has extensively characterised the regulation of TGFβ signalling by posttranslational modulations of members of TGFβ signalling pathway [44,45,46]. Here, we made an unexpected discovery that E3 ubiquitin ligase TRIP12 which was previously shown to be required in diverse cellular processes including DNA damage, cell cycle regulation, chemotherapy resistance, and neurodegeneration [18, 19, 22, 24], controls TGFβ pathway activity independent of its E3 ubiquitin ligase activity.

Our data show that TRIP12 interacts with SMAD4 via its IDR region. The IDR region may confer DNA binding ability to proteins. TRIP12 IDR has been shown to bind directly to DNA elements [47]. Given the fact that TRIP12 is involved in DNA damage response and gene expression, it is plausible that the IDR domain of TRIP12 is its DNA binding domain. Interestingly, we show that SMAD4 interacts with TRIP12 IDR via its MH2 domain. This interaction is not dependent on other protein-protein interaction domains including WWE and ARM domain in TRIP12. Thus, TRIP12 may use its different domains to selectively interact with its broad range of substrates. The presence of low levels of other TGFβ pathway proteins including SMAD2 and c-SKI in our IP-MS experiment suggests a possibility that TRIP12 via its IDR domain may recruit other components of TGFβ pathway to SMAD4 (Fig. 1), but this possibility needs to be further validated.

Previous work have suggested that SMAD4 is subjected to proteasomal degradation and several E3 ubiquitin ligases have been linked with SMAD4 polyubiquitination [15, 48]. Interestingly our data is contrary to some of those findings. First, we do not find any change in SMAD4 protein levels in the presence of a commonly used proteasomal inhibitor, MG132. Second, SMAD4 protein stability over time as judged by cycloheximide treatment followed by Western blots, show minimal change in SMAD4 protein levels even after 24 h, suggesting that SMAD4 is relatively a stable protein. Finally, both endogenous as well as ectopically expressed SMAD4 protein levels were unaffected by MG132 or cycloheximide treatment regardless of the duration of treatment overruling the possibility of any transcriptional changes due to these treatments. These contrasting results may reflect the cell type specific and context dependent regulation of SMAD4 protein. Indeed, previous work that linked SMAD4 polyubiquitination with its proteasomal degradation was largely done in cancer cell lines including with use of some cancer associated SMAD4 mutants [33, 49,50,51] (Fig. 2 and Supplementary Fig. 1).

Surprisingly, endogenous SMAD4 is largely localised to the nucleus even in the absence of TGFβ incubation while SMAD2 readily shuttles to the nucleus only upon TGFβ stimulation, and its phosphorylated form is retained longer in the nucleus in the absence of TRIP12, which may explain sustained activation of SMAD4/SMAD2 complex in those cells (Fig. 3). The SMAD4 nuclear localisation in the absence of TGFβ stimulation might be due to underlying active BMP signalling or via another pathway which is independent of TGFβ/BMP signalling. The SMAD4 monoubiquitination results in its dissociation from the R-SMADs and resolution of TGFβ response [52]. We show that SMAD4 monoubiquitination is dramatically inhibited in TRIP12-knockout cells. In our subsequent biochemical analysis, we do not find any direct ubiquitination of SMAD4 by recombinant TRIP12 HECT domain. Instead, we found reduced SMURF2 recruitment to SMAD4 in TRIP12-knockout cells which was restored back to the wildtype levels when ectopically expressed GFP-tagged TRIP12 wildtype as well as a C1959A mutant is introduced in these cells (Supplementary Fig. 1B). Consistent with that, both TRIP12 wildtype and C1959A mutant restored the monoubiquitination of SMAD4 in TRIP12-knockout cells. These results strongly suggest that the monoubiquitination of SMAD4 is largely dependent on TRIP12’s ability to recruit SMURF2 to SMAD4 (Fig. 2G–J).

Genetic inhibition via shRNA or CRISPR/Cas9 mediated deletion of TRIP12 gene results in robust activation of TGFβ signalling (Fig. 3D, E). This increased signalling is completely blocked by reintroducing wildtype, C1959A, and ΔHECT TRIP12 mutants (Fig. 3F). TRIP12 contains several defined and undefined domains including the IDR, WWE, ARM, and the HECT domain. Previous work have established the notion that the E3 ubiquitin ligase activity of TRIP12 drives its molecular functions. Interestingly, TRIP12 may also regulate cell cycle dynamics independent of its E3 ligase activity [18], and a recent work identified ubiquitination independent function of another E3 ubiquitin ligase HERC3 in the regulation of transcriptional co-activators YAP/TAZ’s activity [53]. Along the same lines, we show that TRIP12 can also regulate TGFβ activity independent of its E3 ubiquitin ligase activity and our data suggest that TRIP12 biological functions may extend beyond its catalytic activity.

Our work potentially establishes the role of TRIP12 for the first time in the regulation of TGFβ biology in multiple models. For example, we show that TRIP12 deletion in mammalian cell lines, zebrafish, and Drosophila leads to phenotypes highly concordant with deregulated TGFβ signalling. First, we show that in several human cell lines and mouse NIH3T3 fibroblasts the levels and duration of TGFβ induced response and target genes are increased (Fig. 4A and Supplementary Fig. 4A). Second, two well established TGFβ target genes were upregulated in trip12 crispants zebrafish embryos during development (Fig. 4F). This increase in TGFβ signalling in zebrafish embryos may also contribute to developmental defects in these embryos (Fig. 4B–E) [34]. However, we do not exclude the possibility that zebrafish developmental defects may arise from a potential deregulation of other pathways previously attributed to Trip12 deficiency in mice [25]. Third, in Drosophila gut we find a sharp reduction of ISCs which was compensated by the increase in differentiated EE cells. Indeed, the numbers of ISCs and EEs were restored to control levels in Drosophila when ctrip and Medea genes were simultaneously inhibited, suggesting that the ISCs renewal and differentiation phenotype in this model is largely driven by TGFβ/BMP signalling (Fig. 6). The reduction of ISCs in ctrip inhibited Drosophila gut may also arise from increased cell death of ISCs, however, we do not find any evidence of enhanced ISCs cell death in those guts (data not shown).

Intestinal tissue homoeostasis is governed by an intricate balance between stem cell renewal, differentiation, and cell death coordinated by the action of several highly conserved molecular pathways [54]. For example, the WNT pathway maintains the renewal of ISCs, the Notch pathway contributes to cell fate decisions, and TGFβ pathway enforces differentiation and apoptosis to maintain the healthy turnover of intestinal epithelium. Perturbation in any of these pathways including deregulated TGFβ signalling contributes to developmental disorders and cancer [55, 56]. Mouse intestinal organoid model is a powerful tool to study the mammalian gut epithelial biology [57]. We did not find any overt TGFβ phenotypes in mouse intestinal organoids targeted by sgTrip12. However, when challenged by low dose TGFβ, sgTrip12 organoids rapidly regressed to apoptotic looking rounded bodies with dark lumen suggestive of enhanced cell death. Indeed, in sgTrip12 organoids TGFβ treatment sharply blocked ISCs proliferative index and dramatically enhanced apoptotic cell numbers compared to the wildtype controls. These results have broader implications since the precise functional biology of TRIP12 in the mammalian gut have not been tested before. Our data demonstrate that TRIP12 is an essential mediator of TGFβ signalling in the intestine and warrants further evaluation of TRIP12 function in intestinal biology and in colorectal cancer in vivo.

Finally, cancer cell metastasis and invasion are important steps during cancer dissemination and spread to distant organs. TGFβ signalling is a major contributor to these processes by favouring the process of EMT and by enhancing the gene expression of metastatic genes [58]. TRIP12 inhibition increased the metastasis of MDA-MB-231 breast cancer cells compared to the controls. Importantly, these cells are highly metastatic and have previously been shown to possess mesenchymal properties [59]. Our finding that TRIP12 inhibition further enhances the migratory properties of these cells suggest that TGFβ not only helps establish the process of EMT but also promotes metastasis of already established mesenchymal cells and TRIP12 is essential for regulating this phenomenon.

Materials and methods

Cell lines

Cell lines including HEK293T, HEK293FT, HCT116 and MDA231 were obtained from Cell Services at the Francis Crick Institute. The human Hepatocellular carcinoma cells (HepG2) & mouse immortalised NIH3T3 fibroblasts were a kind gift from Dr Johan Ericsson. HepG2 cells were maintained in minimal essential media (MEM) supplemented with 10% foetal bovine serum (FBS), non-essential amino acids (NEAA), sodium pyruvate, 1% Glutamax, 1% penicillin/streptomycin (Gibco), and 0.1% Normocin (Invivogen). All the other cell lines were maintained in DMEM High glucose (Gibco) supplemented with all the above reagents as for HepG2 cells except NEAA and sodium pyruvate. All cell lines were maintained in a standard cell culture humidified incubator at 37 °C and 5% CO2.

Cloning and plasmids

The plasmids (pGEX-4T-1, Sigma-Aldrich) for recombinant glutathione S-transferase (GST), the GST-tagged SMAD proteins (SMAD 2 & 4), and Myc-SMAD4 (pcDNA3.0) were from Dr Johan Ericsson’s lab. GFP-tagged wildtype TRIP12, ΔHECT mutant, and ΔHECT/ΔWWE double mutant were reported before [23]. HA-Ubiquitin, Flag-TRIP12 wildtype and C1959A mutant are published before [23]. GFP-tagged TRIP12 ARM, IDR, ARM/IDR, and HECT domains were generated via Gateway cloning method (Invitrogen). Briefly, respective TRIP12 regions were PCR amplified using Flag-TRIP12 plasmid as a template with high fidelity Accuprime DNA polymerase (ThermoFisher). The PCR products were gel purified and 100 ng purified product and 150 ng pDONR221 was used for a BP reaction as given in Gateway cloning kit’s protocol. The insert/pDONR221 ligated mixture from the BP reaction was used to transform chemically competent DH5 alpha (NEB) E coli and at least 3 colonies were picked for colony PCR validation. At least one validated colony was further picked for plasmid miniprep DNA preparation using the kit’s protocol (GeneJet Plasmid Miniprep, ThermoFisher). The validated entry clones were then used for shuttling the TRIP12 regions to pcDNA6.2/N-EmGFP-DEST plasmid (V35520, Invitrogen) using the kit’s protocol. Separately, Gateway cloning was used to shuttle wildtype TRIP12 to pLenti CMV/TO GFP-Zeo DEST which as a gift from Eric Campeau & Paul Kaufman [60] (#17431, Addgene).

Genetic targeting of mammalian cell lines

The CRISPR/Cas9 mediated TRIP12 knockout of HEK293T and HCT116 cells were generated in a previous study [23]. MDA231 TRIP12 knockout pools were generated exactly as before [23]. The stable HepG2 cells overexpressing a control or a TRIP12 specific short hairpin (sh)-RNA were generated in this study. The cells were incubated with lentivirus supernatant containing either control or shTRIP12 (Sigma-Aldrich) for 24 h. After 48 h of transduction the media was changed to 1 μg/ml puromycin media and the cells were selected for another 48 h. The HEK293T TRIP12 knockout pools stably overexpressing shSMAD4 (#37046, Addgene) were generated in this study. First, HEK293T cells were transiently co-transfected with plasmid overexpressing Cas9 and a crTRIP12 (Horizon) as before [23]. Second, lentivirus mediated stable expression of shSMAD4 was done and cells selected in puromycin as above. The stable NIH3T3 fibroblasts overexpressing a control and two different shTrip12 (GIPZ, Horizon), were generated by incubating the NIH3T3 cells with the respective lentiviral supernatant as above. Stable cells were selected with 1 μg/ml puromycin (Sigma-Aldrich) for 48 h before propagation and experiments. The knockdown of TRIP12 or Trip12 was confirmed by Western blotting and by qRT-PCR respectively.

Recombinant proteins’ purification

GST-tagged proteins were purified inhouse by overexpressing pGEX-4T-1 containing ORFs in codon optimised E coli (BL21 Codon + , Agilent). Briefly, GST-tagged ORFs were used to transform E coli and at least 3 distinct colonies were picked for each plasmid and grown overnight in 100 μg/ml ampicillin (Gibco) containing Luria-Bertani (LB) medium at 37 °C on a 200 rpm shaking platform. Bacterial cultures were incubated with isopropyl β-D-1-thiogalactopyranoside (IPTG) at 37 °C and after 2–4 h (h) of IPTG induction, a small aliquot of each colony culture was mixed with 4X SDS loading buffer and the extracts were boiled at 95 °C for 5 min, ran on 8% Tris-TGX gels, transferred to nitrocellulose membrane, blocked in 5% milk-TBST for 1 h at room temperature (RT) and blotted overnight with anti-rabbit GST sera (Invitrogen) to confirm expression of recombinant proteins. The colony culture giving the maximum yield of GST-tagged protein was further grown into 0.5 to 1 liter culture overnight and protein expression was induced next morning as given above. After 4 h of IPTG induction, bacteria were pelleted at 4000 rpm (Avanti J-265, Beckman Coulter) for 30 min in 4 °C, lysed in bacterial lysis buffer (ThermoFisher), sonicated periodically on ice, and ultracentrifuged at 22,000 rpm for 2 h (CP100NX, Hitachi). The cleared lysates were further incubated overnight in 4 °C with glutathione beads (Promega) for recombinant proteins enrichment. The next day, glutathione beads were washed 3 to 5X with 25 mM Tris containing wash buffer and eluted in 500 mM glutathione containing sample buffer (25 mM Tris 100 mM NaCl). Glutathione was removed by buffer exchange at 4 °C using appropriate molecular weight (MW) cut off columns (Thermofisher).

The construct for HECT domain of TRIP12 was amplified from the full length human TRIP12 ORF and subcloned into the pET28a-SUMO plasmid using the BamHI and XhoI restriction sites with N-terminal fusion with 6X HIS-SUMO tag. The resultant plasmid was transformed into E coli BL21 (DE3)-RIL competent cells. A single colony of E coli BL21(DE3)-RIL strain carrying pET28a-SUMO-HECT was inoculated in 100 ml of LB medium supplemented with 50 μg/ml kanamycin and 50 μg/ml of chloramphenicol. An aliquot (1%) of the overnight-grown culture was inoculated in fresh LB medium supplemented with the same antibiotics and left shaking at 200 rpm for 5 h at 37 °C. The cultures were then down tempered to 18 °C for 1 h before induction with 200 nM IPTG for 16 h at 18 °C. The cells were harvested by centrifuging the culture at 8000 rpm (Avanti J-265, Beckman Coulter) for 15 min at 4 °C. The cell pellet was resuspended in lysis buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 10% glycerol, 5 mM β-mercaptoethanol (βME), and 20 mM Imidazole along with 0.2 ml of a mixture of protease inhibitors. Cell lysis was performed chemically, by incubation with hen egg white lysozyme, DNase I, and deoxycholate for about 1 h, incubated on ice. The soluble and insoluble cell fractions were separated by centrifuging the cell lysate at 18,000 rpm (CP100NX, Hitachi) for 60 min at 4 °C. The supernatant was loaded onto an immobilised metal affinity column (nickel-nitrilotriacetic acid column) that was pre-equilibrated with equilibration buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 10% glycerol, 5 mM βME, and 20 mM Imidazole). The column was washed with 25 column volumes of wash buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 10% glycerol, 5 mM βME, and 40 mM Imidazole) to get rid of any nonspecifically bound proteins. Finally, the bound HECT protein was eluted with elution buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 5% glycerol, 5 mM βME, and 300 mM Imidazole) and subsequently dialysed overnight against 25 mM Tris-HCl, pH 8.0, 500 mM NaCl, 5% glycerol, 5 mM βME. The tag was removed by overnight digestion with Ulp protease during dialysis. To separate the cut and uncut fraction, the dialysed protein was again passed through the nickel-NTA column and the flow through was collected. The collected protein was concentrated and was further purified by gel filtration chromatography using a HiLoad 16/600 Superdex 200 column equilibrated with 25 mM Tris-HCl, pH 8.0, 300 mM NaCl, 5% glycerol, 3 mM DTT.

Commercially sourced recombinant proteins

Human recombinant TGFβ1 (240-B-500/CF) was from R&D systems and TGFβ3 (RP8600) was from ThermoFisher. Recombinant His-UBE1 (E-305-025), His-UBCH5 (E2-616-100), His-UBCH7 (E2-640-100), and His-Ubiquitin (U-100H) were all from R&D Systems.

Western blot antibodies

Anti-TRIP12 antibody was from Novus (NB100-97822). antibodies against anti-SMAD2 (51-1300), anti-phospho SMAD2 (44244 G), Anti-SMAD4 (PA5-95245) and anti-beta Actin (MA515739) were from Invitrogen. Anti-SMAD2/3 (5678), anti-Smurf2 (12024) and anti-SMAD4 antibodies were from (Cell Signalling Technologies). Anti-GFP (11814460001) antibody was from Roche. HRP-conjugated anti-mouse (SAB3701106) and anti-rabbit (65-6120) secondary antibodies were from Invitrogen.

Immunoprecipitation (IP) and Mass Spectrometric (MS) Proteomics

Endogenous TRIP12 IP and MS proteomics were performed as before [61]. Sub confluent HCT116 cells were treated with a proteasome inhibitor (MG132) for 6 h. Cells were washed with ice-cold PBS and lysed in 1X cell lysis buffer (CLB; Cell Signalling Technology, #9803) or 1% Triton lysis buffer supplemented with protease inhibitors, PMSF (1 mM), and sodium fluoride (5 mM). Lysates were sonicated briefly and cleared by centrifugation for 5 min at 21,130 × g. Equal concentration and volume of cell lysates were pre-cleared with protein A/G Sepharose (Invitrogen) for 20 min at 4 °C. Precleared cell lysates were incubated with respective antibodies or control IgG (up to 5 μg/ml) on a rotating shaker in 4 °C overnight. Next morning, 30 μl of protein A/G Sepharose beads were added to each tube and further incubated for 3 h in 4 °C. Immuneprecipitates and beads complex were then washed three to five times in ice-cold lysis buffer supplemented with Halt^TM Protease Inhibitor Cocktail (ThermoFisher). Immunoprecipitated proteins were eluted in 4X SDS laemilli sample buffer. The eluted protein complexes were separated by SDS-PAGE on 8% Tris-HCl gel for 5–10 min at 150 volts. The gels were washed with distilled water and stained with instant blue Coomassie (Invitrogen) for 1–2 h and destained by three washes in distilled water. Separated and stained protein bands were excised by using a sterile razor blade placing the gel on top of a clean and clear piece of glass thoroughly cleaned with distilled water and 100% methanol. Each of the excised bands were placed into a sterile microcentrifuge tube (1.5 ml) and labelled carefully. The samples were subjected to MS analysis as previously described [61, 62]. The corresponding negative control lanes were also excised and analysed by MS, to ensure specificity in protein identification.

Immunoprecipitations and Western blotting

Protein complexes were immunoprecipitated and resolved by SDS-PAGE as described above, transferred to nitrocellulose membrane (ThermoFisher), blocked in 5% BSA/TBST, and incubated with the indicated antibodies in 4 °C overnight. Next morning, membranes were washed in TBST for a total of three times, 15 min each and then incubated with HRP-conjugated anti-mouse (1:5000 dilution) or anti-rabbit (1:10.000 dilution) secondary antibodies in 5% non-fat dry milk/TBST for 1 h on a rotating end over shaker at RT. After secondary antibody incubation membranes were washed three times quickly with distilled water to remove residual milk-antibody solution, and then washed in TBST three times for 15 min each. After the final wash, immunoblots were visualised by an enhanced chemiluminescent (ECL) HRP substrate (SuperSignal^TM West Pico PLUS, ThermoFisher) on a chemiluminescence gel documentation equipment (Gel doc, Biorad). For denaturing ubiquitin pull-down assays, cell pellets were first denatured in TBS/1% SDS/5 mM DTT (TSD) buffer and boiled for 10 min at 95 °C. The denatured extracts were sonicated and spun at high speed for 10 min at 21,130 × g. The lysates were then resuspended in buffer TNN (50 mM Tris pH 7.5, 250 mM NaCl, 5 mM EDTA, 0.5% NP-40) to dilute the SDS concentration. 50% volume of each sample lysate was incubated in 4 °C overnight with either HA-conjugated Protein Sepharose A/G (ThermoFisher) to elute the total ubiquitinated proteins or with the Myc-conjugated Protein Sepharose A/G beads (ThermoFisher) to elute the target protein to confirm similar levels of expression throughout all the samples. Immune complexes were washed 3X in ice cold TNN buffer after overnight incubation and processed for Western blotting as described above.

Luciferase reporter assay

The TGFβ responsive luciferase reporter assays were published before [63]. Briefly, cells were transiently transfected with 12XCAGA or 4XPAI luciferase synthetic promotors. All cells were transfected with GFP as a control to normalise the relative luciferase units. 24 h post-transfection, the cells were synchronised in 0.5% FBS media for 16 h. Next morning, the media was replaced with 0.5% FBS media ± 10 ng/ml TGFβ for 4 h. Cells were then washed and lyszed in luciferase reaction buffer and freeze thawed for efficient lysis of the monolayer. The lysates were then spun at 21,130 × g for 30 min to remove the cellular debris and luciferase signal was developed with the luciferase assay reagent kit (E1483, Promega) on a 96 well white background plate. Dual luciferase and GFP signals were recorded on a TECAN multiplate reader.

GST-pull-down assay

Purified recombinant GST-SMAD2 and SMAD4 proteins were incubated with HEK293T wildtype cellular extracts overnight. The interacting proteins were isolated by incubating the extracts with glutathione beads for up to 4 h at 4 °C. The lysates were washed three times in RIPA lysis buffer supplemented with Halt^TM Protease Inhibitor Cocktail (ThermoFisher). These samples were separated on the SDS–PAGE gel, proteins were blotted on a nitrocellulose membrane and detected with anti-TRIP12 and an anti-GST serum as above.

Cycloheximide chase protein stability assay

For protein stability assays, cells were grown as above to approximately 80% confluency and then incubated with the protein translation inhibitor cycloheximide (20 μg/ml) for indicated time points. Cells were washed three times with ice cold PBS, then harvested and lysed in RIPA lysis buffer supplemented with protease and phosphatase inhibitors. Samples were then processed for Western blotting as given above.

Sub-cellular fractionation

To isolate cytoplasmic and nuclear fractions, cell pellets were washed with ice cold PBS twice and then were lysed in fractionation buffer containing 20 mM HEPES pH = 7.4, 10 mM KCl, 2 mM MgCl₂, 1 mM EDTA, 1 mM PMSF, 0.5 mM NaF, 0.5 mM Na₃VO₄ supplemented with Halt^TM Protease Inhibitor Cocktail (ThermoFisher) by incubating on ice for 15 min. Cell suspension was passed through a 27-gauge needle until all cells are lysed and homogenised. The processed samples were further incubated on ice for 20 min to ensure complete cell lysis. Cell lysates were then separated by centrifugation at 21,130 × g for 15 min at 4 °C. The resultant supernatant was collected as ‘cytoplasmic’ fraction and stored at −80 °C. The remaining pellet was further processed for isolating the nuclear proteins by first resuspending in the fractionation buffer and then passing through a 25-gauge needle and centrifuging at 21,130 × g for 15 min at 4 °C. From this, the supernatant was discarded and the resulting pellet containing nuclei was resuspended in TBS supplemented with 0.1% SDS. The nuclear extracts were then sonicated and centrifuged at high speed to isolate the nuclear extracts from debris and insoluble fraction. Samples where then processed for Western blotting as given above.

RNA extraction and quantitative Reverse Transcriptase (qRT)-PCR

RNA was extracted using GeneJet RNA Purification Kit (K0731, ThermoFisher). A total of 1000 ng RNA was used to synthesise cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). For qRT-PCR, PowerUp SYBR Green Master Mix was used (Applied Biosystems). Primers used to amplify human TGFβ pathway genes were as follows Actin, forward (fwd): GGATGCAGAAGGAGATCACTG and reverse (rev): CGATCCACACGGAGTACTTG, ADAM19 fwd: CAGCACTTGCCCCAAAGT and rev: CAGGTCTAGATTTTCGAGCTAATCA, CTGF fwd: CTCCTGCAGGCTAGAGAAGC, and rev: GATGCACTTTTTGCCCTTCTT, PAI fwd: AAGGCACCTCTGAGAACTTCA and rev: CCCAGGACTAGGCAGGTG, P21 fwd: ATGTCAGAACCGGCTGGGGATG and rev: GGGCTTCCTCTTGGAGAAGATC, SMAD7 fwd: GACAGCTCAATTCGGACAAC and rev: TCTCGTAGTCGAAAGCCTTG, and TMEPAI fwd: GCACAGTGTCAGGCAACGG and rev: AGATGGTGGGTGGCAGGTC.

Cell migration assay

A total of 5 × 10⁴ MDA-MB-231 cells were suspended in 200 μl of serum-free DMEM medium and seeded into the upper chamber of each insert (24-well insert; pore size, 8 μm; BD Biosciences). Then, 700 μl of DMEM containing 10 ng/ml TGFβ were added to the lower chamber of a 24-well plate. After incubation at 37 °C for 12–16 h, migrated cells were washed (twice with PBS), and fixed with 4% paraformaldehyde (PFA). Fixed cells were permeabilized with 100% methanol and stained for 15 min in crystal violet solution (0.5% crystal violet in 25% methanol/PBS). Each insert was washed with PBS to remove excess stain. Cells that did not migrate to the lower compartment were removed with a cotton swab. Each insert was photographed in five random fields and total number of cells ± TGFβ treatment were counted by Fiji 2 software (Wayne Rasband, National Institute of Health, USA). The data is presented as fold change in number of migrated cells upon TGFβ induction.

Lentivirus production and concentration

Lentivirus particles were produced in HEK293FT cells. The target and packaging plasmids were co-transfected (2nd or 3rd generation) using lipofectamine 3000 reagent. The cells were incubated with transfection mix overnight and the next morning the media was changed with fresh media. 48 h after transfection the media was collected and filtered through a 0.45 μm syringe filters and the viruses were stored in aliquots at −80 °C. Cells were transduced in regular media supplemented with polybrene (8 μg/ml). 24 h later, stable cells were selected in 1 μg/ml puromycin for up to 48 h. Stable pooled cells were propagated, validated, and use for experiments after validation.

Lentivirus particles were concentrated using either a homemade lentivirus concentrator (40% w/v PEG-8000, 1.2 M NaCl) or Lenti-X^ΤΜ concentrator (Takara Biosciences) using the supplier’s protocol. Briefly, 3 parts of sterile filtered lentiviral supernatant from HEK293FT cells was incubated with 1 part of lentivirus concentrator and incubated at 4 °C overnight on rotating platform. The next morning, precipitates were pelleted at 1600 × g in 4 °C for 60 min, supernatant discarded, and the pellets were resuspended either in organoids transduction media or in 1% sterile BSA/PBS solution.

Zebrafish trip12 model

Zebrafish (Danio rerio) wildtype (AB) adults were maintained in standard conditions under an approved protocol by the local Animal Care (QF-EVMC-IACUC 2020-1132). We used the CRISPR gene editing approach to knockout the zebrafish trip12 ENSDARG00000061397. Two single guide RNA (sgRNA) targeting exon 1 sgRNA 1: GAATTAGGCCGGTTGGACAT, and exon 2 sgRNA2: AACAGCCTCTCTCTATCCGT were designed. The ribonucleoprotein (RNP) of the two sgRNAs and Cas9 mix was injected at 1-cell stage zebrafish embryos. At 24 h post-fertilisation, pooled embryos (n = 50) were collected for High Resolution Melting (HRM) curve assay. HRM was performed using Applied Biosystems in triplicates using 1 µl of the diluted sample in 20 µl reaction containing primers at final concentration of 300 nM, MeltDoc DNAs (AA, AG, GG) were run as controls and gave HRM profiles as expected in addition to the negative control. trip12 exon 1 primers: Fw TGAATGGTAGTGTCTAGAAAGGGT, Rev AGTGTGTGGTCTATTGGCTGGG with amplicon size 140 bp and exon 2 primers, fwd GGGTTCTCAAGTTCTTTCCTCTT, rev TGCTGCTTCCAAGTCTGGAT with amplicon size 100 bp.

Zebrafish development characterisation

We examined the effect of CRISPR/Cas9 injection on zebrafish survival rate and gross morphology of the developing embryo. The development was assessed at 48 h post-fertilisation in comparison to the control. The phenotype classification was scored as G1: severely affected development, G2: mildly affected development, G3: Normal development.

Drosophila lines

The following strains were obtained from the Bloomington Drosophila Stock Center: W1118 (#6326), UAS-ctrip-RNAi (#44481), UAS-Medea-RNAi (#33435). Dl-Gal4; Tub-Gal80ts, UAS-GFP flies were obtained from Lemaitre Bruno lab. For double knockdown we combined UAS-ctrip-RNAi (II chromosome) with UAS-Medea-RNAi (III chromosome). Flies were reared on standard cornmeal/agar medium at 25 °C unless noted otherwise. The flies were transferred to fresh food vials every two days. Conditional expression in adult flies using tub-Gal80ts was achieved by maintaining flies at 18 °C until eclosion, then shifting young adults to 29 °C for 3 days before gut dissection.

Drosophila gut Immunofluorescence

Experimental F1 flies were sorted, their external appendages were removed, and an intact gastrointestinal tract was dissected in 1X PBS and fixed in PBST (PBS with 0.1% Triton) containing 4% paraformaldehyde for 30 min. Three to six fly guts were processed as one experimental sample. Samples were then rinsed with PBST three times (15 min each) and blocked for 1 h in PBST containing 1% BSA. After blocking, samples were stained at 4 °C overnight with the mouse anti-Prospero (DSHB: MR1A, 1:20) primary antibody prepared in blocking buffer. Fly guts were washed with PBST three times and incubated with secondary antibodies (1:200) in blocking buffer at room temperature for 1 h in the dark. The secondary antibody used was goat anti-mouse conjugated to Alexa-568. Fly guts were then washed with PBST three times, mounted in Vectashield (Vector Laboratories) containing DAPI (2 µg/mL). Images were captured with a spinning disk confocal microscope (Yokogawa CSU-X1) equipped with 10x and 20x lens. All images were adjusted and processed using Fiji 2.

Flow cytometric analysis

An intact gastrointestinal tract was dissected in 1 × 1% BSA/PBS buffer. Three fly guts were processed as one experimental sample. The isolated guts were subjected to enzymatic digestion by addition of 0.5% Trypsin-EDTA solution to each sample, vortexed and incubated at RT for 25–30 min. Digested guts were vortexed again and left to let the undigested midgut tissue sink to the bottom of the tube. The cells that were in suspension were collected in an eppendorf tube and gut digestion cycle was repeated on the undigested fraction until all the midgut tissue has been digested. Isolated cells were collected by centrifugation at 200 × g for 5 min at 4 °C, washed and stained with 50 µg/ml propidium iodide for live/dead cell separation. Dissociated cells from wildtype (e.g., w1118) Drosophila guts were used as controls. These cells were subjected to flow cytometry analysis and 10,000 cells were analysed per sample.

Mouse intestinal organoid culture

Mouse intestinal culture was established as before [64]. Isolated intestines from C57BLK6 mice were placed in a 50 ml falcon tube containing 25 ml ice-cold PBS supplemented with 1% penicillin/streptomycin and vortexed several times. The washing cycle was repeated for a total of 4X or until the wash buffer appears transparent. Washed intestines were then cut open with sterile scissors or razor blade and chopped into approximately 1 cm pieces. The cut pieces were carefully washed, pelleted, cleared, and then incubated in 1 mM EDTA/PBS for 30 min at 4 °C. After this, the samples were shaken vigorously to dislodge the villi and the tissues were then allowed to settle, supernatant removed, and tissues were transferred to 5 mM EDTA/PBS for a further 1 h at 4 °C. After this, the samples were shaken vigorously, and the supernatant was collected and spun down at 300 × g for 5 min. The supernatant was then discarded, and the pellet was resuspended in 50 μl of Culturex Basement Membrane Extract (BME Path Clear, RnD systems) and seeded in a pre-warmed 48-well plate. The plate was incubated at 37 °C for 15 min to allow the BME to polymerise. Organoids were grown in mouse intestinal organoid media (Intesticult, Stem cells).

Generation of CRISPR/Cas9 targeted intestinal organoids

3 to 5 days prior to lentivirus transduction, mouse intestinal organoids were trypsinized and plated in Intesticult media supplemented with 10 μm GSK3β inhibitor (CHIR, Tocris) 10 μm RHO kinase inhibitor (Y-27632, Tocris) and nicotinamide to obtain highly proliferating cystic organoids as established [65, 66]. On the day of transduction, at least 3 wells (100–200 organoids) were trypsinized and incubated with concentrated lentivirus (250 μl) in the media above supplemented with 8 μg/ml polybrene. The organoid-virus mixture was centrifuged at 600 × g for 1 h at 32 °C followed by incubation at 37 °C for at least 4 h to allow transduction. Transduced organoids were spun at 250 × g for 10 min, washed in ice cold Advanced DMEM F12 media (Gibco), and were resuspended and plated in BME on a 48-well plate. Stable organoids were selected in 1 μg/ml puromycin for 48 h after which, the selected pooled organoids were expanded and collected for validation of genetic manipulation via T7 restriction endonuclease assay.

Validation of genetic targeting of Trip12 locus

Genomic DNA was extracted from pelleted organoids cells using Lucigen QuickExtract™ DNA Extraction Solution (QE09050). A 426 bp product of mouse Trip12 Exon 3 was amplified using 2 μl extracted DNA template by a forward (Fwd: GACAGGTTTACTCATGACAGGC) and a reverse primer (Rev: CACAAGAACTCTCTGTCCTC) in a PCR reaction using high fidelity AmpliTaq Gold DNA Polymerases (ThermoFisher). Amplified PCR products were column purified using GeneJET PCR purification kit (K0702, ThermoFisher) and then analysed on a nano drop. 200 ng of purified PCR product in NEB Buffer 2 (New England Biolabs, M0302L) was then heat denatured 95 °C for 5 min followed by 95 °C for 30 s with a ramp rate of 2°/s in a thermocycler (BioRad). Samples were then mixed to form heteroduplexes by cooling down to 85 °C for 5 min followed by 85 °C for 10 s with a ramp rate of 0.1°/s and then to 19 °C for 5 min on a thermocycler as above. From this, 10 µl is removed as uncut fraction and rest of the product is treated with 0.7 µl of T7 endonuclease enzyme (New England Bio Labs) at 37 °C for 20 min. The reactions were either kept at −20 °C or used immediately for gel electrophoresis.

Immunofluorescence (IF) of organoids

Budding organoids were disintegrated in ice cold Advanced DMEM F12 media, spun at 250 × g for 5 min, and then plated as 20 μl mixture in BME on 8-well chamber slides (Sigma-Aldrich). 3 to 5 days after plating, the organoids were washed with 1X PBS and the cells were fixed in 4% paraformaldehyde (ThermoFisher) for 30 min at RT. The fixed organoids were washed 2X in wash buffer (1% BSA/PBS) and then incubated in permeabilization buffer (0.8% Triton in PBS) for 15 min at RT. Organoids were washed again in PBS and then blocked in blocking buffer (5% BSA/PBS) for 1 h at RT. For IF, organoids were incubated with cleaved caspase-3 (CC3, BD Biosciences) antibody overnight at 4 °C, washed 3X in wash buffer and incubated with Alexa Fluor™ 555 conjugated donkey anti-rabbit antibody for 1 h at RT. Stained organoids were washed 3X and counterstained with Prolong^ΤΜ Gold Antifade DAPI (P10144, Invitrogen) and mounted with a glass coverslip for imaging as above. For labelling of proliferating ISCs and transit amplifying cells (TA), organoids were pulsed with 10 μm 5-ethynyl-2’-deoxyuridine (EdU) for 4 h. Fixation, permeabilization, and staining was performed using the Click-iT™ EdU Cell Proliferation Alexa Fluor™ 594 kit (C10339, Invitrogen). Stained organoids were counter-stained with DAPI and mounted for imaging as above.

Statistical calculations

Statistics were done by Student’s t test unless otherwise stated. Grouped analyses were performed by One-way or Two-way ANOVA.

Data availability

Raw files of proteomics datasets are uploaded in publicly available database Zenodo (DOI: 10.5281/zenodo.8343476).

References

Massagué J. The transforming growth factor-beta family. Annu Rev Cell Biol. 1990;6:597–41.
Article PubMed Google Scholar
Moses HL, Serra R. Regulation of differentiation by TGF-beta. Curr Opin Genet Dev. 1996;6:581–6.
Article CAS PubMed Google Scholar
Massagué J, Blain SW, Lo RS. TGFbeta signaling in growth control, cancer, and heritable disorders. Cell. 2000;103:295–309.
Article PubMed Google Scholar
Heldin CH, Moustakas A. Signaling receptors for TGF-β family members. Cold Spring Harb Perspect Biol. 2016;8:8.
Article Google Scholar
Itoh S, Itoh F, Goumans MJ, Ten, Dijke P. Signaling of transforming growth factor-beta family members through Smad proteins. Eur J Biochem. 2000;267:6954–67.
Article CAS PubMed Google Scholar
Moustakas A, Heldin CH. The regulation of TGFbeta signal transduction. Development. 2009;136:3699–14.
Article CAS PubMed Google Scholar
Gu S, Feng X-H. TGF-β signaling in cancer. Acta Biochim et Biophys Sin. 2018;50:941–9.
Article CAS Google Scholar
Levy L, Hill CS. Alterations in components of the TGF-beta superfamily signaling pathways in human cancer. Cytokine Growth Factor Rev. 2006;17:41–58.
Article CAS PubMed Google Scholar
Massague J, Blain SW, Lo RS. TGFbeta signaling in growth control, cancer, and heritable disorders. Cell. 2000;103:295–309.
Article CAS PubMed Google Scholar
Hao Y, Baker D, Ten Dijke P. TGF-β-mediated epithelial-mesenchymal transition and cancer metastasis. Int J Mol Sci. 2019;20:11.
Article Google Scholar
Batlle E, Massagué J. Transforming growth factor-β signaling in immunity and cancer. Immunity. 2019;50:924–40.
Article CAS PubMed PubMed Central Google Scholar
Kavsak P, Rasmussen RK, Causing CG, Bonni S, Zhu H, Thomsen GH, et al. Smad7 binds to Smurf2 to form an E3 ubiquitin ligase that targets the TGF beta receptor for degradation. Mol Cell. 2000;6:1365–75.
Article CAS PubMed Google Scholar
Xue J, Lin X, Chiu WT, Chen YH, Yu G, Liu M, et al. Sustained activation of SMAD3/SMAD4 by FOXM1 promotes TGF-β-dependent cancer metastasis. J Clin Investig. 2014;124:564–79.
Article CAS PubMed PubMed Central Google Scholar
Lin X, Liang M, Feng XH. Smurf2 is a ubiquitin E3 ligase mediating proteasome-dependent degradation of Smad2 in transforming growth factor-beta signaling. J Biol Chem. 2000;275:36818–22.
Article CAS PubMed Google Scholar
Zhang Y, Chang C, Gehling DJ, Hemmati-Brivanlou A, Derynck R. Regulation of Smad degradation and activity by Smurf2, an E3 ubiquitin ligase. Proc Natl Acad Sci USA. 2001;98:974–9.
Article CAS PubMed PubMed Central Google Scholar
Agricola E, Randall RA, Gaarenstroom T, Dupont S, Hill CS. Recruitment of TIF1γ to chromatin via its PHD finger-bromodomain activates its ubiquitin ligase and transcriptional repressor activities. Mol Cell. 2011;43:85–96.
Article CAS PubMed Google Scholar
Gudjonsson T, Altmeyer M, Savic V, Toledo L, Dinant C, Grøfte M, et al. TRIP12 and UBR5 suppress spreading of chromatin ubiquitylation at damaged chromosomes. Cell. 2012;150:697–709.
Article CAS PubMed Google Scholar
Larrieu D, Brunet M, Vargas C, Hanoun N, Ligat L, Dagnon L, et al. The E3 ubiquitin ligase TRIP12 participates in cell cycle progression and chromosome stability. Sci Rep. 2020;10:789.
Article CAS PubMed PubMed Central Google Scholar
Seo BA, Kim D, Hwang H, Kim MS, Ma S-X, Kwon S-H, et al. TRIP12 ubiquitination of glucocerebrosidase contributes to neurodegeneration in Parkinson’s disease. Neuron. 2021;109:3758–74.e11.
Article CAS PubMed PubMed Central Google Scholar
Chen D, Shan J, Zhu WG, Qin J, Gu W. Transcription-independent ARF regulation in oncogenic stress-mediated p53 responses. Nature. 2010;464:624–7.
Article CAS PubMed PubMed Central Google Scholar
Chio II, Sasaki M, Ghazarian D, Moreno J, Done S, Ueda T, et al. TRADD contributes to tumour suppression by regulating ULF-dependent p19Arf ubiquitylation. Nat Cell Biol. 2012;14:625–33.
Article CAS PubMed Google Scholar
Gatti M, Imhof R, Huang Q, Baudis M, Altmeyer M. The Ubiquitin Ligase TRIP12 Limits PARP1 Trapping and Constrains PARP Inhibitor Efficiency. Cell Rep. 2020;32:107985.
Article CAS PubMed PubMed Central Google Scholar
Khan OM, Almagro J, Nelson JK, Horswell S, Encheva V, Keyan KS, et al. Proteasomal degradation of the tumour suppressor FBW7 requires branched ubiquitylation by TRIP12. Nat Commun. 2021;12:2043.
Article CAS PubMed PubMed Central Google Scholar
Keyan KS, Alanany R, Kohil A, Khan OM. E3 Ubiquitin Ligase TRIP12 controls exit from mitosis via positive regulation of MCL-1 in response to taxol. Cancers (Basel). 2023;15:2.
Article Google Scholar
Kajiro M, Tsuchiya M, Kawabe Y, Furumai R, Iwasaki N, Hayashi Y, et al. The E3 ubiquitin ligase activity of Trip12 is essential for mouse embryogenesis. PLoS One. 2011;6:e25871.
Article CAS PubMed PubMed Central Google Scholar
Bramswig NC, Lüdecke HJ, Pettersson M, Albrecht B, Bernier RA, Cremer K, et al. Identification of new TRIP12 variants and detailed clinical evaluation of individuals with non-syndromic intellectual disability with or without autism. Hum Genet. 2017;136:179–92.
Article CAS PubMed Google Scholar
O’Roak BJ, Stessman HA, Boyle EA, Witherspoon KT, Martin B, Lee C, et al. Recurrent de novo mutations implicate novel genes underlying simplex autism risk. Nat Commun. 2014;5:5595.
Article PubMed Google Scholar
Yoo NJ, Park SW, Lee SH. Frameshift mutations of ubiquitination-related genes HERC2, HERC3, TRIP12, UBE2Q1 and UBE4B in gastric and colorectal carcinomas with microsatellite instability. Pathology. 2011;43:753–5.
Article CAS PubMed Google Scholar
Li G, Yi S, Yang F, Zhou Y, Ji Q, Cai J, et al. Identification of mutant genes with high-frequency, high-risk, and high-expression in lung adenocarcinoma. Thorac Cancer. 2014;5:211–8.
Article CAS PubMed PubMed Central Google Scholar
Xie F, Zhang Z, van Dam H, Zhang L, Zhou F. Regulation of TGF-β superfamily signaling by SMAD Mono-Ubiquitination. Cells. 2014;3:981–93.
Article PubMed PubMed Central Google Scholar
Sinha A, Iyengar PV, Ten, Dijke P. E3 ubiquitin ligases: key regulators of TGFbeta signaling in cancer progression. Int J Mol Sci. 2021;22:2.
Article Google Scholar
Zhou F, Xie F, Jin K, Zhang Z, Clerici M, Gao R, et al. USP4 inhibits SMAD4 monoubiquitination and promotes activin and BMP signaling. EMBO J. 2017;36:1623–39.
Article CAS PubMed PubMed Central Google Scholar
Dhamija S, Yang CM, Seiler J, Myacheva K, Caudron-Herger M, Wieland A, et al. A pan-cancer analysis reveals nonstop extension mutations causing SMAD4 tumour suppressor degradation. Nat Cell Biol. 2020;22:999–10.
Article CAS PubMed Google Scholar
Zinski J, Tajer B, Mullins MC. TGF-beta family signaling in early vertebrate development. Cold Spring Harb Perspect Biol. 2018;10:6.
Article Google Scholar
Apidianakis Y, Rahme LG. Drosophila melanogaster as a model for human intestinal infection and pathology. Dis Model Mech. 2011;4:21–30.
Article CAS PubMed PubMed Central Google Scholar
Doupé DP, Marshall OJ, Dayton H, Brand AH, Perrimon N. Drosophila intestinal stem and progenitor cells are major sources and regulators of homeostatic niche signals. Proc Natl Acad Sci. 2018;115:12218–23.
Article PubMed PubMed Central Google Scholar
Hung RJ, Hu Y, Kirchner R, Liu Y, Xu C, Comjean A, et al. A cell atlas of the adult Drosophila midgut. Proc Natl Acad Sci USA. 2020;117:1514–23.
Article CAS PubMed PubMed Central Google Scholar
McGuire SE, Roman G, Davis RL. Gene expression systems in Drosophila: a synthesis of time and space. Trends Genet. 2004;20:384–91.
Article CAS PubMed Google Scholar
Entchev EV, Schwabedissen A, Gonzalez-Gaitan M. Gradient formation of the TGF-beta homolog Dpp. Cell. 2000;103:981–91.
Article CAS PubMed Google Scholar
Strigini M, Cohen SM. Wingless gradient formation in the Drosophila wing. Curr Biol. 2000;10:293–300.
Article CAS PubMed Google Scholar
Teleman AA, Cohen SM. Dpp gradient formation in the Drosophila wing imaginal disc. Cell. 2000;103:971–80.
Article CAS PubMed Google Scholar
Guo Z, Driver I, Ohlstein B. Injury-induced BMP signaling negatively regulates Drosophila midgut homeostasis. J Cell Biol. 2013;201:945–61.
Article CAS PubMed PubMed Central Google Scholar
Tian A, Jiang J. Intestinal epithelium-derived BMP controls stem cell self-renewal in Drosophila adult midgut. Elife. 2014;3:e01857.
Article PubMed PubMed Central Google Scholar
Wrighton KH, Lin X, Feng X-H. Phospho-control of TGF-β superfamily signaling. Cell Res. 2009;19:8–20.
Article CAS PubMed Google Scholar
Xu P, Liu J, Derynck R. Post-translational regulation of TGF-β receptor and Smad signaling. FEBS Lett. 2012;586:1871–84.
Article CAS PubMed PubMed Central Google Scholar
Hata A, Chen YG. TGF-β signaling from receptors to Smads. Cold Spring Harb Perspect Biol. 2016;8:9.
Article Google Scholar
Vuzman D, Levy Y. Intrinsically disordered regions as affinity tuners in protein-DNA interactions. Mol Biosyst. 2012;8:47–57.
Article CAS PubMed Google Scholar
Wan M, Huang J, Jhala NC, Tytler EM, Yang L, Vickers SM, et al. SCF(beta-TrCP1) controls Smad4 protein stability in pancreatic cancer cells. Am J Pathol. 2005;166:1379–92.
Article CAS PubMed PubMed Central Google Scholar
Liang M, Liang YY, Wrighton K, Ungermannova D, Wang XP, Brunicardi FC, et al. Ubiquitination and proteolysis of cancer-derived Smad4 mutants by SCFSkp2. Mol Cell Biol. 2004;24:7524–37.
Article CAS PubMed PubMed Central Google Scholar
Xu J, Attisano L. Mutations in the tumor suppressors Smad2 and Smad4 inactivate transforming growth factor beta signaling by targeting Smads to the ubiquitin-proteasome pathway. Proc Natl Acad Sci USA. 2000;97:4820–5.
Article CAS PubMed PubMed Central Google Scholar
Yang L, Wang N, Tang Y, Cao X, Wan M. Acute myelogenous leukemia-derived SMAD4 mutations target the protein to ubiquitin-proteasome degradation. Hum Mutat. 2006;27:897–905.
Article CAS PubMed Google Scholar
Dupont S, Mamidi A, Cordenonsi M, Montagner M, Zacchigna L, Adorno M, et al. FAM/USP9x, a deubiquitinating enzyme essential for TGFbeta signaling, controls Smad4 monoubiquitination. Cell. 2009;136:123–35.
Article CAS PubMed Google Scholar
Yuan B, Liu J, Shi A, Cao J, Yu Y, Zhu Y, et al. HERC3 promotes YAP/TAZ stability and tumorigenesis independently of its ubiquitin ligase activity. Embo J. 2023;42:e111549.
Article CAS PubMed Google Scholar
Spit M, Koo BK, Maurice MM. Tales from the crypt: intestinal niche signals in tissue renewal, plasticity and cancer. Open Biol. 2018;8:9.
Article Google Scholar
Massagué J. TGFbeta in cancer. Cell. 2008;134:215–30.
Article PubMed PubMed Central Google Scholar
Ikushima H, Miyazono K. TGFbeta signalling: a complex web in cancer progression. Nat Rev Cancer. 2010;10:415–24.
Article CAS PubMed Google Scholar
Date S, Sato T. Mini-gut organoids: reconstitution of the stem cell niche. Annu Rev Cell Dev Biol. 2015;31:269–89.
Article CAS PubMed Google Scholar
Xu J, Lamouille S, Derynck R. TGF-beta-induced epithelial to mesenchymal transition. Cell Res. 2009;19:156–72.
Article CAS PubMed Google Scholar
Esposito M, Mondal N, Greco TM, Wei Y, Spadazzi C, Lin SC, et al. Bone vascular niche E-selectin induces mesenchymal-epithelial transition and Wnt activation in cancer cells to promote bone metastasis. Nat Cell Biol. 2019;21:627–39.
Article CAS PubMed PubMed Central Google Scholar
Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, et al. A versatile viral system for expression and depletion of proteins in mammalian cells. PLoS One. 2009;4:e6529.
Article PubMed PubMed Central Google Scholar
Khan OM, Carvalho J, Spencer-Dene B, Mitter R, Frith D, Snijders AP, et al. The deubiquitinase USP9X regulates FBW7 stability and suppresses colorectal cancer. J Clin Investig. 2018;128:1326–37.
Article PubMed PubMed Central Google Scholar
Schwanhäusser B, Busse D, Li N, Dittmar G, Schuchhardt J, Wolf J, et al. Global quantification of mammalian gene expression control. Nature 2011;473:337–42.
Article PubMed Google Scholar
Simonsson M, Kanduri M, Gronroos E, Heldin CH, Ericsson J. The DNA binding activities of Smad2 and Smad3 are regulated by coactivator-mediated acetylation. J Biol Chem. 2006;281:39870–80.
Article CAS PubMed Google Scholar
Novellasdemunt L, Kucharska A, Baulies A, Hutton C, Vlachogiannis G, Repana D, et al. USP7 inactivation suppresses APC-mutant intestinal hyperproliferation and tumor development. Stem Cell Rep. 2023;18:570–84.
Article CAS Google Scholar
Van Lidth de Jeude JF, Vermeulen JL, Montenegro-Miranda PS, Van den Brink GR, Heijmans J. A protocol for lentiviral transduction and downstream analysis of intestinal organoids. J Vis Exp. 2015;20:52531.
Google Scholar
Novellasdemunt L, Foglizzo V, Cuadrado L, Antas P, Kucharska A, Encheva V, et al. USP7 Is a Tumor-Specific WNT Activator for APC-mutated colorectal cancer by mediating beta-catenin deubiquitination. Cell Rep. 2017;21:612–27.
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We would like to thank Dr Nayef Mazloum from Weill Cornell Medical College (Qatar) for providing mouse intestinal tissue for culturing mouse intestinal epithelial organoids. We thank Dr Adam Doyle from metabolomics and proteomics facility of York University (United Kingdom) for his support during and after the proteomics experiment and analysis. We thank Dr Jithesh Puthen from College of Health & Life Sciences (HBKU, Qatar) for his help with gene ontology analysis.

Funding

This work was supported by Qatar National Research Fund’s (QNRF) grant NPRP13S-0121-200130 to the Lead Principal Investigator (PI) and senior author OK and an intramural grant from Hamad bin Khalifa University, Doha (Qatar). KSK is a graduate student funded by NPRP13S-0121-200130 grant and an HBKU tuition waiver scholarship. FM is a collaborative PI on NPRP13S-0121-200130.

Author information

Authors and Affiliations

College of Health and Life Sciences, Hamad Bin Khalifa University, Doha, Qatar
Kripa S Keyan, Safa Salim, Swetha Gowda, Syeda Sakina Amir, Maria Teresa Bengoechea-Alonso, Amira Alwa, Subrat Dahal, Johan Ericsson, Farhan Mohammad & Omar M Khan
Department of Research, Sidra Medicine, Doha, Qatar
Doua Abdelrahman & Sahar Da’as
Qatar Biomedical Research Institute, Doha, Qatar
Zeyaul Islam & Prasanna R. Kolatkar
Centre de Recherches en Cancérologie de Toulouse, Université de Toulouse, Inserm, CNRS, Université Toulouse III-Paul Sabatier, Toulouse, France
Claire Vargas & Jerome Torrisani

Authors

Kripa S Keyan
View author publications
You can also search for this author in PubMed Google Scholar
Safa Salim
View author publications
You can also search for this author in PubMed Google Scholar
Swetha Gowda
View author publications
You can also search for this author in PubMed Google Scholar
Doua Abdelrahman
View author publications
You can also search for this author in PubMed Google Scholar
Syeda Sakina Amir
View author publications
You can also search for this author in PubMed Google Scholar
Zeyaul Islam
View author publications
You can also search for this author in PubMed Google Scholar
Claire Vargas
View author publications
You can also search for this author in PubMed Google Scholar
Maria Teresa Bengoechea-Alonso
View author publications
You can also search for this author in PubMed Google Scholar
Amira Alwa
View author publications
You can also search for this author in PubMed Google Scholar
Subrat Dahal
View author publications
You can also search for this author in PubMed Google Scholar
Prasanna R. Kolatkar
View author publications
You can also search for this author in PubMed Google Scholar
Sahar Da’as
View author publications
You can also search for this author in PubMed Google Scholar
Jerome Torrisani
View author publications
You can also search for this author in PubMed Google Scholar
Johan Ericsson
View author publications
You can also search for this author in PubMed Google Scholar
Farhan Mohammad
View author publications
You can also search for this author in PubMed Google Scholar
Omar M Khan
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

OMK conceived and designed the study. FM conceived and designed the Drosophila experiments. KSK performed the experiments in mammalian cell lines, collected the data, and helped with figure assembly. CV and JT generated some of the TRIP12 deletion mutant plasmids. JE and MTB-A generated plasmids for recombinant SMAD proteins, TGFβ luciferase activity and HepG2 cells stably expressing a control or an shTRIP12. SS, SG and AA performed Drosophila gut immunofluorescence and wing studies. SD generated CRISPR targeted zebrafish and DA conducted zebrafish studies. SSA generated the shTrip12 stable mouse NIH3T3 fibroblasts and performed experiments on those cells. OMK generated the Trip12 knockout organoids. SD, ZI, and PRK purified TRIP12 HECT domains and performed in vitro ubiquitylation. OMK, FM, KSK, SS and SG helped with figure assembly. OMK wrote the manuscript. FM, JE, and SD helped with manuscript writing.

Corresponding authors

Correspondence to Farhan Mohammad or Omar M Khan.

Ethics declarations

Competing interests

The authors declare no competing interests.

Ethics statement

All experiments complied with HBKU institutional biosafety committee (IBC-00001144). Mouse intestines were obtained from Dr Nayef Mazloum from WCM-Qatar and complied by Qatar Foundation’s institutional animal care and use committee.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Edited by Professor Anastasis Stephanou

Supplementary information

Supplementary Figs. 1 to 5

Author checklist

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Keyan, K.S., Salim, S., Gowda, S. et al. Control of TGFβ signalling by ubiquitination independent function of E3 ubiquitin ligase TRIP12. Cell Death Dis 14, 692 (2023). https://doi.org/10.1038/s41419-023-06215-y

Download citation

Received: 19 June 2023
Revised: 27 September 2023
Accepted: 05 October 2023
Published: 20 October 2023
DOI: https://doi.org/10.1038/s41419-023-06215-y