Identification of a subnuclear body involved in sequence-specific cytokine RNA processing

Lee, Sungwook; Lee, Taeyun A.; Lee, Eunhye; Kang, Sujin; Park, Areum; Kim, Seung Won; Park, Hyo Jin; Yoon, Je-Hyun; Ha, Sang-Jun; Park, Taesun; Lee, Ju-Seog; Cheon, Jae Hee; Park, Boyoun

doi:10.1038/ncomms6791

Article
Published: 05 January 2015

Identification of a subnuclear body involved in sequence-specific cytokine RNA processing

Sungwook Lee¹,
Taeyun A. Lee¹,
Eunhye Lee¹,
Sujin Kang¹,
Areum Park¹,
Seung Won Kim^2,3,
Hyo Jin Park⁴,
Je-Hyun Yoon⁵,
Sang-Jun Ha⁴,
Taesun Park⁶,
Ju-Seog Lee⁷,
Jae Hee Cheon^2,3 &
…
Boyoun Park¹

Nature Communications volume 6, Article number: 5791 (2015) Cite this article

5016 Accesses
16 Citations
Metrics details

Subjects

Abstract

Processing of interleukin RNAs must be tightly controlled during the immune response. Here we report that a subnuclear body called the interleukin-6 and -10 splicing activating compartment (InSAC) is a nuclear site of cytokine RNA production and stability. Tat-activating regulatory DNA-binding protein-43 (TDP-43) acts as an InSAC scaffold that selectively associates with IL-6 and IL-10 RNAs in a sequence-specific manner. TDP-43 also recruits key spliceosomal components from Cajal bodies. LPS induces posttranslational modifications of TDP-43; in particular, TDP-43 ubiquitination provides a driving force for InSAC formation. As a consequence, in vivo depletion of TDP-43 leads to a dramatic reduction in the RNA processing and the protein levels of IL-6 in serum. Collectively, our findings highlight the importance of TDP-43-mediated InSAC biogenesis in immune regulation.

You have full access to this article via your institution.

Download PDF

Immunoglobulin expression and the humoral immune response is regulated by the non-canonical poly(A) polymerase TENT5C

Article Open access 27 April 2020

The RNA helicase DHX15 is a critical regulator of natural killer-cell homeostasis and functions

Article 23 March 2022

Dual functions of Aire CARD multimerization in the transcriptional regulation of T cell tolerance

Article Open access 02 April 2020

Introduction

The mammalian nucleus is a complex organelle populated by many dynamic subcellular compartments in which numerous biological processes occur, including RNA transcription, splicing and degradation^1,2. Several different types of nuclear bodies have been identified; however, the molecular mechanisms associated with most of these remain largely unknown³. The Cajal body (CB) is a nuclear compartment involved in the assembly of spliceosomal small-nuclear ribonucleoproteins (snRNPs) and telomere synthesis^4,5,6,7. CBs are highly enriched in CB-specific small RNAs, which guide small nuclear RNA (U snRNA) modifications, and p80-coilin, which provides a structural scaffold through self-association^8,9,10.

Cytokines are proteins that act as signalling molecules to regulate immune responses and modulate cellular activities such as growth, survival and differentiation. In particular, interleukin (IL)-6 is a pluripotent cytokine that is involved in multiple pro- and anti-inflammatory processes¹¹. In addition, IL-10 is an immune-regulatory cytokine critical for maintaining immune system balance through inhibiting the secretion of pro-inflammatory cytokines, preventing the production of Th1 cytokines (for example, IL-2 and interferon (IFN)-γ) and controlling the proliferation of B cells, T cells and macrophages¹². Therefore, IL-6 and IL-10 messenger RNA production must be carefully regulated at practically all levels, as misregulated cytokine expression is known to be related to various autoimmune diseases, tumour growth and obesity^11,13,14. However, a key regulatory molecular complex associated with cytokine RNA processing has not been identified.

Tat-activating regulatory DNA-binding protein-43 (TDP-43 or Tardbp) was first identified as a DNA-binding protein with a putative role in HIV transcription¹⁵. TDP-43 is a highly conserved nucleic acid-binding protein that contains a characteristic amino-terminal domain, two RNA recognition motifs and a glycine-rich carboxy-terminal domain. It is involved in early embryogenesis, fat storage and in multiple events of RNA metabolism^{16,17,18,19,20,21}. TDP-43 resides predominantly in the nucleus, but it localizes to the cytoplasm and aggregates as inclusion bodies in patients afflicted with amyotrophic lateral sclerosis (ALS) or frontotemporal lobar degeneration (FTLD) with ubiquitin-positive inclusions^22,23. In pathological conditions, TDP-43 is also hyperphosphorylated and cleaved to generate C-terminal fragments of ~25 kDa²². In addition, TDP-43 overexpression causes neurotoxic effects, such as mitochondria aggregation, motor deficit, myelin degeneration or neuroinflammation^24,25,26. However, the molecular function of TDP-43 in cytokine RNA processing occurring during the immune response remains to be elucidated.

Here we describe the TDP-43-mediated interleukin-6 and -10 splicing activating compartment (InSAC) as the essential nuclear site of IL-6 or IL-10 mRNA production and stability. TDP-43 acts as a scaffold in the InSAC that interacts with IL-6 or IL-10 RNA, and recruits snRNAs and snRNPs from CBs. These functions facilitate pre-mRNA processing and prevent its degradation. Furthermore, lipopolysaccharide (LPS)-induced ubiquitination of TDP-43 provides a driving force in InSAC formation. Therefore, we propose that the biogenesis of InSAC functions as a specific cytokine-splicing compartment that is critical for efficient RNA production during the activation and modulation of the immune response.

Results

Identification of a novel TDP-43-enriched subnuclear body

To study the role(s) of TDP-43 in the immune response, we first examined its subcellular localization in RAW 264.7 macrophages following stimulation with 80 ng ml⁻¹ LPS for 2 or 6 h, which promotes robust cytokine production to induce innate and adaptive immunity²⁷. As TDP-43 is known to reside primarily in the nucleoplasm, it was surprising to discover that stably expressed green fluorescence protein (GFP)-tagged TDP-43 was distributed sparsely throughout the nucleoplasm, but dramatically enriched within the spherical subnuclear foci in LPS-stimulated RAW macrophages (Fig. 1a, arrowheads). We also noted that TDP-43-enriched subnuclear foci increased in size in a time-dependent manner. Approximately 45% of these cells exhibited one or two TDP-43-enriched foci in the nucleus, resembling CBs. To test whether LPS affects TDP-43 expression levels, we examined endogenous expression levels of TDP-43 in LPS-stimulated RAW macrophages, but no differences in TDP-43 expression were observed (Fig. 1b). Endogenous TDP-43 was also enriched within subnuclear foci following LPS stimulation, with smaller amounts distributed throughout the nucleoplasm (Fig. 1c (a–f)). To confirm the de novo formation of TDP-43 foci in response to LPS in primary cells, we examined endogenous TDP-43 in LPS-stimulated bone marrow-derived dendritic cells (BMDCs) (Fig. 1c (g–l)). Our data also showed the presence of TDP-43-enriched subnuclear foci following LPS exposure in primary BMDCs.

**Figure 1: LPS can induce the *de novo* formation of TDP-43 foci.**

Next, we examined whether there are cell type-specific aspects to the de novo formation of TDP-43 foci. For those experiments, we assessed the formation of TDP-43 in activated CD4⁺ T cells, which are major producers of IFN-γ, and N2A (murine neuroblastoma) cells, which can naturally produce a large amount of IL-6 (ref. 28). Interestingly, TDP-43 foci were readily detectable in N2A cells even without LPS stimulation, but not in CD4⁺ effector T cells (Supplementary Fig. 1a). These results led us to hypothesize that the formation of TDP-43 foci is dependent on the specific cytokine RNA species produced in the cells rather than on the cell type or signal. To further investigate this possibility, we examined whether TDP-43 foci can form in nuclear factor-κB (NF-κB)-deficient mouse embryonic fibroblast (MEF) cells, which do not produce proinflammatory cytokines such as IL-6 or tumour necrosis factor (TNF)-α, in the presence of LPS (Fig. 1d and Supplementary Fig. 1b). We observed a lack of TDP-43 foci formation in NF-κB-deficient MEFs (Fig. 1d (j)). In addition, IL-6 was highly produced by N2A cells even in the absence of LPS, but not secreted by CD4⁺ T cells (Supplementary Fig. 1c), further supporting our hypothesis that the formation of TDP-43 foci is linked to the production of proinflammatory cytokines.

As the de novo formation of TDP-43 subnuclear foci and that of CBs in LPS-stimulated cells are indistinguishable in size, shape and density, we next investigated whether the localization of LPS-mediated subnuclear TDP-43 foci formation overlapped with expression of the CB-specific marker p80-coilin. In LPS-stimulated macrophages, TDP-43 localization did not overlap with coilin (Fig. 1e). Surprisingly, CBs were disrupted in macrophages where TDP-43 was strongly enriched in subnuclear bodies (Fig. 1e, see white arrowheads). We also examined TDP-43 localization with respect to other subnuclear compartments, such as nucleoli and promyelocytic leukemia bodies (Supplementary Fig. 1d). However, none of these overlapped with TDP-43 foci, suggesting that the TDP-43-enriched body represents a novel subnuclear compartment that forms de novo in response to LPS stimulation.

TDP-43 is required for IL-6 RNA processing and stability

To explore the function(s) of TDP-43 in innate immunity against microbial infection, we investigated the ability of TDP-43 to induce proinflammatory cytokine production in response to LPS stimulation. TDP-43 was depleted in primary BMDCs or bone marrow-derived macrophages (BMDMs) using TDP-43-specific small interfering RNA (siRNA). Notably, this depletion impaired the LPS-induced production of IL-6 but not that of TNF-α (Fig. 2a). Likewise, LPS-stimulated RAW macrophages stably expressing TDP-43-specific short hairpin RNA (shRNA) exhibited dramatically reduced production of IL-6 but not TNF-α (Supplementary Fig. 2a). We also observed a significant decrease of TDP-43 foci formation in TDP-43-depleted RAW macrophages (Supplementary Fig. 2b). As TDP-43 is involved in RNA metabolism, we next examined the effect of TDP-43 depletion on cytokine mRNA production by reverse transcription–PCR (RT–PCR) with the indicated primer pairs (Supplementary Fig. 2c). The quantity of IL-6 mRNA elicited by LPS stimulation was reduced markedly in TDP-43-depleted BMDMs; in contrast, TNF-α mRNA levels were unaffected (Fig. 2b, indicated by arrowheads). Moreover, TDP-43 depletion led to the accumulation of unspliced IL-6 pre-mRNA and significant impairment of its processing (Fig. 2b, arrows). We quantified the band intensity of their pre-mRNA or mRNA and showed that the sum of band intensity of mRNA and pre-mRNA from control cells was similar to that from TDP-43-depleted cells. Densitometric analysis also showed the accumulated amount of IL-6 pre-mRNA in TDP-43-depleted cells (Fig. 2b, right graphs), suggesting that TDP-43 is a critical nuclear factor involved in IL-6 pre-mRNA processing. Quantitative RT–PCR (qRT–PCR) confirmed that TDP-43-depleted BMDMs showed a significant and reproducible reduction in IL-6 mRNA, but not that of TNF-α (Fig. 2c). We noted similar effects on IL-6 mRNA splicing in TDP-43-depleted RAW macrophages (Supplementary Fig. 2d).

**Figure 2: TDP-43 is essential for IL-6 pre-mRNA processing and stability.**

To explore whether Toll-like receptor (TLR)-agonist specificity is involved in TDP-43-mediated IL-6 pre-mRNA processing, we measured cytokine production in purified BMDMs exposed to CpG-DNA, which activates the TLR9 signalling cascade. In TDP-43-depleted BMDMs, production of IL-6, but not TNF-α, was attenuated in response to CpG-DNA in a manner similar to LPS (Fig. 2d). Furthermore, induction of IL-6 RNA processing by CpG-DNA was severely impaired by loss of TDP-43 expression, while TNF-α RNA splicing remained unaffected (Fig. 2e).

Based on these data, we hypothesized that TDP-43 must interact with IL-6 pre-mRNA to play a role in its RNA processing. To address this, we conducted IL-6 RNA pull-down analysis using LPS-stimulated RAW macrophages. Although the total amount of IL-6 pre-mRNA was much less than that of mRNA, RT–PCR clearly showed that TDP-43 strongly interacted with IL-6 pre-mRNA and only bound a very small amount of IL-6 mRNA (Fig. 2f). In contrast, TDP-43 did not interact with TNF-α mRNA or its pre-mRNA. These results also suggest another possible role for TDP-43 in regulating IL-6 pre-mRNA or mRNA stability. Unfortunately, it was not possible to examine IL-6 mRNA stability in TDP-43-depleted macrophages, because the impairment in pre-mRNA splicing reduced the level of IL-6 mRNA to an undetectable level. However, the half-life of IL-6 pre-mRNA in TDP-43-depleted macrophages was much shorter than in control macrophages (Fig. 2g,h). Therefore, we conclude that TDP-43 is essential for IL-6 pre-mRNA processing and stability.

TDP-43 binds IL-6 or IL-10 RNA

Previous studies have shown that TDP-43 preferentially binds pre-mRNA²¹. As TDP-43 plays a role in processing IL-6 but not TNF-α RNA (Fig. 2), it is possible that TDP-43 may bind IL-6 RNA in a sequence-dependent manner during processing. As previous reports demonstrated TDP-43 binding to long clusters of UG-rich sites in the brain^20,21, we first compared the intronic sequences of IL-6 and TNF-α RNA, to examine whether IL-6 contains UG-rich sequences within its introns. We found that IL-6 contained several UG-rich sequences within introns 1, 2 and 4; however, we also easily found UG-rich sequences within the intronic regions of TNF-α, indicating that TDP-43 may not use these sites to bind IL-6 RNA.

To identify the putative TDP-43-binding region(s) in IL-6 RNA, we designed primer pairs corresponding to each intron of IL-6 RNA for an RNA immunoprecipitation (RIP) assay (Fig. 3a). As the long strands of IL-6 pre-mRNA are relatively unstable in the absence of TDP-43 binding to introns, unbound RNA may be easily cleaved and susceptible to degradation during the RIP assay. We detected an interaction between TDP-43 and IL-6 introns 1 or 2, but not introns 3 or 4 (Fig. 3b). To further identify specific sequence(s) within IL-6 introns 1 or 2 targeted by TDP-43, we applied RNA secondary structure prediction programmes (CentroidFold, www.ncRNA.org). Surprisingly, this analysis revealed that intron 2 of mouse IL-6 contains a predicted stem-loop structure consisting of GC-rich palindromic repeats and a short spacer consisting of ‘GCACU’ (Fig. 3c and Supplementary Fig. 3). Introns 2 and 3 of TNF-α, as well as introns 3 and 4 of IL-6, each contain a similar sequence; however, it was distinct from that of IL-6 intron 2, as they contain short GC- or AT-rich palindromic sequences and a large loop (Supplementary Fig. 3). Next, we analysed all the introns present in RNAs for other cytokines, including TNF-α, IL-1β, IL-4, IL-8, IL-10, IL-12, IFN-α, IFN-β and IFN-γ, to determine whether they contain this predicted sequence. Notably, intron 1 of mouse IL-10 contained GC-rich palindromic repeats and a short spacer including ‘ACU’, similar to mouse IL-6 (Fig. 3c and Supplementary Figs 3 and 4). However, we did not observe any conserved sequences among the intronic sequences of TNF-α, IL-1β, IL-4, IL-8, IL-12, IFN-α, IFN-β or IFN-γ (Supplementary Fig. 3).

**Figure 3: TDP-43 interacts specifically with IL-6 and IL-10 RNAs.**

If this predicted stem-loop sequence is required for TDP-43 binding, then TDP-43 should interact physically with IL-10 intron 1. To address this hypothesis, we performed IL-10 pre-mRNA pull-down assays in LPS-stimulated macrophages. Indeed, TDP-43 interacted with IL-10 pre-mRNA (Fig. 3d). Our data also demonstrate that this factor plays a role in IL-10 production and RNA processing, because TDP-43-depleted BMDMs exhibited lower IL-10 secretion in response to LPS stimulation (Fig. 3e), as well as accumulation of unspliced IL-10 pre-mRNA and a significant defect in its processing in primary cells following LPS or CpG-DNA treatment (Fig. 3f). To confirm these results, we assessed IL-10 production in LPS-stimulated RAW macrophages stably expressing TDP-43 shRNA. As expected, both IL-10 production and RNA processing were significantly reduced in TDP-43-depleted macrophages (Supplementary Fig. 5b,c). However, TDP-43 knockdown did not affect the processing of IL-12 or IL-1β RNA, which do not contain a specific sequence, as the amount of mRNA was similar in BMDMs expressing TDP-43 siRNA and scrambled siRNA (Fig. 3g). Taken together, we conclude that TDP-43 can recognize a specific sequence that contains a GC-rich palindromic repeat with the conserved ‘ACU’ sequence motif in a short spacer that forms a putative stem-loop.

TDP-43 promotes IL-6 and IL-10 RNA processing

If TDP-43 binds IL-6 and IL-10 RNAs in a sequence-specific manner, then synthetic RNA containing these features should interact with TDP-43 directly in vitro. We examined the interaction of TDP-43 with a biotinylated synthetic RNA sequence encompassing nucleotides 521–543 of mouse IL-6 intron 2, which consists of a GC-rich palindromic sequence and the conserved sequence motif ‘ACU’ in a short spacer (Supplementary Fig. 4). A mutated synthetic IL-6 RNA composed of a sequence designed to disrupt the palindromic sequences and conserved sequence motif (mutCA+GUUUCUU) in a spacer was also examined. Indeed, TDP-43 interacted with the synthetic wild-type RNA containing the intact conserved sequences, but not with the mutated RNA (Fig. 4a, right panels). To confirm the specificity of this interaction, we further investigated the interaction of TDP-43 with mutated RNAs in which ‘AC’ was substituted with ‘GU’ in the conserved sequence motif (ACU) of a short spacer region (mutGU), or ‘GGG’ with ‘UUU’ in a GC-rich palindromic repeat (mutUUU) (Fig. 4b, upper schematic sequences). Unlike wild-type IL-6 RNA, TDP-43 did not bind to either mutGU or mutUUU (Fig. 4b).

**Figure 4: TDP-43 promotes IL-6 RNA processing in a stem-loop-dependent manner.**

To define whether RNA sequence is critical for TDP-43-mediated IL-6 RNA processing, we constructed an N-terminal Myc-tagged IL-6 minigene that contains exons 1, 2 and 3 along with introns 1 and 2, or mutated IL-6 minigenes that either lack the entire putative stem-loop region or possess ‘GU’ instead of ‘AC’ in the spacer region (Fig. 4c). RT–PCR analysis with a forward primer (mp1) corresponding to the 5′-Myc tag and a reverse primer (mp2) for exon 2 produced a 212-bp product, as expected, from the IL-6 minigene composed of the region from exon 1 to exon 2, which represents a spliced form of the wild-type IL-6 minigene. Even in the absence of LPS, spliced products were clearly detected in wild-type IL-6 minigene-expressing macrophages; however, the spliced form of the mutant minigene was reduced (Fig. 4c, right panel). Furthermore, we analysed IL-6 RNA processing in TDP-43-depleted macrophages expressing the wild-type IL-6 minigene (Fig. 4d). TDP-43 knockdown caused a reduction in the spliced form of the wild-type IL-6 minigene; however, splicing was normal in the absence of LPS. These findings suggest that a specific sequence in IL-6 pre-mRNA is critical for TDP-43 binding selectivity and RNA processing. Moreover, LPS does not seem to be necessary for mediating IL-6 RNA processing.

If TDP-43-enriched foci are involved in IL-6 RNA processing, they should contain IL-6 pre-mRNA for processing. To examine this possibility, we simultaneously performed RNA-fluorescence in situ hybridization (RNA-FISH) and immunolocalization in macrophages. Dual labelling of IL-6 pre-mRNA with Cy3 and TDP-43 with GFP revealed that IL-6 pre-mRNA co-localized with TDP-43-positive foci in LPS-stimulated macrophages (Fig. 4e, arrowheads). As TDP-43 foci were detected in N2A cells (even in the absence of LPS stimulation) but not in NF-κB-deficient cells (Fig. 1d and Supplementary Fig. 1a), and TDP-43-mediated RNA processing of the IL-6 minigene was independent of LPS-stimulation (Fig. 4c,d), we examined whether the formation of TDP-43 foci was indeed dependent on the presence of IL-6 RNA rather than LPS. We co-expressed GFP-TDP-43 and N-terminal Myc-tagged IL-6, IL-10 or TNF-α minigenes in macrophages and performed RNA-FISH with Cy3-IL-6, IL-10 or TNF-α pre-mRNA in the absence of LPS. Indeed, even without LPS stimulation, we observed the formation of TDP-43 foci containing IL-6 and IL-10 pre-mRNA, but not that of TNF-α (Fig. 4f arrowheads, and Supplementary Fig. 5d arrowhead). Taken together, we conclude that the IL-6 and IL-10 RNA-binding selectivity of TDP-43 is due to the recognition of specific pre-mRNA sequence containing a GC-rich palindromic sequence and a conserved sequence motif within a short spacer region. This binding facilitates the processing of bound RNAs in TDP-43 foci. Based on this role, we named the TDP-43-enriched foci InSAC.

InSAC recruits essential spliceosomal components

To understand the detailed molecular mechanisms underlying InSAC formation in IL-6 pre-mRNA processing, we further examined whether the InSAC contains essential spliceosomal U snRNAs. RAW Macrophages were stimulated with LPS before protein extraction and immunoprecipitation with an anti-trimethylguanosine antibody that recognizes the 2, 2, 7-trimethylguanosine cap of snRNAs. Immunoprecipitates were probed in immunoblottings with an anti-TDP-43 or anti-coilin antibody. Remarkably, TDP-43 was found to be associated with snRNAs in LPS-treated macrophages. These cells also showed a disruption of the interaction between coilin and snRNAs (Fig. 5a, upper and bottom panels, lanes 4 and 5). These results suggest that TDP-43 hijacks spliceosomal U snRNAs and recruits them to InSACs for the tight regulation of IL-6 and IL-10 pre-mRNA processing.

**Figure 5: TDP-43 is required for recruitment of critical spliceosomal components from CBs.**

To confirm the ability of TDP-43 to bind and recruit spliceosomal U snRNAs into InSACs, we examined the co-localization of TDP-43 with snRNAs in the InSACs by immunofluorescence microscopy. Endogenous U snRNAs were indeed co-localized with GFP-TDP-43 in LPS-stimulated macrophages and were therefore present in InSACs (Fig. 5b (f)). Moreover, components of spliceosomal snRNPs (SmB/B' and SmD1) were also found in the InSACs (Fig. 5b (l)). As the survival of motor neurons (SMN) complex is involved in snRNP assembly²⁹, we next examined the co-localization of SMN with TDP-43. In macrophages, SMN tended to distribute within CBs as well as diffusely throughout the nucleoplasm and cytoplasm, and no differences in SMN localization were observed between LPS-stimulated versus unstimulated cells (Fig. 5b (m,p)). As a result, SMN was partially co-localized with TDP-43 throughout the nucleoplasm in unstimulated cells, but the distribution of SMN did not overlap with TDP-43-containing InSACs in LPS-stimulated macrophages (Fig. 5b (r)). We observed similar results from biochemical assays showing that TDP-43 bound to SMN in unstimulated cells, whereas LPS-treated macrophages showed a significant decrease in the association of these two proteins (Fig. 5c, lanes 4 and 5). Surprisingly, the interaction between coilin and SMN increased with LPS stimulation (Fig. 5d, lanes 4 and 5). In addition to observing a disruption in the formation of CBs, where TDP-43-mediated InSACs assemble de novo (Fig. 1e), the interaction between TDP-43 and coilin was also perturbed by LPS stimulation, as we had hypothesized (Fig. 5e, lanes 4 and 5). Taken together, these results demonstrate that TDP-43 plays a role not only in competitively recruiting essential spliceosomal components to InSACs from CBs in response to LPS, but also in controlling the distribution of subnuclear compartments, including CBs, SMN complexes and InSACs.

LPS induces posttranslational modifications of TDP-43

Previous studies have reported that cytoplasmic TDP-43 inclusions that form in neurons and astroglia of ALS and FTLD patients by a variety of factors are rich in ubiquitinated, oligomerized and hyperphosphorylated, and they are also cleaved to generate N- or C-terminal TDP-43 fragments^22,30. We thus hypothesized that infectious stimulation may enhance the propensity of TDP-43 to undergo modification, which supports InSAC formation, and examined whether this protein undergoes any posttranslational modification in LPS-stimulated macrophages. The possibility of LPS-induced TDP-43 oligomerization was assessed in macrophages stably expressing GFP-TDP-43 and HA-TDP-43. Proteins from LPS-treated macrophages were immunoprecipitated with anti-HA antibody and then subjected to immunoblotting with anti-TDP-43 antibody. Notably, LPS facilitated TDP-43 oligomerization (Fig. 6a, lane 3). Moreover, we found that TDP-43 in LPS-stimulated macrophages was cleaved into two different fragments (Fig. 6b, arrowheads). To exclude the outcomes of nonspecific bands by LPS stimulation, we examined LPS-induced TDP-43 fragmentation in TDP-43-depleted cells. Based on the disappearance of the cleaved forms in TDP-43 knockdown cells, we conclude that these cleaved fragments were indeed generated from full-length TDP-43 in response to LPS.

Furthermore, immunoblot analysis with an anti-ubiquitin antibody revealed the presence of ubiquitinated endogenous TDP-43, which appeared as a large-molecular weight smear in the top panel (asterisk in Fig. 6c). We also examined TDP-43 phosphorylation in macrophages exposed to LPS, but we did not observe such phosphorylation in response to LPS stimulation (Supplementary Fig. 6a). In addition, TDP-43 contains a putative sumoylation site (VKKD) within the amino acid region 135–138 (Supplementary Fig. 6b). To address the possibility of LPS-mediated TDP-43 sumoylation, we examined endogenous TDP-43 sumoylation in LPS-simulated cells. However, we did not observe any sumoylated TDP-43 in the absence or presence of LPS (Supplementary Fig. 6c). Based on these data taken together, we conclude that LPS promotes the oligomerization, fragmentation and ubiquitination of TDP-43, which may facilitate InSAC formation and nucleate the essential components of spliceosomal snRNPs and IL-6 or IL-10 RNA for efficient RNA processing.

TDP-43 ubiquitination is essential for IL-6 RNA processing

As many lines of evidence show that TDP-43 ubiquitination provides a strong driving force for the formation of intracellular inclusion bodies in ALS or FTLD, we focused on this modification and investigated whether the ubiquitination of TDP-43 is necessary for the formation of subnuclear InSAC and the processing of IL-6 RNA. In particular, as the ubiquitin-conjugating enzyme UBE2E3 regulates TDP-43 ubiquitination³¹, we generated macrophages stably expressing UBE2E3 shRNA and examined TDP-43 ubiquitination in LPS-stimulated macrophages. We clearly observed that UBE2E3 depletion reduced TDP-43 ubiquitination in the presence of LPS (Fig. 7a). Furthermore, in UBE2E3-depleted cells, the number of InSAC formed was significantly decreased, and the RNA processing and protein secretion of IL-6 were much lower than seen in control cells (Fig. 7b–d). Therefore, we conclude that TDP-43 ubiquitination is required for InSAC formation, thereby promoting IL-6 RNA processing.

**Figure 7: TDP-43 ubiquitination is essential for *de novo* TDP-43 foci formation.**

Effect of in vivo TDP-43 depletion on cytokine production

To test the physiological effect of TDP-43 in cytokine RNA processing, we assessed IL-6 and TNF-α mRNA levels in live mice depleted of TDP-43 and injected with LPS to induce cytokine RNA production (Fig. 8a). In vivo delivery of target siRNA is a well-established system that allowed us to deplete TDP-43 systemically in live mice in vivo, especially in the spleen. Indeed, TDP-43 was significantly depleted in the splenic macrophages (Fig. 8b,c). Importantly, qRT–PCR demonstrated that TDP-43-depleted mice showed reduced IL-6 mRNA production. In contrast, we did not observe a significant difference in TNF-α RNA production on TDP-43 depletion (Fig. 8c). In addition, IL-6 RNA processing was also markedly impaired by in vivo TDP-43 depletion (Fig. 8d). Furthermore, we clearly observed a reduction in the total serum levels of IL-6 in TDP-43-depleted mice (Fig. 8e). However, levels of IL-10 in the serum of mice were barely detected at the indicated times, because IL-10 is mainly secreted at later time points during LPS stimulation. Consistent with in vitro data from primary cells, these results strongly indicate that TDP-43-mediated InSACs induce LPS-mediated inflammation by facilitating IL-6 RNA processing.

**Figure 8: TDP-43 is essential for IL-6 RNA processing.**

Discussion

These studies identify and characterize the InSAC as a novel subnuclear site enriched with TDP-43, IL-6 and IL-10 cytokine pre-mRNAs, snRNAs and Sm proteins. InSAC bodies form in a cell type capable of producing TDP-43-binding cytokine RNAs. Our study also elucidates how IL-6 and IL-10 pre-mRNA processing is tightly regulated by TDP-43-mediated InSAC formation, and how this regulation may be maintained during the immune response to microbial infection. TDP-43 functions as a scaffolding protein that is required for competitively recruiting critical spliceosomal components, thereby facilitating specific cytokine pre-mRNA processing and preventing its degradation. The RNA-binding selectivity of TDP-43 is determined by sequence-specific recognition, leading to the induction of IL-6 and IL-10 RNA processing. In addition, TDP-43-targeted RNA contains GC-rich palindromic repeats along with the conserved ‘ACU’ sequence motifs within a short spacer region. Ultimately, TDP-43-mediated InSAC formation is important in promoting immune defense mechanisms against microbes and maintaining immune homeostasis (Fig. 8f).

In particular, ‘ACU’ sequence motifs within the short spacer region of human IL-6 intron 1 are similar to that of mouse IL-6 intron 2 and mouse IL-10 intron 1. In addition, compared with mouse IL-10, human IL-10 intron 2 also contained the conserved GC-rich palindromic sequences and ‘ACC’ instead of ‘ACU’ within a short spacer region (Supplementary Fig. 4). Thus, it remains possible that TDP-43 may contribute to the enhancement of human IL-6 and IL-10 RNA processing. In contrast, TDP-43 does not influence RNA splicing of TNF-α, IL-12, IL-8 or IL-1β, the major proinflammatory cytokines elicited by LPS or CpG-DNA stimulation. We have been unable to identify a predicted stem-loop sequence within their introns. Although some contain GC-rich palindromic repeats, they possess a larger spacer instead of a short spacer consisting of five or six nucleotides. Presumably, a putative large stem-loop within an intron is unfavourable for the TDP-43 interaction (Figs 3c and 4a, and Supplementary Fig. 3). This raises the question of whether additional specialized nuclear compartments exist that interact with cytokine RNAs containing uncharacterized structural elements, such as a large stem-loop or helix, leading to the selective processing of these cytokine RNAs.

TDP-43 plays an important role in competitively nucleating essential spliceosomal components to InSACs from CBs in response to LPS, and in controlling the distribution of subnuclear compartments as well (Fig. 5). Previous studies have shown that coilin is a multivalent scaffold, allowing it to bind snRNPs efficiently through low-affinity interactions with CB components including SMN^32,33,34, and that subnuclear snRNAs are specifically required for CB formation^35,36.Thus, it seems likely to be that the LPS-induced high-affinity interaction of coilin with SMN prevents the binding of coilin to snRNAs, thereby destabilizing CB formation; on the other hand, the LPS-mediated low-affinity interaction of TDP-43 with SMN may enhance the association of TDP-43 with snRNAs, thus stabilizing InSACs.

TLRs recognize different components from bacteria, fungi and viruses to produce various cytokines and chemokines that are critical for inducing innate and adaptive immune responses²⁷. As TLR4 is essential for LPS recognition, many adaptor proteins involved in activating this receptor could also be critical in LPS-induced TDP-43 modifications. Previous studies have shown that TDP-43 function is affected by a deficiency in progranulin³⁷, a secreted protein that regulates multiple pathways involved in nucleic acid-sensing TLR9 activation^38,39. However, a correlation between TDP-43 and progranulin in LPS-induced InSAC formation remains unclear and might be a subject for future investigation. In particular, Swarup et al.²⁵ has shown that physical interaction between TDP-43 and NF-κB p65 promotes NF-κB-mediated neuroinflammation in ALS cases and TDP-43 transgenic mice. Importantly, we show that InSAC formation is normal in N2A cells even without LPS stimulation. Moreover, the expression of the IL-6 minigene was efficiently processed to mature RNA in the absence of LPS stimulation. Therefore, regardless of NF-κB activation, InSAC formation seems to occur through the recruitment and accumulation of spliceosomal components by recruiting sequence- and structure-specific RNAs, but the possibility remains of the involvement of NF-κB in regulating InSAC formation or the dynamic distribution of other subnuclear bodies.

IL-6 is a pleiotropic cytokine that functions broadly in immune and non-immune cells as a pro- and anti-inflammatory cytokine¹¹. A very recent publication by Shalek et al.⁴⁰ has reported that IL-6 is a sustained cytokine, which continues to show high expression over 12 h after LPS stimulation, compared with TNF-α, which is produced for a very short time during infection. We noted that the InSAC appears at 1 h after LPS stimulation and increases in size in a time-dependent manner. It is possible that InSAC size may be highly correlated with IL-6 RNA production. We thus assume that autoimmune diseases or cancers could be characterized by excessive InSAC formation, and that these conditions could arise due to abnormal TDP-43 modifications, such as ubiquitination or oligomerization. Such insights into the molecular pathology of various cancers and autoimmune diseases may accelerate the development of improved therapies for treating these diseases.

Methods

DNA constructs

Mouse TDP-43 constructs were fused at the N terminus to haemagglutinin (HA) or GFP, and mouse Coilin was tagged at the C terminus with Myc. All constructs were cloned into the retroviral pMSCV (puro) or pLHCX (hygro) vector (Clontech, Mountain View, CA). The shRNA sequence against TDP-43, GFP and UBE2E3 was annealed and subcloned into the pSUPER retroviral vector (Oligoengine, Seattle, WA). Myc-IL-6 minigene comprising exon 1, intron 1, exon 2, intron 2 and exon 3 was constructed by PCR amplification from genomic DNA and subcloned in pMSCV N-term Myc, between the XhoI and EcoRI sites. The mutant minigene of IL-6 was generated by overlap extension PCR. All constructs were verified by sequencing and all primer sequences are listed in Supplementary Table 2.

Antibodies

Antibodies against Myc (1:2,000; 2276), HA (1:1,000; clone 3F10 and 12CA5) and GFP (1:4,000; ab290) were obtained from Cell Signaling Technology (Danvers, MA), Roche (Basel, Switzerland) and Abcam (Cambridge, UK), respectively. The following antibodies were also used: anti-TDP-43 (1:500; A303-223A; Bethyl Laboratories, Montgomery, TX, and 1:1,000 ab104223; Abcam), anti-Coilin (1:200; sc-32860 and sc-135871; Santa Cruz Biotechnology, Santa Cruz, CA), anti-Promyelocytic Leukemia (1:200; AM20293AF-N; Acris Antibodies, San Diego, CA), anti-Nucleolin (1:200; sc-55486; Santa Cruz), anti-SMN (1:2,000; 610646; BD Biosciences, San Jose, CA), anti-Sm (1:1,000; MS-450-P; Thermo Scientific, Fremont, CA), anti-2,2,7-Trimethylguanosine (1:500; NA02; Merck KGaA, Darmstadt, Germany) and anti-UBE2E3 (1:1,000; Merck Millipore, clone MABS17). Antibodies against ubiquitin (1:1,000; 13-160), phospho-serine (1:200; 61-8100) and SUMO-1 (1:2,000; S8070) were purchased from Life Technologies (Carlsbad, CA) and Sigma (St Louis, MO).

Mice and cell lines

C57BL/6 mice were purchased from the Jackson Laboratory. All mice were maintained in the specific pathogen-free facility of the Yonsei Laboratory Animal Research Center at Yonsei University. Murine RAW264.7 macrophages (TIB71, ATCC, Manassas, VA) human embryonic kidney 293T cells (CRL-3216, ATCC) and NF-κβ p65-deficient MEFs (kindly provided by Dr Alxander Hoffmann) were cultured in DMEM supplemented with 10% heat-inactivated fetal bovine serum (HyClone, Logan, UT) and penicillin/streptomycin (HyClone). Cells were grown at 37 °C in humidified air with 5% CO₂.

Generation of BMDCs and BMDMs

BMDMs and BMDCs were generated from wild-type C57BL/6 mice (Orient Bio, Gyeonggi-do, South Korea), in medium containing macrophage colony-stimulating factor (CSF) (BioLegend, San Diego, CA) or granulocyte macrophage-CSF (BioLegend). Briefly, femurs and tibiae were collected from mice 4–5 weeks old. After removing bone adjacent muscles, marrow cells were extracted by flushing with a 25-gauge needle. Bone marrow cells were then resuspended on DMEM medium (10% fetal bovineserum and 1% antibiotics) with macrophage-CSF (25 ng ml⁻¹) or granulocyte macrophage-CSF (5 ng ml⁻¹). Fresh medium was replenished on days 2 and 4. BMDMs and BMDCs were generated after 6–8 days of culture.

Retroviral transduction

Human embryonic kidney 293T cells were transfected with plasmids encoding VSV-G and Gag-Pol, as well as either coilin-Myc, HA-TDP-43, GFP-TDP-43, negative control shRNA for GFP, shRNA for TDP-43, or shRNA for UBE2E3. Thirty-six to 48 h post transfection, media containing viral particles were collected, filtered through a 0.45-μm membrane and incubated with RAW macrophages for 24 h. Cells were selected with puromycin or hygromycin.

Enzyme-linked immunosorbent assay

RAW264.7 macrophages expressing control shRNA against GFP or shRNA against TDP-43 or UBE2E3 were cultured with LPS (80 ng ml⁻¹) for 6 h. BMDMs or BMDCs was transfected (DharmaFECT, Thermo Scientific) with either scrambled siRNA or TDP-43 siRNA for 48 h, followed by stimulation with LPS (80 ng ml⁻¹) or CpG-DNA (1 μM) for 6 h. Tissue culture supernatants were collected, and mouse IL-6, IL-10 and TNF-α levels were analysed by ELISA assay according to the manufacturer’s recommendations (BD Biosciences).

RNA immunoprecipitation

Nuclear fractions were isolated using a hypotonic buffer containing 10 mM HEPES, pH 7.9, 15 mM MgCl₂, 10 mM KCl, 0.05% NP-40 and protease inhibitor cocktail (Roche). Nuclear extracts were resuspended in RIP buffer (50 mM Tris-Cl, pH 7.4, 300 mM NaCl, 0.05% NP-40 and protease inhibitor cocktail) containing 100 units of RNase inhibitor (TaKaRa, Otsu, Japan) and then incubated with anti-HA or anti-Isotype control antibody overnight. After incubation with protein G-Sepharose beads (Sigma) for 1 h, samples were washed with ice-cold RIP buffer and RNA was extracted using an RNA purification kit (GeneAll, Seoul, South Korea) according to the manufacturer’s instructions. All primer sequences are listed in Supplementary Table 1.

GST pull-down and RNA electrophoretic mobility shift assay

Escherichia coli-expressed GST-TDP-43 was purified by Glutathione-agarose (Sigma) according to the supplier’s instructions, with minor modifications. The binding reaction was performed by mixing the purified GST-TDP-43 with biotin-labelled RNA for IL-6 intron 2 (biotin-5′- AUGCCUCCCAGCACUUGGGAGGCAC -3′) or mutated RNAs; mutCA+GUUUCUU (biotin-5′- AUGCCUCCCAGCCAUGUUUCUUCAC -3′), mutGU (biotin-5′- AUGCCUCCCAGCGUUUGGGAGGCAC -3′), or mutUUU (biotin-5′- AUGCCUCCCAGCACUUUUUAGGCAC -3′) in 20 μl reaction buffer according to the manufacturer’s protocol (LightShift Cmiluminescent RNA EMSA Kit, Thermo Scientific, Rockford, IL). Reaction mixtures were separated by a 6% native acrylamide gel in 0.5 × TBE and further analysed by streptavidin–horseradish peroxidase (Thermo scientific).

In vivo RNA interference experiment

TDP43 expression in live mice was knocked down by siRNA to TDP43 with Invivofectamine (Invitrogen). siRNA–Invivofectamine complex was prepared as per the manufacturer’s protocol. Briefly, siRNAs (3 mg ml⁻¹) were mixed with complexation buffer and Invivofectamine, incubated for 30 min at 50 °C and dialysed at room temperature for 2 h in PBS (pH 7.4). Dialysed siRNA-Invivofectamine complex (7 mg kg⁻¹) was intraperitoneally injected through female C57BL/6 (5 or 6 weeks) mice. Two days later, mice were treated intraperitoneally with LPS (5 mg kg⁻¹). After 9 h, mice were euthanized and the spleens were collected for RT–PCR or qRT–PCR. To purify splenic macrophages, the spleens were dissected from abdominal cavity and removed red cells. Flow cytometry sorting was performed to obtain F4/80-positive and CD11c-negative cells. Mouse serum was collected at 0, 6 and 9 h for ELISA assay.

Real time PCR

Total cellular RNA was prepared using an RNA prep kit (GeneAll). Next, 500 ng total RNA was reverse transcribed for 1 h with random hexamers at 42 °C using M-MLV (Moloney Murine Leukemia Virus) reverse transcriptase (Enzynomics, Seoul, South Korea). Subsequently, PCR was performed using the following conditions: 30 cycles of 15 s at 94 °C, 15 s at the experimentally determined optimal annealing temperature (at 56–58 °C) and 60 s per 1 kb at 72 °C (15–40 s). PCR products were visualized on ethidium bromide-stained gels. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for normalization. Real-time PCR was performed using TOPreal qPCR premix (SYBR Green, Enzynomics) and Applied Biosystems 7300 Real-Time PCR System (Life Technologies). TaqMan quantitative PCRs were performed with TaqMan gene expression assays (Applied Biosystems) for TDP-43 (Mm00523866_m), IL-6 (Mm00446190_m1), TNF-α (Mm00443258_m1) and GAPDH (Mm99999915_g1). Results were normalized to expression of the gene encoding GAPDH and were quantified by the change-in-threshold method (ΔΔCT). All primer sequences and the predicted band sizes are listed in Supplementary Table 1.

Immunofluorescence assay

For immunofluorescent staining, cells were fixed in 3.7% formaldehyde and permeabilized with 0.1% Triton X-100 before incubation with the appropriate primary antibody. Bound antibody was visualized with an Alexa Fluor 488- or Alexa Fluor 568-conjugated secondary antibody (Life Technologies). DAPI (4′, 6-diamidino-2-phenylindole) (Sigma) was used as a nuclear counterstain.

FISH assay

Cells were fixed with 3.7% formaldehyde and permeabilized with 70% Ethanol. Cy3-labelled probes for IL-6 intron 2 (Cy3-5′- AGCATAGAGTAGGAACTTGGTAAAGGACAG -3′) was incubated with hybridization buffer (10% formamide, 2 × SSC, Dextran sulfate (100 mg ml⁻¹)) and RNase inhibitor (100 unit) at 37 °C for 4 h in a humid dark box. Unbound probe was removed by washing buffer (10% formamide and 2 × SSC).

Immunoprecipitation and immunoblot analysis

Approximately 2.5 × 10⁶ cells were lysed with 2% NP-40 in PBS supplemented with protease inhibitors for 1 h at 4 °C. Lysates were first precleared with protein G-Sepharose beads (Sigma) before the addition of primary antibodies followed by protein G-Sepharose beads. The samples were incubated at 4 °C. The beads were then washed five times with 0.2% NP-40/PBS and proteins were eluted by boiling the samples in denaturing buffer. Proteins were separated by SDS–PAGE, transferred onto a nitrocellulose membrane, blocked with 5% skim milk in PBS containing 0.1% Tween-20 (Sigma) for 2 h and then probed with the appropriate antibody for 4 h at room temperature. Membranes were washed three times with PBS containing 0.1% Tween-20 and incubated with horseradish peroxidase-conjugated streptavidin for 1 h. Bands were visualized using an ECL detection reagent (Thermo Scientific).

Ethics statement

All animal experiments were performed in accordance with the Korean Food and Drug Administration guidelines. Protocols were reviewed and approved by the Institutional Animal Care and Use Committee of the Yonsei Laboratory Animal Research Center at Yonsei University (Permit Number: 2007-0001).

Statistical analysis

All experiments were repeated at least three times with consistent results. Data are presented as mean and s.d. or s.e.m (as noted in figure legends). Statistical differences between two means were evaluated with the two-tailed unpaired Student’s t-test. Differences with P-values below 0.05 were considered significant. No samples were excluded from the analysis. The data had a normal distribution and the variance was similar between the groups being statistically compared. No statistical method was used to predetermine sample sizes. Sample size was based on previous experience with experimental variability. The experiments were not randomized. The investigators were not blinded to allocation during experiments or outcome assessment.

Additional information

How to cite this article: Lee, S. et al. Identification of a subnuclear body involved in sequence-specific cytokine RNA processing. Nat. Commun. 6:5791 doi: 10.1038/ncomms6791 (2015).

References

Lamond, A. I. & Spector, D. L. Nuclear speckles: a model for nuclear organelles. Nat. Rev. Mol. Cell. Biol. 4, 605–612 (2003).
Article CAS Google Scholar
Handwerger, K. E. & Gall, J. G. Subnuclear organelles: new insights into form and function. Trends Cell Biol. 16, 19–26 (2006).
Article CAS Google Scholar
Matera, A. G., Izaguire-Sierra, M., Praveen, K. & Rajendra, T. K. Nuclear bodies: random aggregates of sticky proteins or crucibles of macromolecular assembly? Dev. Cell 17, 639–647 (2009).
Article CAS Google Scholar
Sleeman, J. E. & Lamond, A. I. Newly assembled snRNPs associate with coiled bodies before speckles, suggesting a nuclear snRNP maturation pathway. Curr. Biol. 9, 1065–1074 (1999).
Article CAS Google Scholar
Jady, B. E. et al. Modification of Sm small nuclear RNAs occurs in the nucleoplasmic Cajal body following import from the cytoplasm. EMBO J. 22, 1878–1888 (2003).
Article CAS Google Scholar
Dundr, M. et al. In vivo kinetics of Cajal body components. J. Cell Biol. 164, 831–842 (2004).
Article CAS Google Scholar
Venteicher, A. S. et al. A human telomerase holoenzyme protein required for Cajal body localization and telomere synthesis. Science 323, 644–648 (2009).
Article CAS ADS Google Scholar
Gall, J. G. Cajal bodies: the first 100 years. Annu. Rev. Cell Dev. Biol. 16, 273–300 (2000).
Article CAS Google Scholar
Kaiser, T. E., Intine, R. V. & Dundr, M. De novo formation of a subnuclear body. Science 322, 1713–1717 (2008).
Article CAS ADS Google Scholar
Cioce, M. & Lamond, A. I. Cajal bodies: a long history of discovery. Annu. Rev. Cell Dev. Biol. 21, 105–131 (2005).
Article CAS Google Scholar
Akira, S., Taga, T. & Kishimoto, T. Interleukin-6 in biology and medicine. Adv. Immunol. 54, 1–78 (1993).
Article CAS Google Scholar
Bogdan, C., Vodovotz, Y. & Nathan, C. Macrophage deactivation by interleukin 10. J. Exp. Med. 174, 1549–1555 (1991).
Article CAS Google Scholar
Moore, K. W., de Waal Malefyt, R., Coffman, R. L. & O’Garra, A. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19, 683–765 (2001).
Article CAS Google Scholar
Wellen, K. E. & Hotamisligil, G. S. Obesity-induced inflammatory changes in adipose tissue. J. Clin. Invest. 112, 1785–1788 (2003).
Article CAS Google Scholar
Ou, S. H., Wu, F., Harrich, D., Garcia-Martinez, L. F. & Gaynor, R. B. Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency virus type 1 TAR DNA sequence motifs. J. Virol. 69, 3584–3596 (1995).
CAS PubMed PubMed Central Google Scholar
Sephton, C. F. et al. TDP-43 is a developmentally regulated protein essential for early embryonic development. J. Biol. Chem. 285, 6826–6834 (2010).
Article CAS Google Scholar
Chadt, A. et al. Tbc1d1 mutation in lean mouse strain confers leanness and protects from diet-induced obesity. Nat. Genet. 40, 1354–1359 (2008).
Article CAS Google Scholar
Chiang, P. M. et al. Deletion of TDP-43 down-regulates Tbc1d1, a gene linked to obesity, and alters body fat metabolism. Proc. Natl Acad. Sci. USA 107, 16320–16324 (2010).
Article CAS ADS Google Scholar
Lagier-Tourenne, C., Polymenidou, M. & Cleveland, D. W. TDP-43 and FUS/TLS: emerging roles in RNA processing and neurodegeneration. Hum. Mol. Genet. 19, R46–R64 (2010).
Article CAS Google Scholar
Polymenidou, M. et al. Long pre-mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43. Nat. Neurosci. 14, 459–468 (2011).
Article CAS Google Scholar
Tollervey, J. R. et al. Characterizing the RNA targets and position-dependent splicing regulation by TDP-43. Nat. Neurosci. 14, 452–458 (2011).
Article CAS Google Scholar
Neumann, M. et al. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314, 130–133 (2006).
Article CAS ADS Google Scholar
Johnson, B. S., McCaffery, J. M., Lindquist, S. & Gitler, A. D. A yeast TDP-43 proteinopathy model: exploring the molecular determinants of TDP-43 aggregation and cellular toxicity. Proc. Natl Acad. Sci. USA 105, 6439–6444 (2008).
Article CAS ADS Google Scholar
Xu, Y. F. et al. Wild-type human TDP-43 expression causes TDP-43 phosphorylation, mitochondrial aggregation, motor deficits, and early mortality in transgenic mice. J. Neurosci. 30, 10851–10859 (2010).
Article CAS Google Scholar
Swarup, V. et al. Deregulation of TDP-43 in amyotrophic lateral sclerosis triggers nuclear factor kappaB-mediated pathogenic pathways. J. Exp. Med. 208, 2429–2447 (2011).
Article CAS Google Scholar
Herman, A. M., Khandelwal, P. J., Rebeck, G. W. & Moussa, C. E. Wild type TDP-43 induces neuro-inflammation and alters APP metabolism in lentiviral gene transfer models. Exp. Neurol. 235, 297–305 (2012).
Article CAS Google Scholar
Janeway, C. A. Jr. & Medzhitov, R. Innate immune recognition. Annu. Rev. Immunol. 20, 197–216 (2002).
Article CAS Google Scholar
Cheng, Y. C. et al. F-spondin plays a critical role in murine neuroblastoma survival by maintaining IL-6 expression. J. Neurochem. 110, 947–955 (2009).
Article CAS Google Scholar
Pellizzoni, L., Yong, J. & Dreyfuss, G. Essential role for the SMN complex in the specificity of snRNP assembly. Science 298, 1775–1779 (2002).
Article CAS ADS Google Scholar
Igaz, L. M. et al. Expression of TDP-43 C-terminal fragments in vitro recapitulates pathological features of TDP-43 proteinopathies. J. Biol. Chem. 284, 8516–8524 (2009).
Article CAS Google Scholar
Hans, F. et al. UBE2E ubiquitin-conjugating enzymes and ubiquitin isopeptidase Y regulate TDP-43 protein ubiquitination. J. Biol. Chem. 289, 19164–19179 (2014).
Article CAS Google Scholar
Stanek, D. & Neugebauer, K. M. The Cajal body: a meeting place for spliceosomal snRNPs in the nuclear maze. Chromosoma 115, 343–354 (2006).
Article CAS Google Scholar
Hebert, M. D. & Matera, A. G. Self-association of coilin reveals a common theme in nuclear body localization. Mol. Biol. Cell 11, 4159–4171 (2000).
Article CAS Google Scholar
Xu, H. et al. The C-terminal domain of coilin interacts with Sm proteins and U snRNPs. Chromosoma 114, 155–166 (2005).
Article CAS Google Scholar
Lemm, I. et al. Ongoing U snRNP biogenesis is required for the integrity of Cajal bodies. Mol. Biol. Cell 17, 3221–3231 (2006).
Article CAS Google Scholar
Sleeman, J. E., Ajuh, P. & Lamond, A. I. snRNP protein expression enhances the formation of Cajal bodies containing p80-coilin and SMN. J. Cell Sci. 114, 4407–4419 (2001).
CAS PubMed Google Scholar
Zhang, Y. J. et al. Progranulin mediates caspase-dependent cleavage of TAR DNA binding protein-43. J. Neurosci. 27, 10530–10534 (2007).
Article CAS Google Scholar
Park, B. et al. Granulin is a soluble cofactor for toll-like receptor 9 signaling. Immunity 34, 505–513 (2011).
Article Google Scholar
Tanaka, A. et al. Serum progranulin levels are elevated in patients with systemic lupus erythematosus, reflecting disease activity. Arthritis Res. Ther. 14, R244 (2012).
Article CAS Google Scholar
Shalek, A. K. et al. Single-cell RNA-seq reveals dynamic paracrine control of cellular variation. Nature 510, 363–369 (2014).
Article CAS ADS Google Scholar

Download references

Acknowledgements

We thank Dr Philip C. Wong (Departments of Pathology, Neuroscience and Neurology, The Johns Hopkins University School of Medicine, Baltimore) for critical reading of the manuscript, and Dr Alxander Hoffmann (University of San Diego, USA) for NF-κB-deficient MEF cells. This study was supported by grants from Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2010-0009203 and 2011-0015372), from the National R&D Program for Cancer Control, Ministry of Health & Welfare, Republic of Korea (1220060), and from the Korean Health Technology R&D Project, Ministry of Health & Welfare, Republic of Korea (HI14C2542). S.L. and J.-H. Y. were supported by the Yonsei University Research Fund of 2014 (2014-12-0135) and by the NIA-IRP, NIH, respectively. S.L., S.K., T.A.L., E.L. and A.P. were supported by Brain Korea (BK21) PLUS Program.

Author information

Authors and Affiliations

Department of Systems Biology, College of Life Science and Biotechnology, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul, 120-749, South Korea
Sungwook Lee, Taeyun A. Lee, Eunhye Lee, Sujin Kang, Areum Park & Boyoun Park
Department of Internal Medicine and Institute of Gastroenterology, Yonsei University College of Medicine, Seoul, 120-752, South Korea
Seung Won Kim & Jae Hee Cheon
Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul, 120-752, South Korea
Seung Won Kim & Jae Hee Cheon
Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul, 120-749, South Korea
Hyo Jin Park & Sang-Jun Ha
Laboratory of Genetics, National Institute on Aging-Intramural Research Program, NIH, Baltimore, 21224, Maryland, USA
Je-Hyun Yoon
Department of Food and Nutrition, College of Human Ecology, Yonsei University, Seoul, 120-749, South Korea
Taesun Park
Department of Systems Biology, University of Texas MD Anderson Cancer Center, Houston, 77054, Texas, USA
Ju-Seog Lee

Authors

Sungwook Lee
View author publications
You can also search for this author in PubMed Google Scholar
Taeyun A. Lee
View author publications
You can also search for this author in PubMed Google Scholar
Eunhye Lee
View author publications
You can also search for this author in PubMed Google Scholar
Sujin Kang
View author publications
You can also search for this author in PubMed Google Scholar
Areum Park
View author publications
You can also search for this author in PubMed Google Scholar
Seung Won Kim
View author publications
You can also search for this author in PubMed Google Scholar
Hyo Jin Park
View author publications
You can also search for this author in PubMed Google Scholar
Je-Hyun Yoon
View author publications
You can also search for this author in PubMed Google Scholar
Sang-Jun Ha
View author publications
You can also search for this author in PubMed Google Scholar
Taesun Park
View author publications
You can also search for this author in PubMed Google Scholar
Ju-Seog Lee
View author publications
You can also search for this author in PubMed Google Scholar
Jae Hee Cheon
View author publications
You can also search for this author in PubMed Google Scholar
Boyoun Park
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

S.L., T.A.L., E.L., S.K., A.P. and H.J.P. conducted experiments and analysed data. B.P. and S.L. designed experiments and wrote the manuscript. J.-H.Y., S.-J.H., T.P., J.-S.L. S.W.K. and J.H.C. advised on experimental designs.

Corresponding author

Correspondence to Boyoun Park.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Information

Supplementary Figures 1-6, Supplementary Tables 1-2, Supplementary Methods and Supplementary References (PDF 1891 kb)

Rights and permissions

Reprints and permissions

About this article

Cite this article

Lee, S., Lee, T., Lee, E. et al. Identification of a subnuclear body involved in sequence-specific cytokine RNA processing. Nat Commun 6, 5791 (2015). https://doi.org/10.1038/ncomms6791

Download citation

Received: 21 May 2014
Accepted: 06 November 2014
Published: 05 January 2015
DOI: https://doi.org/10.1038/ncomms6791

This article is cited by

The nucleolus is the site for inflammatory RNA decay during infection
- Taeyun A. Lee
- Heonjong Han
- Boyoun Park
Nature Communications (2022)
Association between ALS and retroviruses: evidence from bioinformatics analysis
- Jon P. Klein
- Zhifu Sun
- Nathan P. Staff
BMC Bioinformatics (2019)
Linking RNA Dysfunction and Neurodegeneration in Amyotrophic Lateral Sclerosis
- Sami J. Barmada
Neurotherapeutics (2015)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.