Abstract
Cancer cells employ adaptive mechanisms to survive various stressors, including genotoxic drugs. Understanding the factors promoting survival is crucial for developing effective treatments. In this study, we unveil a previously unexplored long non-coding RNA, JUNI (JUN-DT, LINC01135), which is upregulated by genotoxic drugs through the activation of stress-activated MAPKs, JNK, and p38 and consequently exerts positive control over the expression of its adjacent gene product c-Jun, a well-known oncoprotein, which transduces signals to multiple transcriptional outputs. JUNI regulates cellular migration and has a crucial role in conferring cellular resistance to chemotherapeutic drugs or UV radiation. Depletion of JUNI markedly increases the sensitivity of cultured cells and spheroids to chemotherapeutic agents. We identified 57 proteins interacting with JUNI. The activity of one of them the MAPK phosphatase and inhibitor, DUSP14, is counteracted by JUNI, thereby, facilitating efficient JNK phosphorylation and c-Jun induction when cells are exposed to UV radiation. The antagonistic interplay with DUSP14 contributes not only to c-Jun induction but also augments the survival of UV-exposed cells. In summary, we introduce JUNI as a novel stress-inducible regulator of c-Jun, positioning it as a potential target for enhancing the sensitivity of cancer cells to chemotherapy.
Similar content being viewed by others
Introduction
Long noncoding RNAs (lncRNAs) have gained prominence as important contributors to the neoplastic process, marked by alterations in their expression and activity and substantiated by compelling functional experimental evidence [1,2,3,4]. They affect various cancer-related processes and can impact every stage of cancer development, including initiation, progression, and metastasis [4,5,6]. In particular, the participation of lncRNAs in stress responses, notably the DNA damage response (DDR), empowers cancer cells to modulate and surmount DNA damages and the consequent cellular reactions, thereby evade potential cell death. Consequently, lncRNAs assume a pivotal role in fostering cancer cell survival and conferring resistance to chemotherapy [7,8,9,10].
Rapid DNA damage responses (DDRs) are crucial for maintaining organismal well-being and are frequently compromised in cancer development [11]. Key contributors to the sensing, transduction, and repair of DNA damage include tumor suppressors like ATM, p53, and BRCA proteins [11]. Conversely, certain oncoproteins, such as the stress-responsive AP-1 member c-Jun, exhibit high sensitivity to environmental DNA-damaging agents like ultraviolet light (UV) [12]. The UV-induced phosphorylation of c-Jun N-terminal kinase (JNK) triggers JNK-dependent c-Jun phosphorylation, protein stabilization, and increased transcription through autoregulation of its expression [13,14,15,16].
The phosphorylation and activity of JNK are subject to regulation by multiple upstream kinases and phosphatases [14, 17, 18]. Notably, Dual-Specificity Phosphatases (DUSPs) play a significant role in this regulation. JNKs, activated by dual phosphorylation at threonine and tyrosine within the TPY motif, undergo dephosphorylation by DUSPs. This dephosphorylation negatively regulates JNK activity and its downstream targets, including c-Jun [17].
The broad responsiveness of c-Jun to environmental stimuli and its consequential involvement in multiple cellular processes critical for cellular homeostasis make it essential for cellular survival [19], development [20] and tumorigenicity [21]. Moreover, the ability of c-Jun to antagonize proapoptotic signaling underlies its capacity to endow cancer cells with drug resistance. Notably, its activation following treatment of melanomas with BRAF inhibitors is a primary driver for phenotype switching, rendering the cells more mesenchymal and associated with elevated drug resistance [22,23,24].
In this study, we identified JUNI as a stress-regulated lncRNA that controls c-Jun expression, cellular migration and most importantly enhances the survival of cancer cells following exposure to chemotherapeutic drugs.
Results
JUNI is a stress-regulated lincRNA
To identify genes regulated by c-Jun, we analyzed ChIP-seq data from ENCODE for genes whose transcription start sites (TSSs) are located in the vicinity of c-Jun binding sites. The long intergenic noncoding RNA JUN-DT or LINC01135, referred to hereafter as JUNI (for JUN inducer) fits this criterion. It is positioned next to the JUN promoter and according to ENCODE data, transcribed in the opposite orientation to JUN. Only 1100 bp distinguish between the two TSSs. ENCODE data predicts that JUNI contains five main exons and has multiple isoforms. Twenty-seven different transcript isoforms were described according to LNCipedia ranging from 213 to 6213 bases [25]. Importantly, ENCODE predicts that the first exon is shared by all, therefore, all primers to analyze JUNI’s expression as well as siRNAs to silence it, were targeted for this exon. JUNI is evolutionarily conserved within primates but not in rodents (Fig. 1A). The fact that c-Jun binds its own promoter and autoregulates its expression [16, 26] supported the ChIP-seq results but did not confirm any functionality for JUNI. Therefore, we analyzed its expression to exclude promoter leakiness. UV-driven activation of c-Jun N-terminal kinase (JNK) results in JNK-dependent c-Jun phosphorylation, transcript elevation and protein stabilization [13,14,15]. Hypothesizing that the expression of JUNI is regulated by c-Jun and given that UV radiation is a major inducer of c-Jun expression, we irradiated four different cell types with UV radiation and examined JUNI expression. In this study, we used a set of cell lines, including two melanoma cell lines HMCB and CHL1 (where UV is a major carcinogen), HeLa (cervical carcinoma cell line in which JUN expression was intensively studied) and MDA-MB-231 (breast cancer-TNBC; a cancer type in which JUN plays a significant role [27]). Irradiation of these cell lines with 20-30 J/m2 UVC resulted in three to five-fold induction of JUNI expression (Fig. 1B). Similar to JUN, the induction was dose dependent (Fig. 1C), and the rapid response to stress (Fig. 1D) as well as to serum stimulation of starved cells, identified by others [28], qualifies it as an “immediate early” lncRNA. To determine how common is the correlation between JUNI and JUN induction following exposure to drug-induced stress, HeLa cells were exposed to different chemotherapeutic drugs that induce JUN expression, and JUNI levels were monitored. Every DNA damaging treatment that induced JUN also induced JUNI, although to a lower extent (Fig. 1E). Fractionation experiments demonstrated that JUNI resides mainly in the nucleus (Fig. 1F) and quantitation of JUNI’s copy number in untreated HMCB and MBA-MD-231 cells revealed the presence of about 8 copies per cell. HeLa cells express lower amounts of 1-2 copies in untreated cells. Overall, these results suggested that JUNI is a stress-induced gene whose expression pattern resembles that of JUN, therefore, we investigated the potential existence of regulatory interactions between the two genes, especially after exposure of cells to stress.
JUNI expression is controlled by MAPKs but not by c-Jun
To define the pathways required for JUNI upregulation after stress exposure, we inhibited two UV-activated kinases that are known to phosphorylate/induce c-Jun, JNK and p38 using specific inhibitors SP600125 (JNK) or SB203580 (p38). Both inhibitors inhibited JUNI induction by UV, similar to c-Jun expression (Fig. 2A, B), suggesting that the expression of JUNI may be c-Jun-dependent. As the JUN promoter is the major regulatory element proximate to the first exon of JUNI, we tested whether it co-regulates JUNI expression. We transfected MDA-MB-231 and HeLa cells with a genomic element that contains the promoter of JUN flanked by 153 bases of the first exon of JUNI on one side and 750 bp of the 5′ UTR of JUN on the other side [26]. Examination of RNA extracted after DNase treatment demonstrated 8- and 34-fold higher expression of JUNI relative to cells transfected with an empty vector in the different cell lines (Fig. 2C and D). Thus, the genomic sequence within the JUN promoter acts bidirectionally, driving the expression of JUN on one side and JUNI on the other, as previously described for other lncRNAs [29]. Two AP-1 binding sites in the JUN promoter mediate autoregulation of JUN expression. Surprisingly, although mutation in one of them (see materials and methods) [19] reduced JUN expression relative to the promoter expressing wt AP-1 binding sites, JUNI expression levels did not change, suggesting that JUNI is not regulated by c-Jun (Fig. 2D). To directly explore the dependence of JUNI expression on c-Jun, specific siRNA for JUN was transfected into HeLa cells, the cells were UV-treated or not, and the levels of c-Jun and JUNI were determined (Fig. 2E). Despite three-fold suppression of c-Jun protein expression, JUNI levels did not decline (Fig. 2E). Reciprocal experiments supported the independence of JUNI from c-Jun expression. HeLa cells transfected with the JUN expression vector and expressing very high levels of JUN mRNA did not present any difference in JUNI expression (Fig. 2F), and unlike the induction of CCND1, a known c-Jun target gene [30], JUNI levels were not changed in JUN-transfected cells expressing high levels of c-Jun protein (Fig. 2G), thus proving that JUNI expression is independent of c-Jun.
JUNI regulates c-Jun expression
Given that many lncRNAs modulate the expression of nearby genes in a cis [31], we examined the effects of JUNI on JUN expression. To this end, we attempted to knock out the first exon of JUNI using CRISPR gene editing targeting JUNI with two sgRNAs flanking its first exon. However, exon 1-deleted clones could not be generated, suggesting an essential role for this gene. As the first exon is common to all isoforms, we designed two siRNAs targeting it and used them to transiently silence JUNI expression. Both siRNAs silenced JUNI and consequently JUN mRNA expression to a lesser degree (Fig. 3A). It is worth mentioning that cell line-specific, consistent variations in the silencing capacities of the two siRNAs were observed. Importantly, all the phenotypic effects described in this study corresponded to the silencing efficiencies of each siRNA. HMCB and MDA-MB-231 cells express high levels of c-Jun protein, which can be detected even without stress exposure. A mild reduction in c-Jun protein levels after JUNI silencing was detected in these cells (Fig. 3B). In contrast, a clear effect of silencing was observed in all cell lines after exposure to UV (Fig. 3C), suggesting that JUNI has special importance for c-Jun expression after exposure of cells to stress. Indeed, exogenous expression of relatively low levels of the first exon of JUNI either transiently (Fig. 3D) or stably (Fig. 3E) was sufficient to elevate c-Jun levels in cells exposed to UV radiation. Combined, our data suggest that JUNI can regulate JUN expression in trans and is particularly important after stress exposure.
Significant correlations between JUNI and JUN expression also occur in vivo. Examination of expression data of 32 types of tumors in the Pan-Cancer Co-Expression Analysis for the RNA-RNA interactions [32] revealed a 94% positive correlation between JUNI and JUN levels in all cancer types examined. Sixty-two percent of the positively correlated cases were statistically significant (Table 1).
JUNI affects c-Jun-regulated EMT effectors and cellular migration
We examined whether JUNI has a regulatory impact on targets downstream of c-Jun. As c-Jun can modulate melanoma cells plasticity [23], we examined the expression of a set of known c-Jun-regulated genes in CHL1 cells 24 h after silencing JUNI. Interestingly, c-Jun target genes known to be involved in epithelial-mesenchymal-transition (EMT), such as ZEB2 [33] and SNAI1 [34], were downregulated by JUNI silencing, whereas CDH2, which is not a known target, was not (Fig. 4A). One of the potential consequences of downregulation of EMT-relevant, c-Jun targets is reduction in cellular migration as c-Jun was reported to regulate motility [35,36,37,38]. Therefore, we examined whether JUNI’s silencing will reduce the motility of CHL1 and MDA-MB-231 cells. JUNI was silenced using two different siRNAS or not and the ability of both cell types to migrate through a porous membrane was measure using transwell migration assay. As depicted in Fig. 4B, CJUNI silencing reduced the migration relative to control cells (NS). This suggests that JUNI is required for cellular migration. To further support this conclusion CHL1 cells in which JUNI was silenced or not were subjected to scratch analysis. Indeed, as expected, silencing of JUNI impaired the ability of the silenced cells to migrate and close the wound (Fig. 4D, E). To exclude the possibility that these effects are due to spontaneous reduction in cellular survival, at this early time point, JUNI silenced CHL1 cells were counted 24 and 36 h after transfection, the final time points of the migration assays. At this time point 6% difference in cell number was observed between JUNI expressing and JUNI silenced cells (Fig. 4F) clearly distinguished from the 60–70% difference observed in the transwell migration (Fig. 4C). These results demonstrate that JUNI can regulate the levels of genes involved in EMT and control cellular migration.
Short-term silencing of JUNI sensitizes cancer cells to UV radiation and chemotherapeutic drugs
The induction of JUNI by DNA damaging agents (Fig. 1) suggests its potential role in the cellular response to DNA damage. Given the established association of EMT with chemoresistance [39, 40] and considering the impact of JUNI on EMT-relevant genes, we aimed to investigate the significance of JUNI in the survival of cells exposed to UV irradiation or chemotherapeutic drugs. To this end JUNI was silenced in HMCB, CHL-1 and MDA-MB-231 cells, and 36–40 h later, the cells were either UV irradiated or exposed to the chemotherapeutic drugs etoposide or doxorubicin. Cell survival was determined microscopically and using XTT cell viability assay. Silencing of JUNI in all cell lines sensitized them to UV-induced stress and chemotherapeutic drugs (Fig. 5A, B and Fig. S1). Apoptotic cells exhibiting blebbing membranes and nuclear fragmentation were clearly observed (Fig. 5A). Moreover, all treatments induced higher levels of cleaved caspase 3 in JUNI-silenced cells (Fig. 5B). Measurement of survival using XTT revealed that exposure to UV radiation and the administered drugs led to a 30 to 65% decrease in the survival of JUNI-silenced cells compared to cells transfected with control siRNA (Figs. 5C and S1). Cell death in JUNI-silenced cells not treated with drugs averaged around seven to eight percent in all cell lines (Figs. 5C and S1, NT), suggesting that the drugs effect is specific. To assess the impact of JUNI silencing on the sensitivity of cancer cells to chemotherapeutic drugs in another model, spheroids of CHL1 and HMCB cells were generated, exposed to doxorubicin, and analyzed for survival 5-8 days later. As illustrated in Fig. 5D, E, the survival of JUNI-silenced cells was diminished by 50%, further supporting the protective role of JUNI in cells exposed to DNA damage. Overall, we suggest that JUNI is indispensable for the survival of stress-exposed cancer cells.
Antagonistic interactions of JUNI with DUSP14 mediate c-Jun induction by UV and cellular survival
To explore the identity of protein interactors that may affect the ability of JUNI to regulate c-Jun expression and affect cell death, we identified proteins interacting with JUNI by applying the incPRINT screen [41]. Using the shortest yet stable isoform of JUNI that contained the JUN-affecting sequences as RNA bait, we identified 57 JUNI-interacting proteins (Fig. 6A). Analyses of their cellular functions revealed enrichment of proteins involved in various fundamental, basic aspects of cellular wellbeing, such as splicing, ribosome biosynthesis, and mitosis (Table S1). Interestingly, c-Jun itself does not interact with JUNI (Table S1, Normalized luciferase intensity MS2, RLU = 0.44). By contrast, the dual specificity protein phosphatase 14 (DUSP14; also known as MKP6) was one of the highly rated interacting proteins with JUNI (Fig. 6A, B). DUSP14 can directly dephosphorylate JNK, p38 and ERK or indirectly limit the activation of TAK1 a MAP3K which is essential for c-Jun expression [42, 43]. We validated the interaction between DUSP14 and JUNI in HeLa cells by crosslinking and immunoprecipitation (CLIP) analysis. The enrichment of endogenous JUNI following immunoprecipitation with transfected DUSP14 or GFP was measured whereas specificity was determined by comparison of JUNI enrichment to other unrelated nuclear lncRNAs MALAT1 and PVT1. These experiments demonstrated a specific association of JUNI with DUSP14 (Fig. 6C). As JUNI is required for efficient c-Jun upregulation after UV exposure, and DUSP14 inhibits JNK, a stress-activated, positive regulator of JUN transcription and protein expression [14, 15], we hypothesized that JUNI antagonizes DUSP14 activity to enable full-scale c-Jun induction post-stress exposure and that this antagonism may have a role in other JUNI-dependent activities discovered in this study. The potential JUNI-DUSP14 antagonism was examined at 2 levels. Biochemically, we sought to test if JUNI enables efficient JNK and c-Jun phosphorylation, thus resulting in c-Jun induction post UV exposure and at the cellular level, we examined whether JUNI-DUSP14 antagonism is reflected by effects on cellular survival.
To explore the effects on c-Jun, we silenced DUSP14, JUNI or both in HMCB cells that were later exposed to UV radiation and JNK activation, c-Jun phosphorylation and its total level were determined. Indeed, silencing JUNI inhibited JNK phosphorylation (pThr183/pTyr185) in UV-treated cells to a nearly undetectable level and consequently Ser63 phosphorylation of c-Jun, therefore, prevented its induction by UV (Fig. 6D). Co-silencing of DUSP14 together with JUNI restored JNK and c-Jun phosphorylation to levels slightly lower than those observed in non-silenced cells. To determine if the effect of JUNI on c-Jun induction is mediated by DUSP14 phosphatase activity we transfected HMCB cells with wt or phosphatase dead (C111S) DUSP14 together with JUNI expression vector or an empty one. Cells were irradiated 24 h post transfection and the phosphorylation as well total levels of c-Jun were monitored (Fig. 6E). As depicted in Fig. 6E, JUNI considerably elevated c-Jun phosphorylation and expression only in cells transfected with phosphatase active DUSP14. These data suggest that JUNI regulates JNK phosphorylation and c-Jun levels by antagonizing DUSP14 activity.
To assess the importance of DUSP14 in JUNI-dependent effects on the survival of stress-exposed cells, JUNI, DUSP14, or both were silenced in HMCB and HeLa cells that were later exposed to UV, and cell survival was measured (Fig. 6F). Consistent with the previously indicated results (Fig. 5), JUNI-silenced cells were 40% more sensitive to radiation than non-silenced cells (Fig. 6F). DUSP14 silencing did not significantly improve the survival of irradiated cells expressing normal levels of JUNI. Remarkably, it improved the survival of JUNI-silenced cells by 29 and 33% in HMCB and HeLa cells, respectively (Fig. 6F), suggesting that JUNI’S expression is important for antagonizing DUSP14 in order to improve the survival of stress-exposed cells. Nevertheless, it should be mentioned that the negative effect of JUNI silencing on the survival of stressed cells was not fully rescued by silencing of DUSP14, suggesting the presence of additional targets.
Discussion
Overall, we discovered a novel lncRNA that plays fundamental roles in cellular survival after exposure of cancer cells to stress. JUNI’s expression itself is stress regulated. The known nonspecific inhibition of transcription initiation [44] and elongation [45] observed after UV exposure, and the resemblance of its to its adjacent gene, JUN, support the specificity of JUNI induction under stress. JUNI demonstrates a rapid response to UV exposure, consistent with its role as an inducer of c-Jun, an “immediate early protein.” Its rapid induction also in serum starved cells after complementation of serum [28], similar to c-Jun itself, also support its activity as “immediate early lncRNA”. The observation that JUNI’s induction does not necessitate c-Jun expression underscores the unidirectional impact as a regulator of c-Jun without reliance on its regulated gene. JUNI’s induction after stress exposure requires activation of JNK and p38, thereafter, JUNI binds and antagonizes DUSP14, a negative regulator of these kinases, to enable their full activation after stress exposure. Thus, we demonstrate a positive feedback loop in the activation of these kinases. This finding aligns with existing studies indicating the regulatory role of lncRNAs in the JNK pathway [46,47,48,49]. In fact, the lncRNA TCONS_00145741 activates JNK phosphorylation by inhibiting its interactions with DUSP6 in thrombin treated microglia cells [50]. We demonstrate that JUNI alleviates the inhibitory, phosphatase-dependent, effects imposed by DUSP14 of the JNK pathway, following cellular exposure to stress. While our work reveals a novel mechanism of c-Jun activation through the inhibition of the JNK inhibitor, DUSP14, in trans after stress exposure, it does not necessarily preclude additional effects of JUNI on c-Jun expression in untreated cells through interaction with other proteins, in cis.
This study attributes two crucial biological functions to JUNI: the regulation of cellular migration and, more significantly, its essential role in evading cell death following the exposure of cancer cells to UV and chemotherapeutic drugs. Both traits, migration and resistance to drugs, observed after JUNI silencing were previously associated with the activity of the JNK-c-Jun pathway. For example, JNK and c-Jun were previously reported to regulate cellular migration under different cellular settings [35,36,37,38, 47] and c-Jun was reported to inhibit apoptosis in cells exposed to DNA damages. In vitro, phosphorylation mutant c-Jun (S63A,S73A) which cannot be activated by JNK, markedly inhibited the activation of AP-1-driven transcription and greatly increased the cytotoxic effects of DNA-damaging agents associated with enhanced apoptosis [51]. ChIP-seq analysis of BT474 cells treated with cisplatin suggested that c-Jun in cooperation with ATF2 bind to regulatory elements and activates an array of DNA repair genes [52]. Moreover, liver tumors induced by carcinogen treatment (Diethylnitrosamine) were not formed in mice deleted of c-Jun, whose role in the liver is mainly in the prevention of apoptosis [21].
JNK activity is required for the induction of cell death post UV exposure [53]. Therefore, the ability of DUSP14 silencing to rescue from the cell death upon JUNI silencing is surprising. However, recent studies discovered a novel facet of JNK, demonstrating its cellular protective roles [54]. Three potential mechanisms may account for the rescue. Firstly, DUSP14 inhibition increases the activity of protective proteins that are negatively regulated by it. For example, NFκB is downstream of TAK1-TAB1 proteins which are negatively regulated by DUSP14 [43]. Secondly, low constitutive JNK activation may induce autophagy which exerts protective activity [54, 55]. Finally, the indirect suppression of genes involved in EMT may lead to a less mesenchymal phenotype reflected also by reduced motility. Given that EMT is associated with increased drug resistance [39, 40], it is possible that the mesenchymal to epithelial transition (MET) process occurring in these cells after silencing of JUNI sensitizes the cells to chemotherapeutic drugs as well as impair their migration. In summary, this study illustrates the requirement of JUNI for the survival of cancer cells following exposure to stress and proposes its potential as a target for chemo-sensitization.
Materials and methods
Cell culture
CHL-1, HeLa, MDA-MB 231, HACAT and HMCB cells were procured from ATCC. The first 4 were cultured in DMEM with 10% FBS, whereas HMCB cells were cultured in EMEM. All cells were grown with 10% FBS and cultured at 37 °C with 5% CO2. Cells were routinely monitored for mycoplasma contamination.
Transfection, treatments, and inhibitors
Plasmids were transfected into 40–50% confluent cells using PloyJet reagent (SignaGen Lab MD, USA). siRNAs were transfected with the siRNA transfection reagent INTERFERin® (Polyplus, Illkirch – France). The siRNA concentrations used in this study ranged between 5 and 20 nm. SP600125 (JNK) or SB203580 (p38) inhibitors (10 µM) were added 1 h prior to UV irradiation. Doxorubicin, etoposide and cisplatin were used at doses of 0.5–5 µM. XTT viability assays (Abcam, Cambridge UK) were used according to the manufacturer’s instructions.
RNA Extraction and real-time PCR
RNA was isolated manually using TRI Reagent® (MRC, OH, USA). cDNA was prepared from total RNA (1 µg) using Quantabio, and a qScriptTM cDNA synthesis kit and PerfeCTa SYBR Green SuperMix were used for qPCR according to the manufacturer’s instructions (Quantabio, MA, USA). To prepare DNA-free RNA samples, RNA was treated with PerfeCTa® DNase I according to the manufacturer’s instructions (Quantabio, MA, USA). A StepOne Plus Real-Time PCR apparatus with StepOne Software v2.3 was used for analysis (Applied Biosystems, MA USA). Each experiment was performed in multiple technical duplications (n > 4) with in 4 biological repeats. Relative mRNA expression was analyzed according to the 2(−ΔΔCt) calculation method.
Calculation of JUNI copy number
RNA was extracted from 1.5 × 105 HMCB and MDA-MB-231 cells, cDNA was prepared and qPCR performed with primers aimed at the first exon of JUNI as described above. To calculated the total amount of JUNI/well CT values of JUNI RNA obtained from both cell lines were compared to calibration curve of CT values (y) of known amounts of JUNI expressing plasmid (X). Number of copies/well (NCW) was calculated using the following equation: NCW = (ng × [6.022 × 1023])/(length × [1 × 109] × 650). Number of copies/cell (NCC) was calculated by the following formula: NCC = NCW*dilution factor from total RNA to cDNA in a single well/number of cells from which the RNA was extracted. Taken into account 20-30% loss of RNA in extraction and RTqPCR process the number of copies presented is the minimal copy number per cell.
Antibodies, immunoblotting and proteins quantification
The primary antibodies used were c-Jun (CST #60A8 1:1000), Ser-63-p-JUN (CST #9261 1:500), actin (CST #3700S 1:5000), GAPDH (CST #97166 1:5000), P-JNK (CST #9251 1:500), total JNK (#9252, #9258 1:1000), cleaved Caspase-3 Asp175 (5A1E #96641:1000) and anti-FLAG M2 antibody (Sigma, #F1804). HRP-conjugated secondary antibody was used at a dilution of 1:5000 (Jackson Laboratories, USA). Immunoblotting was performed using standard protocol. Proteins were detected and quantitated using Bio-Rad’s chemiDoc imagers. Representative images are presented. Proteins quantities normalized to loading controls are presented below each relevant blot. In all cases N ≥ 3.
Spheroid formation
2–3k cells were seeded using hanging drop method, 5–7 days later spheroids were transferred to ultra low-attachment U-bottom 96 well plate and treated with 1–2 µM of doxorubicin for 5–8 days. Images were acquired at ×10 magnification, spheroids were trypsinized and total cells number was counted using Trypan blue dye, N = 3.
Cell migration
Fifteen thousand CHL1 cells/well were seeded in a 96-well dish (Sartorius IncuCyte Imagelock Plate) and transfected with the desired siRNA and 24 h later 24 h later. Wounds were made 24 h post transfection using wound making tool to create an equal scratch and IncuCyte live cell imaging system (Sartorius) was used to measure wound closure for 12 h, taking pictures at 1 h intervals. N = 8
Microscopy
Images were captured at ×40 magnification using an inverted Nikon Eclipse Ts2R microscope. Scale bars are presented.
Plasmids and cloning
DUSP14-HIS was a kind gift from M. Saleh [56] pRK5 HA-DUSP14 plasmid (HA tag N-terminal) was obtained by PCR amplification from pOTB7 DUSP14 plasmid (HGMP MRC geneservice, IMAGE cDNA clone 2819474) and subcloning into pRK5 plasmid containing HA sequence. pRK5 HA-DUSP14 C111S was obtained by PCR oligonucleotide site-directed mutagenesis. To generate the JUNI-MS2x10 construct used in incPRINT, a 938 bp fragment of the JUNI mature RNA was cloned into 10xMS2 vector [41] using a gBlocks Gene Fragment containing Cla1 and Hind3 restriction sites (IDT, NJ, USA). Exon1 of JUNI was cloned into pEFA1 CMV puro/GFP vector using a gBlocks gene fragment containing EcoR1 and BAMH1 restriction enzymes. The genomic element that contains the promoter of JUN flanked by 153 bases of the first exon of JUNI on one side and 750 bp of the 5′ UTR of JUN on the other side as well as its mutant versions were previously described [26]. The AP-1 binding site at positions -72- -63 of the JUN promoter was mutated from 5′-GTGACATCAT-3′ to 5′-CATCCACCAT-3′ as previously described [19].
Crosslinking and Immunoprecipitation (CLIP)
Ten million HeLa cells were transiently transfected with mammalian expression vectors expressing His-DUSP14 or GFP as a control using Lipofectamine 2000 (Thermo Fisher) according to the manufacturer’s instructions. The next day, the cells were washed with PBS and irradiated once on ice with 150 mJ/cm2 UV light (254 nm) in ice-cold PBS using a Hoefer Scientific UV Crosslinker. Cells were then pelleted and lysed in 1 ml of lysis buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl, 1% Igepal CA-630, 0.1% SDS, 0.5% sodium deoxycholate, supplemented with protease inhibitors), sonicated, cleared, and adjusted to a protein concentration of 1 mg/ml. RNA was then partially digested with 0.2 U/ml RNase I for 3 min before immunoprecipitation with 10 μL of anti-His-tag antibody (Cell Signaling) pre-conjugated to 50 μL protein G Dynabeads (Thermo Fisher) for 1 h. The beads were then washed 5 times with lysis buffer before the bound RNAs were eluted off by Proteinase K (Thermo Fisher) digestion for 1 h at 65 °C. The RNA was then extracted using TRIzol (Thermo Fisher) and subjected to qPCR analysis with qPCR primers against JUNI, MALAT1, and PVT1.
IncPRINT
The incPRINT protocol and analysis were previously described [41]. In this study, the bait was a 938 bp fragment of the JUNI mature RNA cloned into the 10xMS2 vector. The experiment was performed twice. The threshold for significant interaction was set at a relative luciferase activity (protein versus background) 2.2 or higher.
Primers and siRNA
PCR primers
Gene | Forward | Reverse |
---|---|---|
GAPDH | TCGACAGTCAGCCGCATCTTCTTT | ACCAAATCCGTTGACTCCGACCTT |
JUN | CCCCAAGATCCTGAAACAGA | CCGTTGCTGGACTGGATTAT |
JUNI | CGGACACTCGCATAAAGTCA | AGCGCTTCCTAGAGGCTACC |
Zeb2 | CAAGAGGCGCAAACAAGCC | GGTTGGCAATACCGTCATCC |
SNAI1 | CTGGGTGCCCTCAAGATGCA | CCGGACATGGCCTTGTAGCA |
DUSP14 | GAGGCGTACAACTGGGTGAA | CCCCAGTAAGGCATCAGGT |
CDH2 | TGTCGGTGACAAAGCCCCTG | AGGGCATTGGGATCGTCAGC |
MALAT1 | GACGGAGGTTGAGATGAAGC | ATTCGGGGCTCTGTAGTCCT |
PVT1 | TGGAATGTAAGACCCCGACTCT | GATGGCTGTATGTGCCAAGGT |
CCND1 | GAGGAAGAGGAGGAGGAGGA | GAGATGGAAGGGGGAAAGAG |
siRNA oligonucleotides
JUNI si1 | GACACUCGCAUAAAGUCACGCAGUA |
JUNI si2 | GGUAGAACCUGGACUUCAAAUCUCU |
JUN | ACUCAUGCUAACGCAGCAGUU |
DUSP14 | GGCAUCACCUGCAUUGUUAAUGCTA |
Statistical analysis
All the data presented as normalized means ± SD. One tailed Wilcoxon matched pairs test was used to determine significance. P < 0.05 were considered as statistically significance. Significance is marked in this study according to the following key: *p < 0.05; **p < 0.001, ***p < 1 × 10-5.
References
Bhan A, Soleimani M, Mandal SS. Long noncoding RNA and cancer: a new paradigm. Cancer Res. 2017;77:3965–81.
Spizzo R, Almeida MI, Colombatti A, Calin GA. Long non-coding RNAs and cancer: a new frontier of translational research? Oncogene. 2012;31:4577–87.
Chi Y, Wang D, Wang J, Yu W, Yang J. Long non-coding RNA in the pathogenesis of cancers. Cells. 2019;8:1015–59.
Tan YT, Lin JF, Li T, Li JJ, Xu RH, Ju HQ. LncRNA-mediated posttranslational modifications and reprogramming of energy metabolism in cancer. Cancer Commun. 2021;41:109–20.
Gutschner T, Diederichs S. The hallmarks of cancer: a long non-coding RNA point of view. RNA Biol. 2012;9:703–19.
McCabe EM, Rasmussen TP. lncRNA involvement in cancer stem cell function and epithelial-mesenchymal transitions. Semin Cancer Biol. 2021;75:38–48.
Connerty P, Lock RB, de Bock CE. Long non-coding RNAs: major regulators of cell stress in cancer. Front Oncol. 2020;10:285.
Tehrani SS, Karimian A, Parsian H, Majidinia M, Yousefi B. Multiple functions of long non-coding RNAs in oxidative stress, DNA damage response and cancer progression. J Cell Biochem. 2018;119:223–36.
Su M, Wang H, Wang W, Wang Y, Ouyang L, Pan C, et al. LncRNAs in DNA damage response and repair in cancer cells. Acta Biochim Biophys Sin. 2018;50:433–9.
Chen QN, Wei CC, Wang ZX, Sun M. Long non-coding RNAs in anti-cancer drug resistance. Oncotarget. 2017;8:1925–36.
Jackson SP, Bartek J. The DNA-damage response in human biology and disease. Nature. 2009;461:1071–8.
Devary Y, Gottlieb RA, Lau LF, Karin M. Rapid and preferential activation of the c-jun gene during the mammalian UV response. Mol Cell Biol. 1991;11:2804–11.
Fuchs SY, Fried VA, Ronai Z. Stress-activated kinases regulate protein stability. Oncogene. 1998;17:1483–90.
Karin M, Gallagher E. From JNK to pay dirt: jun kinases, their biochemistry, physiology and clinical importance. IUBMB Life. 2005;57:283–95.
Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell. 2000;103:239–52.
Stein B, Angel P, van Dam H, Ponta H, Herrlich P, van der Eb A, et al. Ultraviolet-radiation induced c-jun gene transcription: two AP-1 like binding sites mediate the response. Photochem Photobio. 1992;55:409–15.
Ha J, Kang E, Seo J, Cho S. Phosphorylation dynamics of JNK signaling: effects of dual-specificity phosphatases (DUSPs) on the JNK pathway. Int J Mol Sci. 2019;20:6157–76.
Weston CR, Davis RJ. The JNK signal transduction pathway. Curr Opin Cell Biol. 2007;19:142–9.
Shaulian E, Karin M. AP-1 as a regulator of cell life and death. Nat Cell Biol. 2002;4:E131–136.
Hilberg F, Aguzzi A, Howells N, Wagner EF. c-jun is essential for normal mouse development and hepatogenesis. Nature. 1993;365:179–81.
Eferl R, Ricci R, Kenner L, Zenz R, David JP, Rath M, et al. Liver tumor development. c-Jun antagonizes the proapoptotic activity of p53. Cell. 2003;112:181–92.
Fallahi-Sichani M, Moerke NJ, Niepel M, Zhang T, Gray NS, Sorger PK. Systematic analysis of BRAF(V600E) melanomas reveals a role for JNK/c-Jun pathway in adaptive resistance to drug-induced apoptosis. Mol Syst Biol. 2015;11:797.
Ramsdale R, Jorissen RN, Li FZ, Al-Obaidi S, Ward T, Sheppard KE, et al. The transcription cofactor c-JUN mediates phenotype switching and BRAF inhibitor resistance in melanoma. Sci Signal. 2015;8:ra82.
Titz B, Lomova A, Le A, Hugo W, Kong X, Ten Hoeve J, et al. JUN dependency in distinct early and late BRAF inhibition adaptation states of melanoma. Cell Discov. 2016;2:16028.
Volders PJ, Anckaert J, Verheggen K, Nuytens J, Martens L, Mestdagh P, et al. LNCipedia 5: towards a reference set of human long non-coding RNAs. Nucleic Acids Res. 2019;47:D135–D139.
Angel P, Hattori K, Smeal T, Karin M. The jun proto-oncogene is positively autoregulated by its product, Jun/AP-1. Cell. 1988;55:875–85.
Vleugel MM, Greijer AE, Bos R, van der Wall E, van Diest PJ. c-Jun activation is associated with proliferation and angiogenesis in invasive breast cancer. Hum Pathol. 2006;37:668–74.
Bunch H, Choe H, Kim J, Jo DS, Jeon S, Lee S, et al. P-TEFb Regulates Transcriptional Activation in Non-coding RNA Genes. Front Genet. 2019;10:342.
Kopp F, Mendell JT. Functional classification and experimental dissection of long noncoding RNAs. Cell. 2018;172:393–407.
Wisdom R, Johnson RS, Moore C. c-Jun regulates cell cycle progression and apoptosis by distinct mechanisms. EMBO J. 1999;18:188–97.
Gil N, Ulitsky I. Regulation of gene expression by cis-acting long non-coding RNAs. Nat Rev Genet. 2020;21:102–17.
Li JH, Liu S, Zhou H, Qu LH, Yang JH. starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res. 2014;42:D92–97.
Zhao C, Qiao Y, Jonsson P, Wang J, Xu L, Rouhi P, et al. Genome-wide profiling of AP-1-regulated transcription provides insights into the invasiveness of triple-negative breast cancer. Cancer Res. 2014;74:3983–94.
Thakur N, Gudey SK, Marcusson A, Fu JY, Bergh A, Heldin CH, et al. TGFbeta-induced invasion of prostate cancer cells is promoted by c-Jun-dependent transcriptional activation of Snail1. Cell Cycle. 2014;13:2400–14.
Jiao X, Katiyar S, Liu M, Mueller SC, Lisanti MP, Li A, et al. Disruption of c-Jun reduces cellular migration and invasion through inhibition of c-Src and hyperactivation of ROCK II kinase. Mol Biol Cell. 2008;19:1378–90.
Lin G, Yu B, Liang Z, Li L, Qu S, Chen K, et al. Silencing of c-jun decreases cell migration, invasion, and EMT in radioresistant human nasopharyngeal carcinoma cell line CNE-2R. Onco Targets Ther. 2018;11:3805–15.
Sioletic S, Czaplinski J, Hu L, Fletcher JA, Fletcher CD, Wagner AJ, et al. c-Jun promotes cell migration and drives expression of the motility factor ENPP2 in soft tissue sarcomas. J Pathol. 2014;234:190–202.
Xia Y, Karin M. The control of cell motility and epithelial morphogenesis by Jun kinases. Trends Cell Biol. 2004;14:94–101.
Brabletz T, Kalluri R, Nieto MA, Weinberg RA. EMT in cancer. Nat Rev Cancer. 2018;18:128–34.
Shibue T, Weinberg RA. EMT, CSCs, and drug resistance: the mechanistic link and clinical implications. Nat Rev Clin Oncol. 2017;14:611–29.
Graindorge A, Pinheiro I, Nawrocka A, Mallory AC, Tsvetkov P, Gil N, et al. In-cell identification and measurement of RNA-protein interactions. Nat Commun. 2019;10:5317.
Marti F, Krause A, Post NH, Lyddane C, Dupont B, Sadelain M, et al. Negative-feedback regulation of CD28 costimulation by a novel mitogen-activated protein kinase phosphatase, MKP6. J Immunol. 2001;166:197–206.
Yang CY, Li JP, Chiu LL, Lan JL, Chen DY, Chuang HC, et al. Dual-specificity phosphatase 14 (DUSP14/MKP6) negatively regulates TCR signaling by inhibiting TAB1 activation. J Immunol. 2014;192:1547–57.
Rockx DA, Mason R, van Hoffen A, Barton MC, Citterio E, Bregman DB, et al. UV-induced inhibition of transcription involves repression of transcription initiation and phosphorylation of RNA polymerase II. Proc Natl Acad Sci USA. 2000;97:10503–8.
Williamson L, Saponaro M, Boeing S, East P, Mitter R, Kantidakis T, et al. UV Irradiation Induces a Non-coding RNA that Functionally Opposes the Protein Encoded by the Same Gene. Cell. 2017;168:843–855.e813.
Fu L, Peng S, Wu W, Ouyang Y, Tan D, Fu X. LncRNA HOTAIRM1 promotes osteogenesis by controlling JNK/AP-1 signalling-mediated RUNX2 expression. J Cell Mol Med. 2019;23:7517–24.
Li H, Liu X, Zhang L, Li X. LncRNA BANCR facilitates vascular smooth muscle cell proliferation and migration through JNK pathway. Oncotarget. 2017;8:114568–75.
Li L, Li Z, Meng X, Wang X, Song D, Liu Y, et al. Histone lactylation-derived LINC01127 promotes the self-renewal of glioblastoma stem cells via the cis-regulating the MAP4K4 to activate JNK pathway. Cancer Lett. 2023;579:216467.
Wang K, Zhong W, Long Z, Guo Y, Zhong C, Yang T, et al. 5-Methylcytosine RNA methyltransferases-related long non-coding RNA to develop and validate biochemical recurrence signature in prostate cancer. Front Mol Biosci. 2021;8:775304.
Wu L, Zhan Q, Liu P, Zheng H, Liu M, Min J, et al. LncRNA TCONS_00145741 knockdown prevents thrombin-induced M1 differentiation of microglia in intracerebral hemorrhage by enhancing the interaction between DUSP6 and JNK. Front Cell Dev Biol. 2021;9:684842.
Potapova O, Basu S, Mercola D, Holbrook NJ. Protective role for c-Jun in the cellular response to DNA damage. J Biol Chem. 2001;276:28546–53.
Hayakawa J, Mittal S, Wang Y, Korkmaz KS, Adamson E, English C, et al. Identification of promoters bound by c-Jun/ATF2 during rapid large-scale gene activation following genotoxic stress. Mol Cell. 2004;16:521–35.
Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, et al. Requirement of JNK for stress-induced activation of the cytochrome c-mediated death pathway. Science. 2000;288:870–4.
Wu Q, Wu W, Fu B, Shi L, Wang X, Kuca K. JNK signaling in cancer cell survival. Med Res Rev. 2019;39:2082–104.
Sample A, He YY. Autophagy in UV damage response. Photochem Photobio. 2017;93:943–55.
Douglas T, Saleh M. Post-translational modification of OTULIN regulates ubiquitin dynamics and cell death. Cell Rep. 2019;29:3652–3663.e3655.
Acknowledgements
ES and VK are funded by the Israel Cancer Association, 20220102. AS is supported by grants from Institut Curie, LabEx DEEP (ANR-11-LABX-0044, ANR-10-190 IDEX-0001-02) and XSC is supported by a Foundation pour la Recherche Médicale doctoral fellowship. FKM and MD were supported by a UK Medical Research Council Career Development Award (MR/P009417/1) to FKM.
Funding
Open access funding provided by Hebrew University of Jerusalem.
Author information
Authors and Affiliations
Contributions
Vikash Kumar: Research and data preparation. Xavier Sabaté-Cadenas: Research, IncPRINT assay. Isha Soni: Research and data preparation. Esther Stern: Research. Carine Vias: Research, IncPRINT assay. Doron Ginsberg: Conceptualization, supporting comments. Carlos Romá-Mateo: Materials supplies. Rafael Pulido5: Material supplies. Martin Dodel: Research. Faraz K. Mardakheh: Research guidance. Alena Shkumatava: Research tools development and guidance. Eitan Shaulian: Conceptualization, research design and control and writing.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Kumar, V., Sabaté-Cadenas, X., Soni, I. et al. The lincRNA JUNI regulates the stress-dependent induction of c-Jun, cellular migration and survival through the modulation of the DUSP14-JNK axis. Oncogene (2024). https://doi.org/10.1038/s41388-024-03021-4
Received:
Revised:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41388-024-03021-4