Abstract
To enable computational analysis of regulatory networks within the cancer cell in its natural tumor microenvironment, we develop a two-stage histoepigenetic analysis method. The first stage involves iterative computational deconvolution to estimate sample-specific cancer-cell intrinsic expression of a gene of interest. The second stage places the gene within a network module. We validate the method in simulation experiments, show improved performance relative to differential expression analysis from bulk samples, and apply it to illuminate the role of the mesothelin (MSLN) network in pancreatic ductal adenocarcinoma (PDAC). The network analysis and subsequent experimental validation in a panel of PDAC cell lines suggests AKT activation by MSLN through two known activators, retinoic acid receptor gamma (RARG) and tyrosine kinase non receptor 2 (TNK2). Taken together, these results demonstrate the potential of histoepigenetic analysis to reveal cancer-cell specific molecular interactions directly from patient tumor profiles.
Similar content being viewed by others
Introduction
The study of oncogene expression in unperturbed cancer cells within their tumor microenvironment provides insights that may not be gained from other more accessible models that may not reflect as closely the tumor biology in vivo. The lack of correspondence of experimental models with tumor biology in vivo may lead to only partial understanding of oncogenic mechanisms, ultimately resulting in failures of experimental therapies targeting the oncogene. One illustrative example is the glycosylphosphatidylinositol-anchored cell-surface protein mesothelin (MSLN), whose expression is elevated in many pancreatic ductal adenocarcinoma (PDAC) cases1 and is associated with shorter overall survival2. Most of the current knowledge about MSLN’s function in the context of PDAC comes from mouse or cell-line models, which have shown its upregulation increases cancer cell proliferation, cell cycle progression, and cell survival3,4,5; while its interaction with MUC16 contributes to cell motility and invasion6,7. These models have shown limited utility for developing therapies targeting MSLN: while preclinical studies targeting MSLN in pancreatic cancer cell lines and patient-derived xenograft mouse models have resulted in inhibition of cancer growth8,9, early-stage clinical trials have shown stabilized disease or increase in survival for only a few patients10,11, with partial and overall responses being mostly low or absent12,13.
One obvious step toward addressing this problem is to study the oncogene and its network within its natural tumor microenvironment. However, transcriptional profiling of tumors is confounded by sample-to-sample differences in tumor purity and cell-type composition14,15. This is a particularly important concern for PDAC tumors as they can show an abundant and highly variable stromal component, leading to ambiguous interpretation of bulk expression profiles16. For example, a sample with higher bulk expression of MSLN may either contain cancer cells with higher intrinsic expression of MSLN or the expression of MSLN may be constant and the sample may just have higher purity (proportion of cancer cells), resulting in higher bulk expression of the gene. This ambiguity hampers not only cancer-cell intrinsic differential gene expression analysis, but also the analysis of genes of interest in the context of their cancer-cell-specific regulatory networks.
One approach toward addressing this problem would be to computationally tease apart the associated cancer cell-type-specific differences between groups of tumors. Numerous computational methods have been developed to account for tumor purity differences14, but cannot explicitly trace differential expression to specific cell types nor place the gene within its network module. Our previously developed Epigenomic Deconvolution (EDec) method17 partially addresses this problem by comparing cell-type-specific profiles starting from two groups of predefined groups of samples. One obvious limitation of EDec is the requirement that the two groups be predefined. This limitation precludes grouping by cell-intrinsic expression of genes of interest such as MSLN. To address this “chicken and egg” problem, we develop a histoepigenetic analysis method that expands on the EDec method in two ways: (1) It integrates within an iterative procedure a two-way clustering step with deconvolution to separate PDAC tumors based on cancer-cell-specific expression of a gene of interest such as MSLN; (2) It estimates a network of genes potentially interacting with the gene of interest. We here validate the method in simulation experiments, compare it to alternative approaches, and apply it to elucidate MSLN’s network within PDAC cancer cells.
Results
Deconvolution of TCGA PDAC datasets identifies four constituent cell types
We first applied the original EDec method to the DNA methylation and gene expression profiles of 150 PDAC tumors and 2 adjacent normal tissues within The Cancer Genome Atlas (TCGA) collection. EDec estimated four distinct cell type profiles, provided their per sample proportions, and provided estimates of cell-type-specific DNA methylation and expression profiles. Based on expression of known cell-type-specific marker genes, the profiles could be unambiguously recognized as belonging to stromal, immune, normal epithelial/acinar, and cancer cell types (Fig. 1a). Comparisons of deconvoluted tumor tissue to deconvoluted paired adjacent normal tissue showed a larger proportion of the predicted cancer cell type in the tumors compared to the normal tissues (Fig. 1b). The predicted cancer cell proportion in the normal tissue of patient TCGA.YB.A89D is consistent with previous central pathology review that noted “~10% neoplastic cellularity”15. Per sample estimates of cancer cell proportions for these 150 tumors showed high Spearman’s correlation with previous tumor purity estimates calculated using InfiniumPurify18 (r = 0.98, p < 2.2 × 10−16) and ABSOLUTE15 (r = 0.89, p < 2.2 × 10−16) (Fig. 1c). Likewise, precalculated leukocyte proportion estimates15 showed high correlation with immune cell proportion estimates (r = 0.96, p < 2.2 × 10−16) (Fig. 1c). These results suggest EDec properly estimated constituent cell types, their proportions within individual samples, and cell-type-specific expression profiles.
Grouping tumor samples by cancer-cell intrinsic expression of MSLN
The goal at the first stage of histoepigenetic analysis (see “Materials and methods” and Fig. 2a) was to group tumor samples based on cancer cell intrinsic MSLN expression—addressing complications introduced by tumor purity differences (Supplementary Fig. 1)—and to compare those with high vs. low expression. To test the performance of the method, we ran several simulations on mock pancreatic sample profiles containing reference cancer cell profiles with either high or low MSLN expression. Simulated mixing showed high correlation between estimated proportions and known mixed proportions (Supplementary Fig. 2a) and stable clustering into MSLN high vs MSLN low tumors (Supplementary Fig. 2b). Moreover, deconvoluted cell-type-specific gene expression profiles of these groups were also accurate (Supplementary Fig. 2c). Taken together, the results suggest that the method performed accurately. We next applied the method to the PDAC tumors in the TCGA dataset to identify and compare those with high vs. low cancer cell-intrinsic expression of MSLN. The first split yielded one group of PDACs with high cancer cell intrinsic MSLN expression and the other with lower expression. In the second step, the latter was further split into two groups (Supplementary Fig. 3a). The group with the lowest MSLN expression was then compared to the one with the highest (Fig. 2b).
We next compared the result of iterative grouping to grouping based on bulk profiles. For this purpose, we split samples into three quartiles for each method and compared the samples in the top (first) and bottom (third) quartile for each method. While the overlap was high (Fig. 2c), the exceptions could be explained by the confounding effect of tumor purity: bulk grouping incorrectly assigned 8 samples with low cancer cell MSLN levels but high tumor purity and missed 3 samples with high cancer cell MSLN levels but low tumor purity. Consistent with this finding, no significant differences were observed in the predicted cell-type proportions between the MSLN high vs MSLN low quartiles generated by the iterative method (Supplementary Fig. 3b), while the quartiles obtained from bulk profiling showed significant (p < 0.05, Wilcoxon rank-sum test) differences in several cell-type proportions—notably cancer—between groups (Supplementary Fig. 3c). Moreover, we also observed smaller survival differences between high and low groups based on cancer-cell intrinsic expression of MSLN compared to bulk expression levels of MSLN (Supplementary Fig. 4a). This observation suggests that survival differences observed from bulk profiling may be due to confounding effects of cell-type composition and tumor size19 evident in bulk comparisons (Supplementary Fig. 4b, c).
For the purpose of subsequent analyses, we focused on the sample set showing concordant MSLN high expression by both groupings and the sample set showing concordant MSLN low expression also by both groupings (30 and 35 samples respectively, indicated within circle overlaps in Fig. 2c).
Regulation of RARG by MSLN
We next examined genes whose cancer-cell intrinsic expression correlates with MSLN. Comparing cancer cell profiles between groups, 33 genes showed higher expression in the MSLN-high group and 55 showed lower expression (Supplementary Table 1). In addition to MSLN itself20, several of the 33 genes with higher expression within the MSLN-high group of tumors are associated with poor prognosis and tumor progression in PDAC patients, including KCNN4 (ref.21), TNK2 (ref.22), CAPG23, and MUC1 (ref.24). Gene set enrichment analyses (GSEA) of these 33 genes identified a highly enriched subset of 11 genes bound by retinoic acid receptor gamma (RARγ/ RARG) in mice25, including MSLN and RARG itself (Supplementary Table 2). This enrichment is biologically significant because RARγ is expressed in human pancreatic carcinomas26 and plays a role in pancreatic duct differentiation27. Notably, RARG was one of 22 genes not detected as being differentially expressed by bulk expression comparisons (Supplementary Table 1).
To explore the mechanistic link between MSLN and RARG expression, we utilized a panel of pancreatic cancer cell lines with a range of MSLN levels4. Cancer cell lines with higher levels of MSLN indeed showed a trend toward higher levels of RARG (Fig. 3a). Upon MSLN knockdown, 2 of 3 cell lines with high MSLN levels showed significantly (p < 0.05, two-tailed unpaired Student’s t-test) reduced RARG transcription (Fig. 3b). Conversely, upon overexpression of MSLN, the cell lines with low MSLN did not show an increase in RARG levels (Fig. 3b), suggesting that MSLN may be necessary, but not sufficient for RARG expression.
Activation of the AKT pathway by MSLN
Among the 33 genes in the MSLN-high group, RARG and the non-receptor tyrosine kinase TNK2 (or ACK1) stood out for their previously demonstrated ability to phosphorylate and activate AKT. Specifically, ACK1 activates AKT in pancreatic cancer where it also promotes cell survival and correlates with disease progression22. On the other hand, RARγ is known to activate AKT in hepatocellular carcinoma28. These findings were intriguing in light of the previous results implicating MSLN in the activation of AKT in PDAC cell lines via phosphorylation5 by an unknown mechanism.
We next asked if RARγ and ACK1 are the mediators of AKT activation. To answer this question, we knocked down MSLN in the cell lines with high MSLN expression. As predicted, the knockdown reduced RARγ and ACK1 levels (Fig. 3c), as well as reduced phospho-AKT levels (Fig. 3c) at both residues (S473 and T308) necessary for AKT activation29. Upon MSLN overexpression in cell lines with low MSLN expression, protein levels of RARγ and ACK1 were increased (Fig. 3c), consistent with their mediating role in AKT activation. Notably, in contrast to the increase of protein levels of RARγ and ACK1, MSLN overexpression did not alter their transcriptional levels.
We next asked if the downstream effects of MSLN-mediated activation of AKT observed in cell line studies5 also occurs in patient tumors. Toward this end, we performed enrichment analysis on the genes that show higher cancer-cell-specific expression in the MSLN-high group of tumors. Indeed, a significant (p = 0.004, hypergeometric test) overlap was found with genes previously shown to be activated by AKT in vitro, suggesting that the in vitro cell line modeling indeed reflects the behavior of cancer cells in vivo.
AKT activators RARG and TNK2 belong to the MSLN network module
The goal of the next (second) stage of histoepigenetic analysis (see “Materials and methods” and Fig. 2a) was to directly construct the MSLN network module, validate direct interactions of MSLN with TNK2 and RARG within the module, and identify additional genes relevant for understanding MSLN function in cancer cells. Toward this goal, we inferred a Gaussian graphical model (GGM) from the 150 bulk PDAC tumor expression profiles in the TCGA collection (Materials and Methods). To eliminate confounding due to variations in tumor purity, cell-type proportions (inferred by deconvolution) were added as covariates (Materials and Methods). The final GGM included the 367 nodes corresponding to the genes differentially expressed between MSLN-high and low tumors within any of the four estimated cell types (Fig. 1) and 6,130 edges.
We next examined the 32 of 367 genes that were directly connected with MSLN. Notably the 32 included TNK2 and RARG (Fig. 4a), validating their direct interactions with MSLN. Moreover, GGM also recapitulated known interactions of RARγ, showing a significant (p < 1.98×10-12, hypergeometric test) enrichment of connections between RARG and genes with known motifs for RARγ30 termed retinoic acid response elements (RAREs) (Supplementary Table 3).
We then focused on the 88 genes showing differential cancer cell expression between MSLN-high and low groups (33 showing higher expression in the MSLN-high group and 55 showing lower expression, Supplementary Table 1). We next applied CTD, an in-house developed method (see “Materials and methods”), to analyze the genes in a network context by figuratively “connecting the dots” in the network. Briefly, CTD takes a set of genes and a weighted graph (the network) and identifies any subsets of the gene set that shows significant pattern of connectedness within the graph together with a p value for that pattern. CTD identified significant pattern of GGM connections between some members of this set (p < 1.8 × 10–47) (Fig. 4b). Moreover, seven differentially expressed genes identified via GSEA to be bound by RARγ, including MSLN and TNK2, also formed a significantly connected GGM module (p < 5.9 × 10–7).
To further validate the accuracy of this method, we also examined connectedness of the following two subsets of the 88 genes known to be co-regulated: genes with RAREs30 and those associated with parvin-beta (PARVB) by GSEA. Significant connectedness was indeed found for both sets (p < 4.5 × 10−3, p < 1.71 × 10−9, respectively), suggesting that the method is sensitive. In contrast, as expected, three random gene sets did not show significant connectedness (Supplementary Table 3).
Taken together, these results support the hypothesis that MSLN interacts with RARG and TNK2, though other factors and feedback loops could not be ruled out. Indeed, the first order neighbors with strong edges to MSLN, RARG, and TNK2, such as PITX1, KCNN4, ALS2CL, and TRAK1, could also play roles in the MSLN-induced expression of RARG and TNK2 (Fig. 4c).
Discussion
The proposed histoepigenetic analysis method generates novel mechanistic hypotheses by detecting differentially expressed genes within minimally perturbed cancer cells in their tumor microenvironment and places them in a network context. By eliminating artifacts associated with physical separation of cells and their propagation in vitro, the method produces hypotheses that are testable in tractable models such as cell lines while ensuring relevance of the knowledge gained for human tumor biology in vivo. The method extends the previously developed EDec method by extending the deconvolution step with an iterative two-way clustering step to group tumor samples based on cancer cell-type-specific expression of a gene of interest. In the second stage, the gene is placed in network context. Using the example of MSLN in PDAC, we demonstrate how the method identifies potentially interacting genes and pathways associated with MSLN within the cancer cell in its native microenvironment. In contrast, most previous mechanistic studies of MSLN-associated pathways started with cell lines or mouse models. This general approach can be applied to patient tumor samples from other cancer types to study other genes of interest.
We demonstrate the utility of the method by elucidating interactions within the MSLN network in PDAC cancer cells. The analysis identified the MSLN-associated network module and interactions downstream of MSLN that could be validated in cell line models. Given that our results suggest that MSLN is necessary, but not sufficient for RARG and TNK2 expression, future work is required to fully understand the precise mechanisms of how MSLN is acting upstream of these genes. The MSLN network module contains a number of candidate genes that may play a role in this mechanism.
Our findings complement current understanding of RARγ and retinoids as important players in PDAC biology and normal development. Because RARγ expression is reduced upon MSLN knockdown in cell line experiments, RARγ has the potential to act downstream of MSLN. RARγ acts in the cytoplasm and nucleus to repress or activate genes depending on the context, cofactors, and abundance of its retinoid ligands (reviewed in ref. 31). Specifically, RARγ regulates the balance of self-renewal and differentiation31,32. In the developing pancreas, retinoids affect ductal versus acinar differentiation27. Treatment of some pancreatic cancer cell lines with retinoids induces apoptosis, epithelial differentiation, cell cycle arrest, and reduces cell viability33,34,35. Some of these effects are mediated by RARγ as observed in the BxPC3 and Capan2 cell lines33, the same cell lines in which we showed reduction of RARγ upon MSLN knockdown. Conversely, cell lines with low RARγ appear resistant to this effect33. Moreover, patient PDAC tumors show reduced levels of retinoids compared to normal counterparts36. Thus, MSLN’s observed effect on pancreatic cancer cell proliferation in vitro4 may partly be mediated by RARγ and its ability to regulate the balance of self-renewal and differentiation depending on the concentrations of retinoids present.
Another important member of the MSLN network is AKT. There are conflicting reports in the literature regarding the ability of MSLN to affect the phosphorylation and activation of AKT in PDAC cell lines5,7, which is associated with worse prognosis in PDAC patients37. Similar to the effects of MSLN in PDAC cell lines3,4,5, activated AKT inhibits apoptosis, is involved in cell cycle progression, and mediates cell proliferation22,38. Our results expand upon the notion that MSLN may activate AKT, suggesting that this activation may be mediated through RARγ or ACK1. Moreover, because MSLN inhibition decreases phospho-AKT levels in other cancers with elevated MSLN levels39, our results may also be relevant for cancers other than PDAC.
The interactions within the MSLN network have significant implications for current PDAC drug discovery efforts targeting MSLN, RARγ, and their network neighborhood. Specifically, the limited benefit of targeting MSLN may be examined in the context of the tumor-specific state of the downstream mediators suggested by our study. Moreover, the pattern of interactions within the MSLN module has implications for utilizing retinoids and ACK1 inhibition as therapeutic strategies. Pilot clinical trials utilizing retinoids—most not selective for RARγ—have shown limited or no effects, with only some pancreatic cancer patients showing prolonged stable disease40,41. Preclinical trials showing that inhibition of ACK1 in PDAC cell lines has resulted in AKT suppression and subsequent decrease in cell proliferation, cell cycle arrest, and induction of apoptosis22. Our results suggest that these therapeutic targets should not be viewed in isolation but rather in relation to one another. In addition to the already tested targets, the MSLN network module includes new candidates that may play important roles. Finally, the suggested interactions within the MSLN network can be utilized to identify candidate biomarkers for stratification of patients or as targets for combination therapies.
Materials and methods
Processing of the TCGA PDAC dataset
Level 3 DNA methylation, RNA-seq (HiSeqV2), and clinical metadata datasets from the TCGA Pancreatic Cancer cohort (PAAD), not flagged during previous review15, were downloaded from UCSC Xena42. For the methylation dataset, probes with a missing beta value for any individual sample or falling on sex chromosomes were removed. Problematic 450 K probes43 were filtered using the mapping, typeINextBaseSwitch, snp5.common, extBase, and sub30.copy masks from http://zwdzwd.io/InfiniumAnnotation/current/hm450/hm450.hg38.manifest.tsv.gz and multi-mapping, cross-reactive, and probes containing common SNPs from https://github.com/sirselim/illumina450k_filtering. Probes associated (FDR < 0.01) with gender, radiation therapy history, history of diabetes, history of pancreatitis, smoking status, and history of targeted molecular therapy were determined by fitting an analysis of variance model using R’s aov function and removed. As were those associated with age and weight, determined by fitting linear models using R’s lm function.
Deconvolution of TCGA datasets using EDec
The EDec R package was used to infer cell-type-specific methylation and gene expression profiles as previously described17. 500 informative probes were chosen by running the run_edec_stage_0 command with the “one.vs.rest” option and p value < 0.00001 for six selected reference groups using available methylation profiles from NCBI’s Gene Expression Omnibus44 (GEO) (Supplementary Table 4). Only probes present in the processed TCGA PDAC methylation dataset and with detection p < 0.01 across all reference profiles were retained. The appropriate number of cell types for deconvolution was determined with EDec’s estimate_stability function as previously described17 using reproducibility of stage 1 estimated matrices as the criterion. Estimated mean gene expression values and standard errors were used to construct bar plots using the ggplot2 package in R.
The first stage of histoepigenetic analysis: iterative computational deconvolution centered on a gene of interest
As illustrated in Fig. 2a, the matrix of cell proportions derived by stage 1 EDec deconvolution (yellow matrix in Fig. 2a) is used for iterative computational deconvolution to estimate sample-specific cancer-cell intrinsic expression of a gene of interest (arrows from the yellow matrix to the left and right in Fig. 2a). Specifically, the matrix of bulk gene expression profiles of all 150 TCGA samples were randomly split into two submatrices and independently input into stage 2 of EDec to estimate the cell-type-specific expression matrix for each group using the proportion matrix estimated from stage 1. For each sample, the linear combinations of its composition estimate with each of the two groups’ cell-type-specific expression profiles are calculated. The Euclidean distances were compared between each group’s combination and the sample’s bulk expression of MSLN and the sample was assigned to the group with shorter distance. The grouping and deconvolution steps were iterated until samples were no longer reassigned between groups. Three complete rounds of this iterative procedure were performed to test stability of final groupings. Groupings were formed on the consensus of these 3 runs.
Simulating methylation and RNA-seq mixtures
Methylation datasets for four cell types (B-cell, Fibroblast, Capan2, and MIA Paca2) were downloaded from GEO (GSM861675, GSM1669664, GSM1670109, GSM2420490). Noisy profiles were generated for each dataset and then the immune, fibroblast, and one of two cancer profiles were mixed in random proportions as previously described17. Each cancer profile was used in fifty mixtures. These 100 simulated methylation mixtures were deconvoluted using EDec. The estimated proportions and methylation profiles were compared to the known true proportions and original methylation profiles using Pearson’s correlation. For simulated RNA-seq profiles, FASTQ files for four publicly available RNA-seq profiles (GSM1576391, GSM2100912, GSM3133134, GSM3430680) were downloaded from GEO, QC’d using FastQC, processed using Trim Galore, and aligned using RSEM. The RNA-seq profiles were multiplied by the same proportions as their matched methylation mixtures for all 100 mixtures and reads for each gene per mixture summed to create the mixture’s bulk profile. The iterative group fit method was used to group the RNA-seq mixtures around MSLN expression. Splitting was performed 20 times to check stability and all possible pairwise correlations of the final group members across these runs were compared. Groups were then deconvoluted separately.
Comparison of differential expression methods
For the TCGA samples, MSLN high (n = 30) and low (n = 35) groups were determined by overlapping samples classified by both the bulk MSLN and the iterative group fit models. The deconvoluted cancer cell profiles for the groups were compared for differential expression using t-tests with the estimated means and standard errors of genes as previously described and with the same caveats17. Bulk differential expression between groups was done with raw (non-normalized) RSEM gene counts downloaded from NCI’s GDC Legacy Archive (https://portal.gdc.cancer.gov/legacy-archive/search/f) using the DESeq2 R package45 with groups (MSLN high or low) with or without EDec-predicted cancer cell proportions as factors. All comparisons used a fold change ≥ 2 and false discovery rate (FDR) q value < 5%.
Gene set enrichment analyses on cancer genes with higher expression in MSLN high group
The 33 genes with higher expression in the cancer cell profile of the MSLN high group were used for gene set enrichment analysis using the Molecular Signatures Database (MsigDB) web site version 6.3 (ref. 46). The top ten overlaps of these genes were computed against each of the C1–C6 gene set collections using an FDR q value < 0.05. The 689 genes that showed higher expression in the MSLN high group at a p value < 0.05 were compared to the gene list AKT_expression_UP from MsigDB. Enrichment for the 13 gene overlap with the 172 AKT genes was computed using a hypergeometric test.
The second stage of histoepigenetic analysis: construction of the gene network
As illustrated in Fig. 2a, in the second stage of histoepigenetic analysis a network is constructed and within it a module is identified that contains the gene of interest. The network is constructed as a GGM. To select which GGM learner to use, two methods were evaluated over three criteria: (1) The ability to form highly connected modules of previously known interactors, (2) the lack of modules from randomly selected gene sets, and (3) directionality of edges (positive or negative) matching biological predictions. R packages huge47 (graphical lasso method) and GeneNet48 (empirical Bayes method) were used to build networks over log2 transformed RNA-seq values for all 150 TCGA tumor samples on the 367 differentially expressed genes and the proportions of each cell type per sample. Positive controls were a set of 7 RARG related genes and a set of 21 genes related to PARVB expression and negative controls were randomly selected gene sets of size 7, 21, and 88 (Supplementary Table 5).
The huge network was trimmed using the Stability Approach to Regularization Selection49 (StARS) method (λ = 0.125). GeneNet created two networks, one with all edges and one with the same number of edges present in the huge network. To eliminate confounding due to variation in cell type composition, a node representing cell proportion was added (arrow from the yellow matrix down in Fig. 2a). After network construction, this node and its adjacent edges were removed for the purpose of subsequent analyses.
The R package CTD was used to quantify the modularity of the positive and negative control gene sets (Supplementary Table 3). CTD quantifies the relative level of connectedness (i.e. modularity) of a subset of nodes in a network, giving highly connected subsets in the network stronger significance compared to sparsely connected node subsets.
To assess the directionality of the edge weights, two sets of edge weights were evaluated between: (1) Genes predicted to be differentially expressed in MSLN high cancer cells and MSLN and (2) 5 genes with RAREs in their regulatory regions30 and RARG (Supplementary Tables 3 and6). The huge network did not agree with the expected directionality, but was consistent with the evaluation of relative modularity. In contrast, both GeneNet networks showed more consistent directionality, but poor sensitivity of modularity. Because modularity was considered more important than directionality, we selected the huge network. Edges with weights exceeding the mean (µ = −0.00492) by at least one standard deviation (σ = 0.0297) were considered as being strong.
CTD was used to query the cancer, stromal, and immune specific dysregulated genes, as well as the 3-gene subset of MSLN, RARG, and TNK2 for modularity. Enrichment of edges was computed using a hypergeometric test.
Cell culture
PDAC cell lines were purchased from ATCC, authenticated by short tandem repeat profiling, and propagated for less than 6 months after authentication. MSLN overexpression stable cell lines of Panc1, Panc28, and Panc48, as well as MSLN shRNA knockdown cell lines of Capan2, CFPAC1, and PL45 were established and maintained as previously described50. ASPC1, BxPC3, and SU86.86 cells were cultured in RPMI 1640 (Gibco, Thermo Fisher Science, USA); CFPAC1, HPAF-2, MIA Paca2, Panc1, Panc28, Panc48, and PL45 cells were cultured in DMEM (Gibco, Thermo Fisher Science, USA); Capan2 cells were cultured in McCoy’s 5 A medium (Gibco, Thermo Fisher Science, USA). All cells were supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher Science, USA) and cultured at 37 °C with a humidity of 90–95% and 5% CO2.
Real-time PCR
Total RNA for each cell line was extracted using TRIzol reagent (Invitrogen, Thermo Fisher Science, USA) according to the product’s manual. cDNA synthesis was performed with a reverse transcription-PCR kit (Bio-Rad) and real-time PCR was performed by standard procedures as previously described51. RARG and MSLN measurements were normalized to GAPDH in the PDAC cell panel and relative to controls in the overexpression and knockdown comparisons. Primer sequences (5′–3′):
Human MSLN forward CTATTCCTCAACCCAGATGCGT and reverse GCACATCAGCCTCGCTCA,
Human RARG forward CAAGTGCATCATCAAGATCGTG and reverse GATACGCAGCATCAGGATATCT,
Human GAPDH forward TCGACAGTCAGCCGCATCT and reverse CCGTTGACTCCGACCTTCA.
Immunoblotting assay
Cell lysates were prepared using RIPA lysis buffer with protease and phosphatase inhibitor cocktail and were quantitated for protein abundance using the Pierce BCA Protein Assay Kit from Thermo Fisher Scientific. PVDF membranes were blocked in 5% nonfat dry milk/TBST solution and incubated at 1:1000 dilution with: MSLN mAb (D9R5G), RARγ1 mAb (D3A4), AKT Ab #9272, Phospho-AKT (Ser473) mAb (D9E), Phospho-AKT (Thr308) mAb #2965, and Phospho-ACK1 (Tyr284) Ab#3138 from Cell Signaling Technology and ACK1 antibody (A-11) from Santa Cruz Biotechnology. Anti-β-actin Ab (A2228) was at 1:2,000 dilution (Sigma-Aldrich). Immunodetection was performed using SuperSignal West Pico (34577) and Femto (34095) Chemiluminescent Substrate according to the manufacturer’s instructions (Thermo Fisher Scientifc, USA).
Statistical analyses
Unless otherwise noted, all statistical analyses and bioinformatics were performed using the R programming language version 3.4.0 (https://www.R-project.org/). P values were adjusted for multiple comparisons using the Benjamini & Hochberg method. Survival analyses were done with the R package survival, including multivariate Cox regression using variables (Supplementary Table 7) with p values < 0.05 in univariate Cox regression. Real-time PCR results were representative of three independent experiments and compared with two-tailed unpaired Student’s t-test with Welch correction when sample variances were not equal as defined by the Brown–Forsythe test using GraphPad Prism Software Version 6 and 7.
Code availability
The expanded EDec methodology for grouping samples around the expression of a gene of interest and CTD methodology are available as R packages at: https://github.com/BRL-BCM/PDAC_decon and https://github.com/BRL-BCM/CTD.
References
Frierson, H. F. et al. Large-scale molecular and tissue microarray analysis of mesothelin expression in common human carcinomas. Hum. Pathol. 34, 605–609 (2003).
Nahm, C. B. et al. Biomarker panel predicts survival after resection in pancreatic ductal adenocarcinoma: a multi-institutional cohort study. Eur. J. Surg. Oncol. 45, 218–224 (2019).
Bharadwaj, U., Li, M., Chen, C. & Yao, Q. Mesothelin-induced pancreatic cancer cell proliferation involves alteration of cyclin E via activation of signal transducer and activator of transcription protein 3. Mol. Cancer Res 6, 1755–1765 (2008).
Bharadwaj, U., Marin-Muller, C., Li, M., Chen, C. & Yao, Q. Mesothelin overexpression promotes autocrine IL-6/sIL-6R trans-signaling to stimulate pancreatic cancer cell proliferation. Carcinogenesis 32, 1013–1024 (2011).
Bharadwaj, U., Marin-Muller, C., Li, M., Chen, C. & Yao, Q. Mesothelin confers pancreatic cancer cell resistance to TNF-α-induced apoptosis through Akt/PI3K/NF-κB activation and IL-6/Mcl-1 overexpression. Mol. Cancer 10, 106 (2011).
Muniyan, S. et al. MUC16 contributes to the metastasis of pancreatic ductal adenocarcinoma through focal adhesion mediated signaling mechanism. Genes Cancer 7, 110–124 (2016).
Chen, S. H., Hung, W. C., Wang, P., Paul, C. & Konstantopoulos, K. Mesothelin binding to CA125/MUC16 promotes pancreatic cancer cell motility and invasion via MMP-7 activation. Sci. Rep. 3, 1870 (2013).
Jiang, H. et al. Efficient growth suppression in pancreatic cancer PDX model by fully human anti-mesothelin CAR-T cells. Protein Cell 8, 926–931 (2017).
He, J. et al. Engineered CAR T cells targeting mesothelin by piggyBac transposon system for the treatment of pancreatic cancer. Cell Immunol. 329, 31–40 (2018).
Le, D. T. et al. A live-attenuated Listeria vaccine (ANZ-100) and a live-attenuated Listeria vaccine expressing mesothelin (CRS-207) for advanced cancers: phase I studies of safety and immune induction. Clin. Cancer Res. 18, 858–868 (2012).
Beatty, G. L. et al. Activity of mesothelin-specific chimeric antigen receptor T cells against pancreatic carcinoma metastases in a phase 1 trial. Gastroenterology 155, 29–32 (2018).
Weekes, C. D. et al. Phase I study of DMOT4039A, an antibody-drug conjugate targeting mesothelin, in patients with unresectable pancreatic or platinum-resistant ovarian cancer. Mol. Cancer Ther. 15, 439–447 (2016).
Hassan, R. et al. Phase I clinical trial of the chimeric anti-mesothelin monoclonal antibody MORAb-009 in patients with mesothelin-expressing cancers. Clin. Cancer Res. 16, 6132–6138 (2010).
Aran, D., Sirota, M. & Butte, A. J. Systematic pan-cancer analysis of tumour purity. Nat. Commun. 6, 8971 (2015).
Raphael, B. J. et al. Integrated genomic characterization of pancreatic ductal adenocarcinoma. Cancer Cell 32, 185–203.e13 (2017).
Moffitt, R. A. et al. Virtual microdissection identifies distinct tumor- and stroma-specific subtypes of pancreatic ductal adenocarcinoma. Nat. Genet. 47, 1168–1178 (2015).
Onuchic, V. et al. Epigenomic deconvolution of breast tumors reveals metabolic coupling between constituent cell types. Cell Rep. 17, 2075–2086 (2016).
Qin, Y., Feng, H., Chen, M., Wu, H. & Zheng, X. InfiniumPurify: an R package for estimating and accounting for tumor purity in cancer methylation research. Genes Dis. 5, 43–45 (2018).
Marchegiani, G. et al. Does size matter in pancreatic cancer?: Reappraisal of tumour dimension as a predictor of outcome beyond the TNM. Ann. Surg. 266, 142–148 (2017).
Winter, J. M. et al. A novel survival-based tissue microarray of pancreatic cancer validates MUC1 and mesothelin as biomarkers. PLoS ONE 7, e40157 (2012).
Jiang, S. et al. Integrated expression profiling of potassium channels identifys KCNN4 as a prognostic biomarker of pancreatic cancer. Biochem. Biophys. Res. Commun. 494, 113–119 (2017).
Mahajan, K. et al. Ack1 tyrosine kinase activation correlates with pancreatic cancer progression. Am. J. Pathol. 180, 1386–1393 (2012).
Thompson, C. C. et al. Pancreatic cancer cells overexpress gelsolin family-capping proteins, which contribute to their cell motility. Gut 56, 95–106 (2007).
Hinoda, Y. et al. Increased expression of MUC1 in advanced pancreatic cancer. J. Gastroenterol. 38, 1162–1166 (2003).
Delacroix, L. et al. Cell-specific interaction of retinoic acid receptors with target genes in mouse embryonic fibroblasts and embryonic stem cells. Mol. Cell Biol. 30, 231–244 (2010).
Xu, X., Stier, U., Rosewicz, S., Elnaggar, A. & Lotan, R. Selective suppression of nuclear retinoic acid receptor beta gene expression in human pancreatic carcinomas. Int J. Oncol. 8, 445–451 (1996).
Kadison, A. et al. Retinoid signaling directs secondary lineage selection in pancreatic organogenesis. J. Pediatr. Surg. 36, 1150–1156 (2001).
Zeng, W. et al. Targeting to the non-genomic activity of retinoic acid receptor-gamma by acacetin in hepatocellular carcinoma. Sci. Rep. 7, 348 (2017).
Bellacosa, A. et al. Akt activation by growth factors is a multiple-step process: the role of the PH domain. Oncogene 17, 313–325 (1998).
Lalevée, S. et al. Genome-wide in silico identification of new conserved and functional retinoic acid receptor response elements (direct repeats separated by 5 bp). J. Biol. Chem. 286, 33322–33334 (2011).
Di Masi, A. et al. Retinoic acid receptors: from molecular mechanisms to cancer therapy. Mol. Asp. Med. 41, 1–115 (2015).
Purton, L. E. et al. RARgamma is critical for maintaining a balance between hematopoietic stem cell self-renewal and differentiation. J. Exp. Med. 203, 1283–1293 (2006).
Pettersson, F., Dalgleish, A. G., Bissonnette, R. P. & Colston, K. W. Retinoids cause apoptosis in pancreatic cancer cells via activation of RAR-gamma and altered expression of Bcl-2/Bax. Br. J. Cancer 87, 555–561 (2002).
Singh, B. et al. On the role of transforming growth factor-beta in the growth inhibitory effects of retinoic acid in human pancreatic cancer cells. Mol. Cancer 6, 82 (2007).
El-Metwally, T. H., Hussein, M. R., Pour, P. M., Kuszynski, C. A. & Adrian, T. E. High concentrations of retinoids induce differentiation and late apoptosis in pancreatic cancer cells in vitro. Cancer Biol. Ther. 4, 602–611 (2005).
Bleul, T. et al. Reduced retinoids and retinoid receptors’ expression in pancreatic cancer: a link to patient survival. Mol. Carcinog. 54, 870–879 (2015).
Chadha, K. S. et al. Activated Akt and Erk expression and survival after surgery in pancreatic carcinoma. Ann. Surg. Oncol. 13, 933–939 (2006).
Ebrahimi, S. et al. Targeting the Akt/PI3K signaling pathway as a potential therapeutic strategy for the treatment of pancreatic cancer. Curr. Med Chem. 24, 1321–1331 (2017).
Wang, K. et al. Inhibition of mesothelin as a novel strategy for targeting cancer cells. PLoS ONE 7, e33214 (2012).
Pili, R. et al. Phase I study of the histone deacetylase inhibitor entinostat in combination with 13-cis retinoic acid in patients with solid tumours. Br. J. Cancer 106, 77–84 (2012).
Michael, A., Hill, M., Maraveyas, A., Dalgleish, A. & Lofts, F. 13-cis-Retinoic acid in combination with gemcitabine in the treatment of locally advanced and metastatic pancreatic cancer-report of a pilot phase II study. Clin. Oncol. (R. Coll. Radio.) 19, 150–153 (2007).
Goldman, M. et al. The UCSC Xena platform for public and private cancer genomics data visualization and interpretation. bioRxiv https://www.biorxiv.org/content/10.1101/326470v5 (2019).
Zhou, W., Laird, P. W. & Shen, H. Comprehensive characterization, annotation and innovative use of Infinium DNA methylation BeadChip probes. Nucleic Acids Res. 45, e22 (2017).
Barrett, T. et al. NCBI GEO: archive for functional genomics data sets-update. Nucleic Acids Res. 41, D991–D995 (2013).
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl Acad. Sci. USA 102, 15545–15550 (2005).
Zhao, T., Liu, H., Roeder, K., Lafferty, J. & Wasserman, L. The huge Package for High-dimensional Undirected Graph Estimation in R. J. Mach. Learn Res. 13, 1059–1062 (2012).
Schäfer, J., & Strimmer, K. A shrinkage approach to large-scale covariance matrix estimation and implications for functional genomics. Stat Appl Genet Mol Biol 4, Article 32 (2005).
Liu, H., Roeder, K. & Wasserman, L. Stability approach to regularization selection (StARS) for high dimensional graphical models. Adv. Neural Inf. Process Syst. 24, 1432–1440 (2010).
Li, M. et al. Mesothelin is a malignant factor and therapeutic vaccine target for pancreatic cancer. Mol. Cancer Ther. 7, 286–296 (2008).
Li, M. et al. Interleukin-8 increases vascular endothelial growth factor and neuropilin expression and stimulates ERK activation in human pancreatic cancer. Cancer Sci. 99, 733–737 (2008).
Acknowledgements
The authors thank The Cancer Genome Atlas consortium for generating a useful publicly available dataset and Yuna Blum for assisting in the identification of problematic samples in TCGA’s PAAD collection. The contents do not represent the views of the U.S. Department of Veterans Affairs or the United States Government.
Funding
This project was partially supported by the Barry Stephen Smith Memorial Pancreatic Cancer Research Award, CPRIT RP170691 (PI-Lewis), and NIH R01 CA183984 (PI: Yao) to Dr. Yao. This publication was also supported in part by a grant from the Common Fund of the National Institutes of Health (NIH) 5U54 DA036134 (to A.M.). L.R.T. is supported by a training fellowship from the Gulf Coast Consortia, on the NLM Biomedical Informatics Training Program (Grant No. T15 LM007093).
Author information
Authors and Affiliations
Contributions
E.L., Q.Y., and A.M. conceived and designed the study. Deconvolution, bioinformatics, and statistical analyses were performed by E.L. with supervision from A.M. CTD methodology was developed by L.R.T. and A.M. Network modeling and simulations were performed by E.L.L. with supervision from A.M. D.L. performed qRT-PCR, immunoblotting assays, and cell culture with supervision from Q.Y. E.L. drafted the manuscript with assistance from D.L., E.L.L., L.R.T., Q.Y., and with editing and supervision from A.M.
Corresponding authors
Ethics declarations
Conflict of interest
The authors declare that they have no conflict of interest.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Lurie, E., Liu, D., LaPlante, E.L. et al. Histoepigenetic analysis of the mesothelin network within pancreatic ductal adenocarcinoma cells reveals regulation of retinoic acid receptor gamma and AKT by mesothelin. Oncogenesis 9, 62 (2020). https://doi.org/10.1038/s41389-020-00245-3
Received:
Revised:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41389-020-00245-3