Introduction

Metabotropic glutamate receptor 2 (mGlu2) belongs to the metabotropic glutamate (mGlu) group II receptors. These receptors are neurotransmitter G protein-coupled receptors (GPCRs) that modulate glutamatergic neuronal activity [1]. mGlu2 is composed of an extracellular Venus Flytrap domain, a cysteine-rich domain, and a heptahelical domain and is predominantly coupled to Gi/o proteins, which leads to inhibition of cAMP formation and voltage-gated Ca2+ channels and activation of K+ channels. Extensive studies indicate that activation of group II mGlu receptors may have promising antipsychotic effects [2, 3]. The drugs targeting to mGlu2 are expected to be the next generation of antipsychotics, which may significantly improve both positive and negative symptoms in patients with schizophrenia. These new antipsychotics are intriguing since the current antipsychotics that target the dopamine and serotonin pathways have more effects on positive symptoms [3, 4]. However, the failure of group II mGlu receptor agonists in Phase II clinical trials[5, 6] has been a hindrance to their advancement to market.

There is debate on the potential for agonists of group-II mGlu receptors to be used as therapeutic agents for the treatment of schizophrenia: “Still promising or a dead end?” [7]. Owing to the conservation of Venus Flytrap domain, group-II mGlu agonists are unable to discriminate between mGlu2 and mGlu3 [8]. Overcoming this problem will require clear elucidation of the mechanisms of activation associated with each receptor subtype. Studies suggest distinct and important roles for mGlu2. For example, mGlu2 is enriched in the medial prefrontal cortex, which is linked to schizophrenia, whereas the dorsolateral entorhinal cortex and piriform cortex regions are enriched with mGlu3 [9]. Moreover, results from mGlu2 and mGlu3 knockout mice suggest that mGlu2 plays an important role in mediating antipsychotic activity in schizophrenia [10, 11], while mGlu3 is crucial in exerting neuroprotective effects [12]. While more selective and potent mGlu2 agonists or positive allosteric modulators (PAMs) are currently being developed, the understanding of the precise mechanisms of mGlu2 signaling remains incomplete, and additional studies are necessary.

Receptor tyrosine kinases (RTKs) communicate with GPCR signaling. RTKs, such as epidermal growth factor, platelet-derived growth factor, brain-derived neurotrophic factor, nerve growth factor, and insulin like growth factor 1 (IGF-1), can be transactivated in response to GPCR activation by neurotransmitters and neuropeptides, which elicits a wide variety of functions [13]. Activation of IGF-1 receptor (IGF-1R) increases extracellular signal-regulated kinase1/2 (ERK1/2) phosphorylation, which might be beneficial to neuronal survival, brain development, and cognitive function [14]. Moreover, IGF-1 has been identified as a promising target or marker in brain disorders, such as schizophrenia [15,16,17] and Alzheimer’s disease [18, 19]. IGF-1R is transactivated by angiotensin II type 1 receptor and GABAB receptor [20, 21]. However, whether there is crosstalk between mGlu2 and IGF-1R remains to be elucidated.

In the current study, we aimed to characterize the downstream signaling pathway of mGlu2. We found that mGlu2 activation resulted in transactivation of IGF-1R and further increased ERK1/2 and cAMP response element-binding protein (CREB) phosphorylation. It was determined that the Gi/o protein, Gβγ subunits, phospholipase C (PLC), and focal adhesion kinase (FAK) were involved in the IGF-1R signal axis induced by mGlu2. In addition, the results from cortical neurons using an mGlu2-specific PAM confirmed that activation of IGF-1R by endogenous mGlu2 was similar to that in the heterogeneous expression system. IGF-1R and the downstream signaling axis activated in response to mGlu2 should provide a better understanding of how mGlu2 is associated with brain disease.

Materials and methods

Drugs

The drugs LY379268, LY341495, LY487379, PF573228, and U0126 were purchased from Tocris Bioscience (Shanghai, China). Pertussis toxin (PTX), AG1024, and U73122 were purchased from Merck Biosciences (Shanghai, China). F-12 medium and other solutions used for cell culture were purchased from Thermo Fisher Scientific (Shanghai, China). Fetal bovine serum (FBS) was purchased from Zhejiang Tianhang Biotechnology, China. Bovine serum albumin (BSA) was purchased from Biosharp, Shanghai, China.

Plasmids

The pcDNA3-c-myc-CD8-βARK plasmid, which includes the CD8-antigen membrane receptor and a domain containing the G protein βγ subunit-binding site of GRK2, was a generous gift from Dr. Philippe Rondard (Institut de Genomique Fonctionnelle, Montpellier, France).

Antibodies

Primary antibodies for the detection of specific phosphorylated forms and non-phosphorylated forms of the various target antigens included rabbit anti-Phospho-p44/42 mitogen-activated protein kinase (MAPK) (pERK1/2) (phosphorylated at Thr202/Tyr204) antibody (#9101), rabbit anti-p44/42 MAPK (ERK1/2) antibody (#9102), rabbit anti-Phospho-IGF-I receptor β (Tyr1135/1136) (19H7) antibody (#3024), rabbit anti-IGF-I receptor β antibody (111A9) (#3018), rabbit anti-Phospho-FAK (Tyr397) antibody (#3283), rabbit anti-FAK antibody (#3285), mouse anti-Phospho-CREB (Ser133) (1B6) antibody (#9196), and rabbit anti-CREB antibody (#9197). All of these antibodies were purchased from Cell Signaling Technology (Shanghai, China).

CHO-mGlu2 cell line generation and culture

A stable cell line overexpressing mGlu2 was established using Chinese hamster ovary cells Flp-In-CHO. Human GRM2 cDNA (NM_000839.4) was subcloned into the mammalian expression vector pcDNA5/FRT using the restriction enzymes NheI and BamHI. The plasmid pcDNA5/FRT-mGlu2 was transfected into CHO cells under hygromycin B (Roche, Shanghai, China) selection. Transfected CHO-mGlu2 colonies were subjected to immunoblotting to determine the level of mGlu2 expression. The cell lines were cultured in F-12 medium supplemented with 10% FBS, 0.2 M glutamine, and 0.5% penicillin/streptomycin. Cell cultures were incubated at 37 °C in a humidified atmosphere containing 5% CO2. Flp-In-CHO cell and pcDNA5/FRT vector were purchased from Invitrogen (Shanghai, China).

shRNA transfection

The short hairpin RNA (shRNA) plasmid used in the IGF-1R RNAi knockdown experiments was described previously [21]. The forward DNA template was gatccccgaagatttcacagtcaacttcctgtcagattgactgtgaaatcttcggtttttg, and the reverse DNA template was aattcaaaaaccgaagatttcacagtcaatctgacaggaagttgactgtgaaatcttcggg. IGF-1R shRNA or shRNA vectors were transfected following the protocol of Lipofectamine 2000 (Invitrogen, Shanghai, China). Briefly, shRNA and Lipofectamine 2000 were diluted in Opti-MEM (Invitrogen, Shanghai, China) and then combined for 20 min at room temperature to allow for the formation of transfection complexes. Complexes were added to cells for 6–8 h at 37 °C. The medium was exchanged with fresh growth medium, and cells were grown for another 72 h in culture before being used for experiments.

Western blotting analysis

CHO cell lysates were sonicated, and the total protein concentrations were determined using Bradford reagent (Beyotime Biotechnology, Shanghai, China). Samples were adjusted to equal protein concentrations; mixed with 4× loading buffer containing 200 mM Tris-HCl pH 6.8, 40% glycerol, 8% sodium dodecyl sulfate (SDS), 0.4% bromophenol blue, and 400 mM dithiothreitol; and heated at 100 °C for 5 min. Equal amounts of protein (10–20 μg) were resolved by SDS-polyacrylamide gel electrophoresis on 10% gels. Proteins were transferred to nitrocellulose membranes (Millipore, Shanghai, China) and blocked for 2 h at room temperature (approximately 21 °C) with 5% nonfat dry milk buffer dissolved in TBS-T (TBS buffer with 0.1% Tween 20). The blots were incubated overnight at 4 °C with primary antibodies diluted in TBS-T containing BSA, followed by incubation with horseradish peroxidase-conjugated secondary antibodies (1:20,000; Cell Signaling Technology, Shanghai, China) for 2 h. Immunoblots were visualized using enhanced chemiluminescence reagents (Thermo Fisher Scientific, Shanghai, China) and imaged on X-ray film (Kodak, Shanghai, China). The immunoreactive band density was measured by the NIH Image software, ImageJ. All bands were normalized to the percentage of the total protein levels or β-actin control values.

Primary cortical neuronal cultures

All experiments were specifically designed to minimize the number of animals used and were approved by the Animal Experimentation Ethics Committee of the School of Life Science and Technology, Huazhong University of Science and Technology. Primary cortical neuronal cultures were prepared from day-18 embryonic mice as previously described [22]. Pregnant Kunming mice were obtained from Hubei Provincial Center for Disease Control and Prevention. Following dissection in ice-cold phosphate-buffered saline (PBS), the cerebral cortices were dissociated with a trypsin solution; plated at a density of 1–2 × 106 cells/dish onto poly-D-lysine (Sigma-Aldrich, Shanghai, China) coated 35-mm culture dishes; and cultured in Neurobasal medium (Gibico, Shanghai, China) supplemented with 10% FBS (Sijiqing, Hangzhou, China), B27 supplement, 0.5 mM GlutaMAX, 0.5% penicillin/streptomycin, and 25 µM L-glutamine. The medium was exchanged 24 h later for serum-free Neurobasal medium supplemented with B27 supplement, 0.5 mM GlutaMAX, and 0.5% penicillin/streptomycin. Half of the serum-free medium was replaced every 3–4 days. Cell cultures were maintained at 37 °C in a humidified atmosphere containing 5% CO2.

Drug treatments

For ERK, IGF-1R, FAK, and CREB activation assays, cultures were washed once with Ca2+-free HEPES-buffered solution (HBS) containing 10 mM HEPES pH 7.4, 140 mM NaCl, 4 mM KCl, 2 mM MgSO4, and 1 mM KH2PO4 and starved for 2 h in Ca2+-free HBS buffer. For inhibitor experiments, cells were preincubated at 37 °C with or without the inhibitor dissolved in HBS for the indicated time periods before drug stimulation. For PTX treatment, cells were pretreated or mock treated for 14–16 h with PTX (200 ng/mL). Cells were then stimulated at the indicated times by incubation with LY379268, LY487379, or an inhibitor prepared in fresh HBS. At the end of the treatment, the cells were quickly washed with ice-cold Ca2+-free PBS, pH 7.4. The cells were then lysed with 150 μL of SDS lysis buffer and placed immediately on ice. The cell lysates were analyzed by Western blotting. Drugs were dissolved in HBS with or without dimethyl sulfoxide (DMSO). When DMSO was used with the drugs, the same concentration of DMSO was added to the controls.

Statistical analysis

Data are presented as the mean ± SEM of at least three independent experiments. Statistical analysis was performed by one-way analysis of variance followed by Tukey’s post hoc test. Values with P < 0.05 were considered statistically significant.

Results

Activation of mGlu2 increased ERK1/2 phosphorylation through the Gi/o protein, Gβγ subunits, and PLC

Several reports have shown that the group II mGlu agonist LY379268 induced ERK1/2 phosphorylation [23,24,25,26]. To investigate the role of mGlu2, we generated a cell line that stably expressed human mGlu2 in Flp-In-CHO cells. Expression of mGlu2 in CHO-mGlu2 cells was verified using an mGlu2-specific antibody and Ca2+ release assay. The established cell line showed stable mGlu2 expression and an effective response (Figure S1).

ERK1/2 phosphorylation was detected in the CHO-mGlu2 cell line by LY379268 treatment. At 100 nM, LY379268 caused a rapid transient increase in ERK1/2 phosphorylation in CHO-mGlu2 with no alteration of the overall ERK1/2 expression levels (Fig. 1a). ERK1/2 phosphorylation peaked at 5 min and then gradually decreased back to the basal level. LY379268-induced ERK1/2 phosphorylation was dose dependent (Fig. 1b). The EC50 was approximately 12.1 ± 4.2 nM (n = 4). ERK1/2 was fully phosphorylated with 100 nM LY379268. For subsequent experiments, we chose to use 100 nM LY379268 for 5 min of stimulation, unless otherwise indicated.

Fig. 1
figure 1

Activation of mGlu2 increased ERK1/2 phosphorylation through Gi/o, Gβγ, and PLC in the CHO-mGlu2 cell line. a ERK1/2 phosphorylation following incubation with LY379268 (100 nM) for 0 to 60 min. Phospho-ERK1/2 (pERK1/2) increased at 3 min and peaked at 5 min, followed by decreasing at 10 min, 20 min, and 60 min to the basal level. *P < 0.05, ***P < 0.001 vs. 0 min; n = 9. b Dose response for the 5 min treatment of LY379268 on pERK1/2 in CHO-mGlu2 cells. An increase was observed at 30 nM and reached a plateau at 100 nM. *P < 0.05, **P < 0.01 vs. 0 nM; n = 4. c–e CHO-mGlu2 cells were pretreated with PTX (200 ng/mL) for 14–18 h or U73122 (5 μM) for 1 h or were transfected with CD8-βARK for 48 h, while there was no significant change of pERK1/2 compared with the basal level. LY379268 (100 nM, 5 min) increased ERK1/2 phosphorylation (***P < 0.001; n ≥ 3 per group), which was inhibited by PTX (###P < 0.001; n = 5), CD8-βARK (#P < 0.05; n = 3), or U73122 (###P < 0.001; n = 3)

Full size image

To confirm specificity, CHO-mGlu2 cells were pretreated with the mGlu2 and mGlu3 antagonist LY341495 and MEK inhibitor U0126 prior to LY379268 stimulation. Both LY341495 and U0126 decreased LY379268 induction of ERK1/2 phosphorylation (Figure S2).

We further investigated the signaling of mGlu2 toward ERK1/2 activation. Pretreatment of CHO-mGlu2 cells with 200 ng/mL PTX for 14–18 h blocked LY379268 induction of ERK1/2 phosphorylation (Fig. 1c). The CD8-βARK molecule consists of the transmembrane domain of CD8 as the membrane anchor and C-terminal region of GRK2 (βARK) and is characterized as a Gβγ scavenger [27]. Overexpression of CD8-βARK also inhibited LY379268-induced ERK1/2 phosphorylation (Fig. 1d). Pretreatment of cells with the selective PLC inhibitor U73122 abolished LY379268-induced ERK1/2 phosphorylation (Fig. 1e) as well.

IGF-1R transactivated by mGlu2

To confirm the role of IGF-1R in mGlu2-induced ERK phosphorylation, we first used AG1024, an inhibitor of IGF-1R. AG1024 abolished LY379268 stimulation of ERK1/2 phosphorylation (Fig. 2a). Activated pIGF-1R was used as a control to confirm the inhibitory effect of AG1024 on IGF-1R. In parallel, we used IGF-1R shRNA to knockdown the endogenous levels of IGF-1R. LY379268-activated ERK phosphorylation was reduced following interference with the IGF-1R shRNA (Fig. 2b). LY379268 caused a rapid and transient increase of IGF-1R phosphorylation without altering the IGF-1R protein expression levels (Fig. 2c, d).

Fig. 2
figure 2

Induction of ERK1/2 phosphorylation by mGlu2 through transactivation of IGF-1R. a Pretreatment with the IGF-1R inhibitor AG1024 (0.1 μM for 1 h) did not change ERK1/2 phosphorylation in CHO-mGlu2 cells but inhibited the LY379268 (100 nM for 5 min) increase of pERK1/2. Phospho-IGF-1R (pIGF-1R) was increased by LY379268 and inhibited by AG1024. ***P < 0.001, ###P < 0.001; n = 6. b CHO-mGlu2 cells were transfected with IGF1-R shRNA or control shRNA for 72 h, followed by treatment with 100 nM LY379268 for 5 min. IGF-1R shRNA decreased the expression of IGF-1R and decreased the LY379268 (100 nM for 5 min) increase of pERK1/2. **P < 0.01, ***P < 0.001, #P < 0.05; n = 3. c Effect of LY379268 (100 nM) treatment for different times on IGF-1R phosphorylation in CHO-mGlu2 cells. pIGF-1R increased at 1 min to 3 min. *P < 0.05, **P < 0.01 vs. 0 min; n = 4. d Effects of different concentrations of LY379268 on IGF-1R phosphorylation. At 30 nM to 100 nM, LY379268 (5 min) treatment significantly increased pIGF-1R in CHO-mGlu2 cells. *P < 0.05, ***P < 0.001 vs. 0 nM; n = 3

Full size image

Gβγ subunits, PLC, and FAK participated in mGlu2-induced IGF-1R transactivation

We then examined the role of the Gβγ subunits and PLC in mGlu2-induced IGF-1R transactivation. Overexpression of CD8-βARK or pretreatment with U73122 inhibited mGlu2-activated IGF-1R phosphorylation (Fig. 3a, b).

Fig. 3
figure 3

Gβγ, PLC, and FAK are involved in mGlu2-induced IGF-1R phosphorylation. a The plasmid CD8-βARK was transfected into CHO-mGlu2 cells for 48 h, followed by treatment with 100 nM LY379268 for 5 min. CD8-βARK did not change basal pERK1/2 but decreased LY379268-induced pIGF-1R (**P < 0.01, #P < 0.05; n = 5). b Pretreatment with U73122 (5 μM, 60 min) inhibited LY379268 (100 nM, 5 min)-induced pIGF-1R (**P < 0.01, ##P < 0.01; n = 4). c Pretreatment of the FAK inhibitor PF573228 (10 μM, 10 min) inhibited LY379268 (100 nM, 5 min)-induced pERK1/2 and pIGF-1R. Phospho-FAK (pFAK) was increased by LY379268 and inhibited by PF573228. **P < 0.01, ***P < 0.001, ###P < 0.001; n = 4. d FAK phosphorylation following incubation of CHO-mGlu2 cells with LY379268 (100 nM) for the time points indicated. pFAK increased after 3 min to 5 min incubation with LY379268. *P < 0.05 vs. 0 min; n = 3

Full size image

FAK was reported to activate and stabilize the IGF-1R signaling complex [28]. In our study, LY379268 increased FAK phosphorylation (Fig. 3d) and the FAK inhibitor PF573228 abolished mGlu2-induced IGF-1R, ERK1/2, and FAK phosphorylation in CHO-mGlu2 cells (Fig. 3c), indicating that FAK was involved in the observed mGlu2-induced IGF-1R transactivation.

IGF-1R and ERK1/2 are involved in mGlu2-induced CREB phosphorylation

CREB, an important transcription factor that regulates neurodevelopment, synaptic plasticity, and neuroprotection, was reported to function downstream of phosphorylated ERK1/2 [29]. We tested the response of CREB following mGlu2-mediated activation of the ERK1/2 pathway. We found that LY379268 transiently activated CREB phosphorylation in the CHO-mGlu2 cell line (Fig. 4a). Additionally, pretreatment of cells with AG1024 or U0126 blocked LY379268-induced CREB phosphorylation (Fig. 4b, c).

Fig. 4
figure 4

mGlu2-induced CREB phosphorylation was dependent on the transactivation of IGF-1R and ERK1/2. a LY379268 (100 nM) treatment of CHO-mGlu2 cells increased CREB phosphorylation at 5 min to 10 min, which decreased to the basal level after 30 min. ***P < 0.001 vs. 0 min; n = 5. b–c LY379268 (100 nM, 5 min) increased phospho-CREB (pCREB) was inhibited by pretreatment with the IGF-1R inhibitor, AG1024 (0.1 μM, 1 h) (***P < 0.001, ###P < 0.001; n = 5), and MEK inhibitor, U0126 (10 μM, 1 h) (**P < 0.01, ##P < 0.01; n = 6)

Full size image

Endogenous mGlu2 transactivate IGF-1R to induce ERK1/2 and CREB phosphorylation in primary cortical neurons

Owing to the conservation of the mGlu Venus Flytrap domain, LY379268 is a specific agonist of group II mGlu, but it cannot discriminate between mGlu2 and mGlu3 [8]. PAMs, which bind to the heptahelical domain, display better selectivity among each subtype. The drug LY487379 (N-(4-(2-methoxyphenoxy)-phenyl)-N-(2,2,2-trifluoroethylsulfonyl)-pyrid-3-ylmethyl-amine) is a selective PAM of mGlu2 and has little activity on mGlu3 [30]. Using LY487379, we detected endogenous mGlu2 signaling in neurons. LY487379 stimulation increased IGF-1R, ERK1/2, and CREB phosphorylation in primary cortical neuronal cultures (Fig. 5a). After inhibition of IGF-1R by AG1024, the LY487379-activated levels of IGF-1R, ERK1/2, and CREB phosphorylation were decreased (Fig. 5b).

Fig. 5
figure 5

mGlu2-specific PAM, LY487379, and transactivated IGF-1R are able to induce phosphorylation of ERK1/2 and CREB in cultured cortical neurons. a LY487379 (1 μM) treatment transitorily increased the phosphorylation of IGF-1R (*P < 0.05 vs. 0 min, n = 4), ERK1/2 (*P < 0.05 vs. 0 min; n = 3), and CREB (*P < 0.05 vs. 0 min; n = 3). b Effect of the IGF-1R inhibitor AG1024 (0.1 μM, 1 h) on LY487379-induced (1 μM, 5 min) phosphorylation of ERK1/2 (pERK1/2) and CREB (pCREB). Phospho-IGF-1R (pIGF-1R) was increased by LY487379 and inhibited by AG1024. **P < 0.01, ***P < 0.001, #P < 0.05, ###P < 0.001; n = 3

Full size image

Discussion

RTKs can be transactivated by GPCRs, leading to signaling. There are an increasing number of studies pertaining to the crosstalk between GPCRs and RTKs [13], but this study is the first to show that mGlu2 is able to transactivate IGF-1R. Only a few GPCRs were reported to transactivate IGF-1R, such as AT1R and GABAB receptor [20, 21]. We identified the transactivation of IGF-1R by mGlu2 and the involvement of the Gβγ subunits, PLC, and FAK in the activation process. Based on our findings and those of others, the non-RTK may be an important signal transducer. In AT1R transactivation of IGF-1R, Src, another non-RTK, was reported to be involved [20]. FAK was also found to act as a platform for protein–protein interactions and for the dissociation of G proteins, Src, and IGF-1R [31]. Meanwhile, our results demonstrated a role for the Gβγ complex and PLC in the initiation of the mGlu2-activated transduction, similar to the GABAB receptor, which also belongs to the GPCR group C and couples to the Gi/o protein [21]. PLC is more often demonstrated to be activated by Gq-coupled GPCRs, but there are also several reports showing their involvement in Gi/o-coupled GPCRs [21, 32], which is due to the activation of PLC by the Gβγ complex.

mGlu2 is a potential drug target for schizophrenia [2, 3]. Decreased mGlu2 activity has been shown in schizophrenia animal models and patients [33,34,35]. The most reported mechanism of mGlu2 in schizophrenia is through an interaction and crosstalk with the 5HT2a receptor. Decreased mGlu2 activity and hyperfunction of the 5HT2a receptor is observed in schizophrenia [36], and agonists or PAMs of mGlu2 have been developed to correct this imbalance for treating schizophrenia. However, recently, mGlu2 activation was also found to activate 5HT2a-Gq-Ca2+ signaling directly [37]. The role of mGlu2 is not clearly elucidated in schizophrenia. The plasma levels of IGF-1 decrease in patients with schizophrenia, as well as their offspring [15, 17], while antipsychotic treatment induces a significant elevation of serum IGF-1 [16]. Here mGlu2-transactivated IGF-1R indicated another role of mGlu2 leading to beneficial effects in schizophrenia by regulating IGF-1R signaling. Both 5HT2a and IGF-1R contributed to mGlu2 downstream signaling via the mGlu2-coupled Gi/o and Gβγ proteins [37]. Likewise, in an animal model of Alzheimer’s disease, reduced IGF-1/IGF-1R signaling exhibited fewer amyloid plaques, less amyloid β, diminished neuroinflammation, improved spatial memory, and reduced anxiety and premature death [18, 19, 38, 39], while inhibition of mGlu2 activity with antagonists improved learning and reduced anxiety as well as the levels of brain amyloid β in APP transgenic rodents [40]. Transactivation signaling from mGlu2 to IGF-1R supports the functional connections of the two receptors in pathological conditions.

Additionally, both mGlu2 and IGF-1R are widely expressed throughout the central nervous system. Activation of IGF-1R by mGlu2 leads to phosphorylation of ERK1/2/CREB, which plays important roles in long-term synaptic plasticity and in cognitive maintenance through regulation of protein synthesis and gene expression [29, 41]. CREB-targeted genes facilitate memory formation through induction of long-term synaptic plasticity, growth and formation of new synaptic spines and connections, and synthesis of new protein that participates in memory reconstruction [42]. Activation of IGF-1R to ERK and CREB phosphorylation should also contribute to the mGlu2 functions under normal physiological conditions.

There are reports showing the existence of mGlu2/4 heterodimers in transfected cell lines and native neurons, which can be activated by LY379268 [43, 44]. However, little research has been reported on the distinct roles of the mGlu2 homodimer and mGlu2/4 heterodimer [45]. We used a stable cell line expressing mGlu2 to detect and evaluate the effects of mGlu2 alone. Additionally, LY487379, which is a specific PAM of mGlu2 and does not affect the mGlu2/4 heterodimer [44, 45], was used in primary cortical neurons. In both the stable mGlu2-expressing cell line and neurons, we detected similar transactivation of the IGF-1R signal axis by mGlu2. Further investigation on the mGlu2 homodimer will be important to better define the distinct roles of mGlu2.

In conclusion, for the first time, we identified the transactivation of IGF-1R by an mGlu2 agonist or PAM, which required Gi/o, Gβγ subunits, PLC, and FAK, and led to the phosphorylation of ERK1/2 and CREB (Fig. 6). This signaling represents a new signaling mechanism of mGlu2 and suggests the role of the mGlu2 homodimer and its functional connection with IGF-1R in pathology.

Fig. 6
figure 6

Schematic representation of the mGlu2 signaling pathway. Activation of mGlu2 by an agonist or PAM leads to the activation of Gi/o and Gβγ subunits, further activating PLC and FAK to transactivate IGF-1R, which induces ERK1/2 and CREB phosphorylation

Full size image