Abstract
Directed cell movement involves spatial and temporal regulation of the cortical microtubule (Mt) and actin networks to allow focal adhesions (FAs) to assemble at the cell front and disassemble at the rear. Mts are known to associate with FAs, but the mechanisms coordinating their dynamic interactions remain unknown. Here we show that the CRL3KLHL21 E3 ubiquitin ligase promotes cell migration by controlling Mt and FA dynamics at the cell cortex. Indeed, KLHL21 localizes to FA structures preferentially at the leading edge, and in complex with Cul3, ubiquitylates EB1 within its microtubule-interacting CH-domain. Cells lacking CRL3KLHL21 activity or expressing a non-ubiquitylatable EB1 mutant protein are unable to migrate and exhibit strong defects in FA dynamics, lamellipodia formation and cortical plasticity. Our study thus reveals an important mechanism to regulate cortical dynamics during cell migration that involves ubiquitylation of EB1 at focal adhesions.
Similar content being viewed by others
Introduction
Cell migration is essential for tissue organization and regeneration, and defects in the underlying processes have been associated with many developmental disorders and cancer progression. Directed cell migration requires cell polarization and the coordinated action of the actin and microtubule (Mt) cytoskeletons1. However, the spatial and temporal mechanisms that link actin and Mt dynamics are poorly understood.
Cell migration requires sustained forward movement of the plasma membrane at the leading edge. Actin polymerization directly pushes the plasma membrane forward using a combination of actomyosin-based contractility and reversible detachment of membrane from cortical actin cytoskeleton. Dynamic Mts are also required during the migration process1,2, but their function at the cortex is less clear. Individual Mts are polarized filaments, with plus ends that grow, shrink or pause in a process termed dynamic instability3. Mt dynamics are regulated by multiple components including motor proteins and crosslinking factors, as well as by post-transcriptional modifications4.
Mt-plus ends are highly dynamic and comprise a loading platform for Mt-plus-end interacting proteins called +TIPs5, like the family of end binding (EB) proteins that includes EB1, EB2 and EB3. EB1 forms dimers, that autonomously track Mt tips by recognizing structural motifs on growing Mt ends6,7,8,9,10. The structure of the EB1 amino-terminal domain, encompassing conserved CH-domain, has been determined in complex with α-β tubulin heterodimers by cryo-electron microscopy11. The C-terminal domain of EB1 binds +TIPs partners including the adenomatous polyposis coli (APC) tumour suppressor, the Mt–actin binding protein (MACF), the cytoplasmic linker protein (CLIP170) and Clip-associated proteins (CLASPs)12. A conserved SxIP motif in +TIP proteins targets them to Mt-plus ends in an EB1-dependent manner13. Indeed, a proteome-wide screen for SxIP-containing proteins has not only identified CLASPs, MACF1 and APC, but also several new +TIP proteins14, implying that EB1 interacts with multiple components and thereby contributes to many Mt-dependent functions.
Cell movement requires dynamic interactions of the actin and Mt networks with the extracellular matrix through focal adhesions (FAs)15. At the leading edge, integrin-dependent mechanisms promote the assembly of new FA structures, while FAs at the cell rear must be destabilized. CLASPs, MACF1/ACF7 and APC physically link actin and Mts at FAs, and promote cell migration by regulating FA dynamics and establishing directed Mt transport pathways16. The scaffolding component Paxillin was shown to function as a local Mt catastrophe factor at FA17, and its phosphorylation by the FA kinase (FAK) may regulate FA dynamics18. However, the mechanisms by which Mts dynamically interact with FA and promote FA-turnover remain poorly understood.
Protein ubiquitylation triggers both proteasome-dependent and -independent mechanisms that emerged as a wide-spread regulatory signal in cellular physiology including cell signalling, intracellular trafficking and mitosis19,20. Substrate ubiquitylation requires the coordinated action of three enzymes catalyzing ubiquitin activation (E1), ubiquitin conjugation (E2) and ubiquitin ligation (E3). Cullin-RING E3 ubiquitin ligases (CRLs) comprise the largest class of E3 enzymes, which primarily use the RING-H2 finger protein Rbx1 ubiquitin-charged E2 enzymes and catalyse ubiquitin transfer21. CRLs are activated by modification of the cullin subunit with the ubiquitin-like protein Nedd8, which is reversed by the action of the COP9/signalosome complex (CSN)22. Specificity is provided by binding of the Cullin scaffold to subfamily-specific adaptors, which in turn recruit substrates into the complex. For example, CRL3 assembles with Bric-a-brac/Tramtrak/Broad (BTB) proteins such as Keap1 to regulate stress signalling by targeting Nrf2 (refs 23, 24), or KLHL12, which promotes collagen secretion by ubiquitylating Sec31 (ref. 25). KLHL21 and KLHL22 have been shown to target Aurora B and PLK1, respectively, thereby regulating chromosome alignment at the metaphase-to-anaphase transition26,27. Finally, CRL3 recently emerged as a tumour driver and recurrent mutations in the BTB adaptor SPOP may define a new molecular subtype of prostate cancer28.
In this study, we identified a new function of CRL3KLHL21 as a regulator of cell motility by spatially and temporally regulating Mt dynamics at the cell cortex and at FAs. Nanoscale multi-coloured microscopy on fixed and live samples revealed that KLHL21 transiently localizes to Mt tips and accumulates at FAs, preferentially at the leading edge of migrating cells. CRL3KLHL21 binds and ubiquitylates EB1 predominantly on Lys100, which is located within the amino-terminal CH-domain known to interact with Mts. Functional analysis reveals cells expressing a non-ubiquitylatable EB1K100R mutant phenocopy CRL3KLHL21 depletion, and are defective for cell migration and FA dynamics. We propose that CRL3KLHL21 promotes FA dynamics and cell motility at least in part through ubiquitylation of EB1 at Mts reaching the cell cortex.
Results
The CRL3-adaptor protein KLHL21 controls cell migration
To investigate the function of CRL3KLHL21 in cytoskeletal regulation, we analysed migration of HeLa cells using a scratch assay. Interestingly, cells depleted for Cul3 or KLHL21 by RNAi were unable to fill the scratch (Fig. 1a; Supplementary Movie 1). To quantify this migration defect, we measured the scratch area during closure over a period of 10 h (Fig. 1a, right panel). In contrast to controls, cells depleted for Cul3 or KLHL21 by RNAi were highly immobile and exhibited cortex deformations resulting in elongated cell morphology (Supplementary Movie 1). This defect was not observed in cells depleted for KLHL22, which like KLHL21 exhibits delays in mitosis26,27.
To determine how CRL3KLHL21 promotes cell migration, we first examined the subcellular localization of KLHL21 in HeLa and U20S cells expressing functional GFP-tagged KLHL21 from the doxycycline (Dox)-inducible promoter at similar levels as endogenous KLHL21 (Supplementary Fig. 1A). We used a new enhanced total internal reflection (TIRF) microscopy called RING-TIRF that reduces limitations of an irregular illumination field and allows near simultaneous acquisition of multiple wavelengths in high-speed mode29. We localized GFP-KLHL21 and actin in living cells together on structures close (80–120 nm) to the Hela cell surface (Fig. 1b; Supplementary Movie 2). Moreover, we followed single cells expressing GFP-KLHL21 and RFP-Paxillin or stained for VASP, in which the latter two signals are known to mark FA structures (Fig. 1c,d; Supplementary Fig. 1B). Interestingly, GFP-KLHL21 accumulated at the cell periphery in small, immobile areas that co-localized with actin, Paxillin and VASP (Fig. 1b–d; Supplementary Fig. 1B; Supplementary Movie 2–4). These cortical GFP-KLHL21 patches disappeared upon disassembly of FA sites early in mitosis, but were re-established during cytokinesis (Supplementary Fig. 1C; Supplementary Movie 3). To follow the dynamics during cell migration, we performed RING-TIRF live cell imaging of motile HeLa cells co-expressing GFP-KLHL21 (green) and RFP-Paxillin (red). As shown in Fig. 1d (Supplementary Movie 4), KLHL21 and Paxillin co-localized at FAs at lamelipodia (white arrows, lower right kymograph) and remained throughout their disassembly (white arrows, upper right time series panels). Their dynamic behaviour at the leading edge of migrating cells was coordinated (lower right kymograph). These results suggest that KLHL21 localizes to dynamic FA structures in migrating cells.
In addition, GFP-KLHL21 also accumulated on centrosomes and was found in discrete ‘puncta’ at Mt tips (Fig. 2a; Supplementary Fig. 2A) and along Mt (Fig. 2a). Indeed, co-staining with the Mt-plus-end binding protein EB1 showed that GFP-KLHL21 accumulated at Mt tips in over 90% of Mts reaching the cortex in interphase (Supplementary Fig. 2A, over 150 EB1 comets). Accumulation of KLHL21 at Mt-plus ends required EB1, as GFP-KLHL21 staining at Mt tips was strongly diminished in HeLa cells depleted for EB1 but not in cells depleted for Cul3 (Supplementary Fig. 2B). Taken together, we conclude that KLHL21 accumulates at FA structures and interacts with stable Mts and Mt-plus ends in an EB1-dependent manner.
To investigate the molecular mechanism underlying the observed cell migration defect, we analysed Mt network stability in HeLa cells RNAi-depleted for Cul3 or KLHL21 by staining for acetylated tubulin as a measure of Mt stability (Supplementary Fig. 3A). Interestingly, in siCul3- and siKLHL21-treated cells the average Mt acetylation intensity was increased approximately fourfold compared with siRNAi controls, suggesting that the CRL3KLHL21 E3 ligase affects microtubule dynamics. To corroborate these results, we quantified EB1 dynamics of individual Mts reaching the cell cortex in U2OS cells stably expressing GFP-EB1 and plated on a defined fibronectin crossbow micro pattern (Cytoo) (Fig. 2b; Supplementary Movie 5). While in RNAi-control cells only few Mts were stabilized at the cortex and most EB1–cortex interactions lasted between 2 and 6 s, many Mt–cortex interactions were extended in cells depleted for KLHL21 (Fig. 2b, n=500 per condition, Supplementary Movie 6). Together, these data suggest that CRL3KLHL21 affects Mt dynamics and may specifically regulate the turnover of Mts reaching the cell cortex.
CRL3KLHL21 predominantly ubiquitylates lysine 100 of EB1
To investigate how CRL3KLHL21 E3 ligase regulates microtubule dynamics, we analysed the amounts of known Mt-regulators in HeLa cells RNAi depleted for Cul3 and KLHL21 (Supplementary Fig. 3B,C). Immunoblotting revealed that EB1 levels were slightly increased in the absence of Cul3 or KLHL21, in contrast to other Mt-binding proteins MAP4, CLASP2, p150Glued or EB3. Interestingly, KLHL21 also physically interacted with EB1, as shown by immunoprecipitating GFP-EB1 or GFP alone from HeLa cell extracts expressing HA-KLHL21. Indeed, HA-KLHL21 was present in GFP-EB1 precipitates, but absent in GFP or HA controls (Fig. 3a). Moreover, the Escherichia coli expressed GST-tagged KELCH domains of KLHL21, but not KLHL22, were able to bind purified EB1 in vitro (Supplementary Fig. 4A), although the affinity of this interaction appears very low. Overall, these data indicate that EB1 is able to bind KLHL21, implying that EB1 might be a direct ubiquitylation target of CRL3KLHL21. To test this possibility, we performed in vitro ubiquitylation reactions using recombinantly produced Cul3-N8/RBX1/KLHL21 (CRL3KLHL21) E3 ligase. Interestingly, CRL3KLHL21 was able to ubiquitylate a small fraction of EB1 in vitro in a KLHL21-dependent manner (Fig. 3b). Mass spectrometry analysis of EB1 ubiquitylation predominantly identified lysine 100 but also lysines K60, K66, K89, K112 and K122 as ubiquitin acceptor sites in vitro (Fig. 3c,f, red; Supplementary Table 1), and several of these lysine residues including K100 and K60, have been previously found to be ubiquitylated in vivo30. Mapping the ubiquitylated lysine residues onto the EB1–Mt structural model (adapted from Maurer et al.11 and Slep et al.31) revealed that K89 and K100 are located within the EB1 CH-domain (Fig. 3c,d), and K89 has been previously shown to be crucial for Mt binding32.
To identify the predominant lysine residue(s) on EB1 targeted by CRL3KLHL21, we purified different non-ubiquitylatable EB1 lysine to arginine mutants (K→R), and subjected them to in vitro ubiquitylation reactions. Interestingly, the EB1K100R mutant, in which only lysine K100 was mutated to the non-ubiquitylatable arginine, was a poor substrate in vitro compared with wild-type EB1 (Fig. 3e). Conversely, we produced an EB1 mutant in which only lysine K100 and/or K89 were unmodified, but all other lysines residues were mutated to non-ubiquitylatable arginine residues. In contrast to EB1K100only and EB1K89/K100only, ubiquitylation of the EB1K89only mutant was strongly reduced (Supplementary Fig. 4B), demonstrating that CRL3KLHL21 preferentially ubiquitylates lysine 100 located in the CH-domain of EB1. Importantly, in contrast to EB1K89R, EB1K100R displays a microtubule binding affinity that is comparable to wild-type EB1 as determined by microtubule co-pelleting assays in vitro (Supplementary Fig. 4D,E), confirming that mutating lysine 100 to an arginine residue preserves the overall Mt-binding activity of EB1. Like K89, K100 is conserved in fission and budding yeast, mouse, xenopus and humans (Supplementary Fig. 4C), and is located between the tubulin heterodimers when the CH-domain of EB1 binds to Mt ends (Fig. 3c,d). Consistent with this analysis, stabilized microtubule addition to the CRL3KLHL21 in vitro ubiquitylation reaction blocks EB1 ubiquitylation (Fig. 3f), implying that K100 is poorly accessible when bound to Mts and thus EB1 ubiquitylation on K100 is likely to interfere with its ability to bind Mt ends.
EB1 ubiquitylation may regulate cell migration
To determine whether CRL3KLHL21-dependent EB1 ubiquitylation on lysine 100 may regulate cell migration in vivo, we downregulated endogenous EB1 in HeLa cells stably expressing GFP-tagged wild-type or EB1K100R protein from the doxycycline promoter at levels similar to endogenous EB1 (Fig. 4a; Supplementary Fig. 5A). The half-life of EB1K100R was comparable to wild-type controls (Supplementary Fig. 5B), indicating that CRL3KLHL21-dependent EB1 ubiquitylation does not affect its stability. Similar to KLHL21 depletion, cells expressing the GFP-EB1K100R mutant were unable to migrate in our scratch assay, in contrast to GFP-EB1 wild-type controls (Fig. 4b,c; Supplementary Fig. 5D). Importantly, depletion of KLHL21 in GFP-EB1K100R cells did not further aggravate this defect, implying that KLHL21 depletion and ubiquitylation of EB1 on K100 are epistatic. The increased EB1 levels in KLHL21-depleted cells are not responsible for the observed migration defect, as depleting EB1 to endogenous levels did not restore cell migration of cells lacking KLHL21 (Supplementary Fig. 5C). Together, these results suggest that CRL3KLHL21-dependent ubiquitylation of EB1 on K100 controls cell migration.
To examine whether EB1 ubiquitylation alters motility and cortical morphology, we imaged HeLa cells stably expressing wild-type GFP-EB1 or the GFP-EB1K100R mutant at low magnification and tracked individual cells during 12 h. As GFP-EB1 and GFP-EB1K100R expression levels in stable HeLa cells were heterogeneous within individual clones, we only analysed cells with comparable integrated intensity (maximum ratio of 1 to 2 for GFP-EB1 to GFP-EB1K100R). As shown in Fig. 4c, the mobility of individual cells expressing EB1K100R was significantly reduced (Supplementary Movie 7). Moreover, the cortical plasticity of EB1K100R-expressing cells was greatly impaired and, in contrast to wild-type EB1 controls, almost no lamellipodia and cortical protrusions were detected (Fig. 4d; Supplementary Fig. 5D,E). As expected, a similar cell motility defect was observed in cells depleted for KLHL21 or CSN2, an essential subunit of the CSN complex (Supplementary Fig. 5E)22, confirming that CRL3KLHL21 activity is required for this process. Taken together, these data demonstrate that cells expressing a non-ubiquitylable EB1K100R mutant phenotypically mimic KLHL21 depletion with respect to cell migration and cortical dynamics, suggesting that CRL3KLHL21 may regulate EB1 at the cell cortex.
Cortical Mt and FA are altered in EB1K100R mutant
To determine the functional consequences of EB1 ubiquitylation, we quantified EB1 dynamics of individual Mts reaching the cell cortex in polarized U2OS cells stably expressing GFP-EB1 or GFP-EB1K100R as described in Fig. 2b. Interestingly, the number of stable GFP-EB1K100R-positive microtubules reaching the cell cortex were significantly increased compared with GFP-EB1 controls (Fig. 5a; Supplementary Movie 5 and 6). This effect was not further enhanced by simultaneous depletion of KLHL21, suggesting that CRL3KLHL21 may regulate turnover of cortical Mts by ubiquitylating EB1. To corroborate these results, we analysed Mt–actin crosstalk in cortical areas of polarized cells imaged by wide-field microscopy. Cell areas in contact with fibronectin spotted in a crossbow micro pattern (Cytoo) constitute lamellipodia where FA and stress fibres are frequent (Supplementary Fig. 6; Supplementary Movie 8). GFP-EB1 rapidly dissociated from Mt tips in over 60% of the Mt-contacted actin filaments, resulting in slower Mt growth (n=250). GFP-EB1K100R mutant protein remained bound in many cases and Mt growth continued (Fig. 5b; Supplementary Movie 8; Supplementary Fig. 6). As KLHL21 accumulates at FA structures, we also analysed the Mt dynamics at FA using RING-TIRF microscopy of HeLa cells expressing RFP-Paxillin and either GFP-EB1 or GFP-EB1K100R (Fig. 5c). Interestingly, this Mt sub-population showed behaviour at FA similar to that observed at actin filaments. While wild-type GFP-EB1 reaching FAs rapidly disassembled, Mts decorated by GFP-EB1K100R were able to cross FAs (insets). We next used RING-TIRF microscopy to compare the stability of FA structures visualized by RFP-paxillin in HeLa cells expressing either wild-type EB1 or the EB1K100R mutant. Strikingly, the assembly and disassembly of FA structures were strongly reduced in cells expressing EB1K100R (Fig. 5d), suggesting that EB1 dynamics and FA-turnover may be coupled. We thus propose that CRL3KLHL21-dependent ubiquitylation of EB1 is required for cell migration by regulating crosstalk between Mt–actin and Mt–FA assemblies.
CRL3KLHL21 alters EB1 dynamics at Mt reaching focal adhesions
To examine the dynamic relationship of KLHL21 and EB1 at FAs, we again used RING-TIRF microscopy to simultaneously image GFP-EB1 or GFP-EB1K100R in live cells transiently expressing mCherry-KLHL21 and stained with SIR-Actin dye. Three-colour nanoscale image sequences were acquired at 600 ms time intervals, and their time projections were analysed (Fig. 6a,b; Supplementary Movie 9–11). Although KLHL21 and EB1 co-localized in multiple Supplementary Movie frames (Supplementary Movie 10), KLHL21 did not behave like a plus-tip-tracking protein. Interestingly, mCherry-KLHL21 clustered around FA, but GFP-EB1 was absent from these clusters (Fig. 6a, enlarged pictures 1–4). In contrast, GFP-EB1K100R readily co-localized with mCherry-KLHL21 in these actin clusters (Fig. 6b, enlarged pictures 1–4). We quantified these data by plotting the mean EB1 intensity per KLHL21 area in cells expressing mCherry-tagged KLHL21 and either wild-type GFP-EB1 or the non-ubiquitylatable GFP-EB1K100R mutant (Fig. 6c). To substantiate this antagonistic behaviour at the cell cortex, we followed individual Mt tips marked by GFP-EB1 as they encounter a FA structure containing KLHL21. Strikingly, GFP-EB1 briefly co-localized with KLHL21, which in turn led to EB1 disappearance (Fig. 6d, white arrows on left panel, Supplementary Movie 9). Indeed, kymographs of GFP-EB1 trajectories confirmed that Mts rapidly pause or shrink after encountering KLHL21 at the cortex (Fig. 6d, left panel, white arrows). In some cases, we also observed de novo recruitment of KLHL21 to Mt–FA contact sites, subsequently leading to Mt pause or catastrophe (Fig. 6d, kymograph, yellow arrow, Supplementary Movie 10). In contrast, GFP-EB1K100R comets were not affected when crossing FA and KLHL21 patches (Fig. 6e, white arrows on kymograph, Supplementary Movie 11). Quantification confirmed that the persistence of individual Mt ends marked by GFP-EB1K100R at the cell cortex of KLHL21-containing FA was significantly longer compared with Mt ends marked with wild-type GFP-EB1 (Fig. 6f). We thus conclude that CRL3KLHL21 promotes cell motility by ubiquitylating EB1 at the cell cortex and FA structures, thereby triggering its removal from growing Mt ends and affecting FA and cortical dynamics.
Discussion
Here we show that the CRL3KLHL21 E3 ligase controls cell migration at least in part by regulating Mt and FA dynamics during interphase. This novel function adds to our previous finding of CRL3KLHL21 activity orchestrating chromosome alignment by regulating Aurora B during mitosis26. Indeed, KLHL21 localizes to FA structures at lamellipodia and destabilized FA where in complex with Cul3 it ubiquitylates EB1 at lysine 100 located within the microtubule binding CH-domain. Our data support the notion that CRL3KLHL21-dependent mono-ubiquitylation of EB1 dimers inhibits EB1–Mt interactions, thereby promoting microtubule disassembly at actin structures and FAs at the cell cortex of migrating cells.
Dynamic cortical Mts are required for cell migration2, possibly by providing directed vesicle transport to lamellipodia. In addition, Mts interact with FAs and are suggested to promote their turnover preferentially at the leading edge33,34,35. Mt growth to reach FA structures does not occur by a random search-and-capture mechanism, but rather is guided along F-actin stress fibres35,36,37. Individual Mts grow multiple times towards the same or different FA, when Mts then frequently pause and switch from growth to shortening34. The scaffolding FA component Paxillin regulates these growth-to-shortening transitions17, possibly by recruitment or local activation of a factor that terminates Mt growth. Interestingly, CRL3KLHL21 fulfils the criteria expected for such a Mt regulator and may alter Mt dynamics by increasing EB1 turnover specifically at cortical actin structures and FAs. Several lines of evidence support the notion that CRL3KLHL21 directly ubiquitylates EB1 in vivo. First, KLHL21 accumulates at FAs and transiently co-localizes with EB1 bound to tips of Mts reaching FA structures at the leading edge. Second, EB1 co-immunoprecipitates with KLHL21 in vivo and binds the KELCH domains of KLHL21 but not the structurally related CRL3-adaptor KLHL22 in vitro. Third, purified CRL3KLHL21 ubiquitylates EB1 in vitro preferentially on lysine 100, which is also found to be ubiquitylated in vivo. Finally, cells expressing the non-ubiquitylatable EB1K100R mutant share the striking cell migration and lamellapodia defects observed in KLHL21-depleted cells. We can neither rigorously exclude an EB1-independent function of KLHL21 in cell migration, nor that the EB1K100R mutant affects FA dynamics by a mechanism unlinked to its role in microtubule polymerization. It also remains possible that the lack of CRL3KLHL21 activity prevents proper Mt–FA interactions because an unknown disassembly factor is no longer able to reach FA structures under these conditions. Of course, CRL3KLHL21 may also target specific FA components in addition to EB1. However, since the cell migration and lamellapodia defects are not further enhanced upon KLHL21 depletion in EB1K100R-expressing cells, we conclude that the two proteins are likely to function in the same pathway and that EB1 is the main KLHL21 substrate in this process.
Available evidence suggests that EB1 at growing Mt tips is dynamic with turnover rates of less than one second7,38. It is therefore unclear why EB1 turnover should be regulated when Mts reach FA structures. Still, EB1 ubiquitylation is likely to directly interfere with its ability to bind Mt tips. Indeed, K100 is located in the EB1 CH-domain, which mediates the interaction with Mt-plus ends by recognizing the GTP cap11,39,40. Modelling lysine 100 on the EB1 bound to α-β tubulin heterodimers predicts a steric clash of ubiquitylated EB1 and Mts. Likewise, Mts addition inhibits CRL3KLHL21-mediated EB1 ubiquitylation in vitro. Additional steps might be required at the cell cortex to increase the accessibility of the K100 residue and allow its ubiquitylation by CRL3KLHL21 in vivo. It is conceivable that post-translational modifications of EB1 or other tip-binding proteins, or the mechanical force generated when Mts encounter actin filaments and/or cortical FA structures is sufficient to distort Mt tips. Alternatively, CRL3KLHL21 may target-free EB1 dimers to prevent their rebinding and rescue of Mt growth at the cell cortex. It is unlikely that the slightly increased EB1 levels upon CRL3KLHL21 depletion explain the cortical Mt-defects, and elevated EB1 levels may rather be an indirect consequence of altered microtubule dynamics. Interestingly, loss of CRL3KLHL21 activity also increases tubulin acetylation in vivo, which correlates with increased microtubule stability. Increased tubulin acetylation could be caused indirectly by the increased stability of cortical Mts in KLHL21-depleted cells, for example by allowing more time for the acetylation machinery to modify the Mt network. It is also possible that KLHL21 promotes tubulin de-acetylation by an unknown mechanism.
Irrespective of the molecular mechanism controlling cortical Mt dynamics and FA disassembly, it would be interesting to understand how KLHL21 localizes to FA structures preferentially at the leading edge of migrating cells. KLHL21 may be recruited to FA structures by interacting with proteins such as Paxillin, APC, the spectraplakin MACF1/ACF7 or CLASPs, which are all required for directed cell migration. Similar to KLHL21, these proteins localize to FA structures by transiently interacting with EB1 (refs 12, 41). Interestingly, they were implicated in Mt organization and/or stabilization near the leading edge of migrating cells, and CRL3KLHL21 could thus stabilize Mt–actin interactions at FA by releasing EB1-associated proteins such as ACF7 or CLASP, which function as Mt–actin crosslinking proteins. Clearly, further work is required to investigate the functional relationship of KLHL21 and these FA factors to understand how they orchestrate Mt and FA dynamics at lamellipodia during cell migration.
Methods
Molecular biology and biochemistry
Protein purification is detailed in Supplementary Information. For the in vitro ubiquitylation assays (Fig. 3b,e,f; Supplementary Fig. 4B), 0.5 μM Cul3-Nedd8/Rbx1 was mixed with 0.5 μM KLHL21, 0.5 μM EB1 variants and 1 μM E2 (UbcH5b), 0.1 μM ubiquitin E1 (Boston Biochem) and 50 μM ubiquitin (Boston Biochem) in 40 mM Tris/HCl, pH 7.6, 10 mM MgCl2, 1 mM ATP and 1 mM DTT, and incubated at 37 °C for 30 min. Reactions were quenched by boiling at 95 °C with LDS-buffer for 5 min and analysed by western blotting.
The Mt co-sedimentation assays were performed as described previously42. Purified EB1 was pre-cleared via ultracentrifugation in a TLA-100 rotor for 10 min at 120,000g and added at a final concentration of 0.5 μM to variable amounts of taxol-stabilized Mts (Cytoskeleton) in BRB80 buffer (80 mM Pipes pH 6.8, 1 mM MgCl2 and 1 mM EGTA). The salt concentration was adjusted in each reaction to 150 mM NaCl final concentration, and incubated for 15 min at room temperature. Subsequently, the supernatant and pellet fractions were separated by ultracentrifugation at 120,000g for 20 min at 25 °C, analysed by SDS–PAGE and quantified using ImageJ.
HeLa cell extracts were prepared as described43, and HA-tagged KLHL21 immunoprecipitated using anti-HA M2-agarose beads (Sigma). GFP-fused proteins were immunoprecipitated using GFP-Trap agarose beads (Chromotek). Beads were incubated with cell extracts for 2 h at 4 °C under constant rotation. Before elution, beads were washed five times with TBS-T. Tryptic digestion and mass spectrometry analysis was performed as described in detail in the Supplementary Information.
Cell culture, immunofluorescence and antibodies
HeLa and U2OS cell lines were grown in a humidified incubator at 37 °C and 5% CO2 in Dulbecco’s modified Eagle medium (Gibco, Invitrogen, Carlsbad, USA) supplemented with 10% fetal calf serum (PAA Laboratories) and 1% penicillin/streptomycin (Gibco). Stable cell lines expressing GFP-EB1, GFP-EB1K100R or GFP- or RFP-tagged KLHL21 were created using HeLa-FRT/TO or U20S FRT/TO host cell lines. Antibiotics for selection were used as follows: hygromycin (Invitrogen) 100 μg ml−1, blasticidin (Invitrogen) 15 μg/ml and puromycin (Sigma Aldrich) 0.5 μg ml−1. Protein expression was induced by the addition of doxycycline (Sigma) at 0.1 or 1 μg ml−1. HeLa cells stably expressing GFP-EB1 or GFP-EB1K100R were transfected with a plasmid expressing RFP-KLHL21 for 24 h.
siRNA transfections were performed using lipofectamine RNAi Max (Invitrogen) at 100 nM final concentration. The following siRNA oligonucleotides (Microsynth) were used: non-silencing control: 5′- UUCUCCGAACGUGUCACGU -3′; Cul3: 5′- AAC AAC UUU CUU CAA ACG CUA -3′); CSN2: 5′- AAG CGG CAU UAA GCA GUU UCC -3′; EB1: Abnova (ref: H00022919-R01), siRNA against KLHL21 and KLHL22 have been described previously26,27. siRNA transfection were performed for at least 48 h and up to 72 h.
To measure cell mobility by scratch assay, HeLa stably expressing GFP-EB1 or GFP-EB1K100R were grown to confluency in 6-well plates, treated with siRNA (day 0) and imaged directly using a dry 20 × magnification objective. Scratches were performed with a tip burned Pasteur pipette. To measure cell motility of single cells, they were plated at low density (day 1) and imaged (day 1 and 2), quantified using the Manual tracker plugin from ImageJ and plotted using Igor software (Wavemetrics).
For immunofluorescence analysis, cells were grown on high precision cover slips (Zeiss), fixed with −20 °C methanol for ∼8 min, blocked for 30 min in PBS+FCS (5%), incubated for 1 h with primary antibody and then washed three times with PBS+0.05% Tween. Bound antibodies were detected by fluorescently labelled secondary antibodies that were incubated for one hour, washed three times with PBS+0.05% Tween, and mounted with Vectashield H-1000. Cell lines expressing GFP-tagged proteins were treated with GFP booster (Chromotek) as a secondary antibody (1:300). Actin was stained over night with SIR-actin dye (Spirochrome) following instructions by the manufacturer.
The following antibodies (with supplier and used dilution) were used in this study: mouse acetylated tubulin (Abcam ab24610, 1:1,000), mouse EB1 (BD biosciences 610534, 1:5,000), rabbit alpha tubulin (Abcam ab11270, 1:10,000), rabbit KLHL22 (ref. 27), rabbit KLHL21 (ref. 26; 1:200), mouse Aurora B (BD Biosciences 61108/3, 1:1,000), rat Clasp2 (Absea 032006E03, 1:2,000), mouse EB3 (BD bioscience 612156, 1:1,000), mouse p150 glued (BD science 610474, 1:2,000), mouse GFP (Roche 11 814460 001, 1:10,000), rabbit Paxillin (Abcam ab32084, 1:1,000), rabbit VASP (Protein Tech 13472-1-AP, 1:1,000), and rabbit MAP4 (Abcam ab89650, 1:500).
Full blots of Fig. 3b,e,f are provided in Supplementary Fig. 7.
Microscopy
For live cell microscopy, cells were imaged using L-15 Lebovitz media with 10% FCS in labtek chambers, or plated on large crossbow micro patterns from Cytoo (ref. 10-006-10-18). Images were acquired on fully automated inverted epi-fluorescence microscopes (Ti-Eclipse, Nikon) in an incubation chamber set to 37 °C, with 100 × oil objectives and appropriate excitation and emission filters. A motorized XY-stage and piezo drive was used to acquire z-stacks and multiple fields of view per time point. Cells grown on micro patterns were analysed in a modified Cytoo chamber (ref. 30-011) that fits into a homemade high precision multi holder for the Nikon Ti-Eclipse microscope.
All super resolution images were acquired on a OMX V4 at a laser intensity as low as possible (<33%) and exposure times between 5 and 200 ms. Images acquired with the TIRF unit were taken in sequential mode to avoid wavelength crosstalk. Exposure time and laser intensity were set to minimize photobleaching and phototoxicity.
Image analysis
Motility quantification is performed by measuring empty area at each time point and divided by the initial empty area (a.u.). Fifteen different scratches per condition have been performed and those experiments have been reproduced three times. Error bars in the graphic’s represent standard deviation between experiments (Figs 1a and 3c; Supplementary Fig. 5C).
To quantify EB1–cortex interactions, U2OS cells stably expressing GFP-EB1 or GFP-EB1K100R were siRNA-treated in 6-well plates (day 0) and incubated with doxycycline (1 μg ml−1) for 24 h. Cells were trypsinized, plated on fibronectin-coated crossbow micro patterns (Cytoo) and then imaged every 500 ms (three z-stack of 0.435 μm step, Supplementary Movie 2, 3 and 9). Cells were carefully compared for their EB1 or EB1K100R expression levels, and cells with integrated intensity higher than twofold than the mean integrated intensity were excluded. Stack images were deconvolved using Huygens remote software with the same settings for all conditions. EB1 retention time at the cell cortex was quantified using a line scan on the front edge, and analysed by the Image J ‘Multiple kymograph’ plugin with 5 pixels line width. Vertical lines were counted as Mt–cortex interaction and the line size in pixel shows the duration of the interaction. Oblique lines were counted as sliding Mts. 500 events in at least 10 cells were analysed per condition. A t-test on the mean was performed using IGOR software (Wavemetrics).
Single cell motility experiment (Fig. 4d; Supplementary Fig. 5D,E) was performed using Image J Manual Tracker plugin and velocity was corrected for any microscope shift. Each cell velocity was averaged per movie. One hundred and fifty cells per condition were collected.
Mean EB1 intensity per KLHL21 zone (Fig. 6c) were quantified as followed; time projections of KLHL21-RFP (red), SIR-Actin (blue) and GFP-EB1 were collected, the KLHL21 patch zones defined as shown in Fig. 6a and the EB1 mean intensity in this zone was then measured. A control zone (no KLHL21 and no EB1 signal) was also determined and EB1 mean intensity in the control zone was deducted from the EB1 mean intensity in the KLHL21 zone. Thirty-five patch zones per condition were collected and presented as box plot. A t-test on the mean was performed using IGOR software (Wavemetrics).
Focal adhesion dynamics (Fig. 5d) was measured in HeLa cell stably expressing either GFP-EB1 or GFP-EB1K100R and transfected a plasmid encoding Paxillin-RFP. Cell were imaged using RING-TIRF microscopy, and the speed of FA assembly and disassembly was calculated using kymographs. More than 20 cells per condition and at least 10 dynamic FA’s per cell were collected (n>150 FA per condition). Box plot and t-test on the mean have been performed using IGOR pro software (Wavemetrics).
Acetylated tubulin was determined using immunofluorescent staining with specific antibodies. Signal intensity was quantified for at least 30 cells per condition in three independent experiments and plotted as the average per cell with standard deviation calculated from the mean.
For all experiments, cells were chosen blindly, without any exclusion criteria. Every experiment was reproduced at least three times, except for Fig. 5d, where cells were collected from two independent experiments and mixed to obtain a single cell pool per condition. All t-test on the mean data (Figs 4d and 5f) meet the stringent assumptions of the test.
Stable cell lines
Standard protocols were used for DNA and RNA manipulations. EB1 mutants were generated with Pfu Turbo DNA polymerase (Stratagene), using the primers 5′- TTAGTAAAAGGAAGGTTTCAGGACAAT -3′ and 5′- ATTGTCCTGAAACCTTCCTTTTACTAA -3′, and verified by sequencing.
The DNA sequence was introduced in a pcdna5 vector and transfected in HeLa or U2OS FRT/TO host cell lines. Clone selection was performed first by Western blot, and clones expressing more than two times compared with endogenous protein were rejected. Selected clones were then screened with a fluorescent microscope to exclude clones showing high heterogeneity in GFP (or RFP)-tagged protein levels.
Data availability
The data that support the findings of this study are available from the corresponding author upon request.
Additional information
How to cite this article: Courtheoux, T. et al. Cortical dynamics during cell motility are regulated by CRL3KLHL21 E3 ubiquitin ligase. Nat. Commun. 7:12810 doi: 10.1038/ncomms12810 (2016).
Change history
31 October 2016
A correction has been published and is appended to both the HTML and PDF versions of this paper. The error has not been fixed in the paper.
References
Akhshi, T. K., Wernike, D. & Piekny, A. Microtubules and actin crosstalk in cell migration and division. Cytoskeleton (Hoboken) 71, 1–23 (2014).
Vasiliev, J. M. et al. Effect of colcemid on the locomotory behaviour of fibroblasts. J. Embryol. Exp. Morphol. 24, 625–640 (1970).
Mitchison, T. & Kirschner, M. Dynamic instability of microtubule growth. Nature 312, 237–242 (1984).
Wloga, D. & Gaertig, J. Post-translational modifications of microtubules. J. Cell Sci. 123, 3447–3455 (2010).
Jiang, K. & Akhmanova, A. S. Microtubule tip-interacting proteins: a view from both ends. Curr. Opin. Cell Biol. 23, 94–101 (2011).
Sandblad, L. et al. The Schizosaccharomyces pombe EB1 homolog Mal3p binds and stabilizes the microtubule lattice seam. Cell 127, 1415–1424 (2006).
Bieling, P. et al. Reconstitution of a microtubule plus-end tracking system in vitro. Nature 450, 1100–1105 (2007).
Bieling, P. et al. CLIP-170 tracks growing microtubule ends by dynamically recognizing composite EB1/tubulin-binding sites. J. Cell Biol. 183, 1223–1233 (2008).
Vitre, B. et al. EB1 regulates microtubule dynamics and tubulin sheet closure in vitro. Nat. Cell Biol. 10, 415–421 (2008).
Dixit, R. et al. Microtubule plus-end tracking by CLIP-170 requires EB1. Proc. Natl Acad. Sci. USA 106, 492–497 (2009).
Maurer, S. P., Fourniol, F. J., Bohner, G., Moores, C. A. & Surrey, T. EBs recognize a nucleotide-dependent structural cap at growing microtubule ends. Cell 149, 371–382 (2012).
Akhmanova, A. S. & Steinmetz, M. O. Tracking the ends: a dynamic protein network controls the fate of microtubule tips. Nat. Rev. Mol. Cell Biol. 9, 309–322 (2008).
Honnappa, S. et al. An EB1-binding motif acts as a microtubule tip localization signal. Cell 138, 366–376 (2009).
Jiang, K. et al. A proteome-wide screen for mammalian SxIP motif-containing microtubule plus-end tracking proteins. Curr. Biol. 22, 1800–1807 (2012).
Wolfenson, H., Henis, Y. I., Geiger, B. & Bershadsky, A. D. The heel and toe of the cell's foot: a multifaceted approach for understanding the structure and dynamics of focal adhesions. Cell Motil. Cytoskeleton 66, 1017–1029 (2009).
Stehbens, S. & Wittmann, T. Targeting and transport: how microtubules control focal adhesion dynamics. J. Cell Biol. 198, 481–489 (2012).
Efimov, A. et al. Paxillin-dependent stimulation of microtubule catastrophes at focal adhesion sites. J. Cell Sci. 121, 196–204 (2008).
Palazzo, A. F., Eng, C. H., Schlaepfer, D. D., Marcantonio, E. E. & Gundersen, G. G. Localized stabilization of microtubules by integrin- and FAK-facilitated Rho signaling. Science 303, 836–839 (2004).
Hershko, A. The ubiquitin system for protein degradation and some of its roles in the control of the cell division cycle. Cell Death Differ. 12, 1191–1197 (2005).
Li, W. & Ye, Y. Polyubiquitin chains: functions, structures, and mechanisms. Cell Mol. Life Sci. 65, 2397–2406 (2008).
Lydeard, J. R., Schulman, B. A. & Harper, J. W. Building and remodelling Cullin-RING E3 ubiquitin ligases. EMBO Rep. 14, 1050–1061 (2013).
Enchev, R. I., Schulman, B. A. & Peter, M. Protein neddylation: beyond cullin-RING ligases. Nat. Rev. Mol. Cell Biol. 16, 30–44 (2015).
Kobayashi, A. et al. Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol. Cell Biol. 24, 7130–7139 (2004).
Cullinan, S. B., Gordan, J. D., Jin, J., Harper, J. W. & Diehl, J. A. The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3-based E3 ligase: oxidative stress sensing by a Cul3-Keap1 ligase. Mol. Cell Biol. 24, 8477–8486 (2004).
Jin, L. et al. Ubiquitin-dependent regulation of COPII coat size and function. Nature 482, 495–500 (2012).
Maerki, S. et al. The Cul3-KLHL21 E3 ubiquitin ligase targets aurora B to midzone microtubules in anaphase and is required for cytokinesis. J. Cell Biol. 187, 791–800 (2009).
Beck, J. et al. Ubiquitylation-dependent localization of PLK1 in mitosis. Nat. Cell Biol. 15, 430–439 (2013).
Gao, D. et al. Organoid cultures derived from patients with advanced prostate cancer. Cell 159, 176–187 (2014).
Ellefsen, K. L., Dynes, J. L. & Parker, I. Spinning-spot shadowless TIRF microscopy. PLoS ONE 10, e0136055 (2015).
Wagner, S. A. et al. A proteome-wide, quantitative survey of in vivo ubiquitylation sites reveals widespread regulatory roles. Mol. Cell Proteomics 10, M111.013284–M111.013284 (2011).
Slep, K. C. et al. Structural determinants for EB1-mediated recruitment of APC and spectraplakins to the microtubule plus end. J. Cell Biol. 168, 587–598 (2005).
Hayashi, I. Crystal structure of the amino-terminal microtubule-binding domain of end-binding protein 1 (EB1). J. Biol. Chem. 278, 36430–36434 (2003).
Rinnerthaler, G., Geiger, B. & Small, J. V. Contact formation during fibroblast locomotion: involvement of membrane ruffles and microtubules. J. Cell Biol. 106, 747–760 (1988).
Kaverina, I., Rottner, K. & Small, J. V. Targeting, capture, and stabilization of microtubules at early focal adhesions. J. Cell Biol. 142, 181–190 (1998).
Krylyshkina, O. et al. Nanometer targeting of microtubules to focal adhesions. J. Cell Biol. 161, 853–859 (2003).
Kodama, A., Karakesisoglou, I., Wong, E., Vaezi, A. & Fuchs, E. ACF7: an essential integrator of microtubule dynamics. Cell 115, 343–354 (2003).
Small, J. V. & Kaverina, I. Microtubules meet substrate adhesions to arrange cell polarity. Curr. Opin. Cell Biol. 15, 40–47 (2003).
Dragestein, K. A. et al. Dynamic behavior of GFP-CLIP-170 reveals fast protein turnover on microtubule plus ends. J. Cell Biol. 180, 729–737 (2008).
Zanic, M., Stear, J. H., Hyman, A. A. & Howard, J. EB1 recognizes the nucleotide state of tubulin in the microtubule lattice. PLoS ONE 4, e7585 (2009).
Maurer, S. P., Bieling, Cope, J., Hoenger, A. & Surrey, T. GTPγS microtubules mimic the growing microtubule end structure recognized by end-binding proteins (EBs). Proc. Natl Acad. Sci. USA 108, 3988 (2011).
Kumar, P. & Wittmann, T. +TIPs: SxIPping along microtubule ends. Trends Cell Biol. 22, 418–428 (2012).
Lampert, F., Hornung, P. & Westermann, S. The Dam1 complex confers microtubule plus end-tracking activity to the Ndc80 kinetochore complex. J. Cell Biol. 189, 641–649 (2010).
Sumara, I. et al. A Cul3-based E3 ligase removes Aurora B from mitotic chromosomes, regulating mitotic progression and completion of cytokinesis in human cells. Dev. Cell 12, 887–900 (2007).
Acknowledgements
We thank M.O. Steinmetz (Paul Scherrer Institute, CH) for sharing EB1 constructs, S. Taylor (Faculty of Life Sciences, Manchester UK) and R. Aebersold (ETH Zürich, CH) for providing the HeLa FRT/TO and U2OS FRT/TO cell lines, T. Schwarz and the ETH ScopeM microscopy facility for technical support, A. Schreiber for help with cloning, and A. Ragheb and A. Bernini for help with protein production. We are grateful to A. Smith, B. Kornmann, S. Tournier and Y. Gachet for critical reading of the manuscript, and members of the Peter laboratory for helpful discussions. T.C. and R.I.E. were supported by ETH Pioneer fellowships, and RIE by a Marie-Curie fellowship. Work in the Peter laboratory is funded by ETHZ, an ERC senior award and a research grant from the SNF.
Author information
Authors and Affiliations
Contributions
T.C., R.I.E., F.L., J.G. and I.S. performed experiments, and T.C., R.I.E., F.L., J.G., I.S. and M.P. participated in experimental design and data analysis. T.C. and M.P. wrote the paper with critical contributions from all authors.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Supplementary information
Supplementary Information
Supplementary Figures 1-7, Supplementary Table 1, Supplementary Methods, (PDF 1464 kb)
Supplementary Movie 1
Confluent HeLa cells treated with the indicated siRNA oligos after scratching at time 0. (AVI 9579 kb)
Supplementary Movie 2
HeLa cells stably expressing GFP-KLHL21 and stained with SIR-Actin dye. The cell cortex was imaged by RING TIRF microscopy. (AVI 6321 kb)
Supplementary Movie 3
HeLa cells stably expressing GFP-KLHL21 and transiently expressing RFP-Paxillin. The cell cortex was imaged by RING TIRF microscopy (AVI 7650 kb)
Supplementary Movie 4
GFP-KLHL21 and Paxillin at cell cortex-Mobile cell. HeLa cells stably expressing GFP-KLHL21 and transiently expressing RFP-Paxillin. The cell cortex was imaged by RING TIRF microscopy during the cell cycle. (AVI 5193 kb)
Supplementary Movie 5
Mt dynamic on crossbow micro-pattern. U2OS cells siRNA-depleted for endogenous EB1 but expressing either GFP-EB1 or GFP-EB1K100R were plated on fibronectin-coated crossbow micro patterns (Cytoo{copyright, serif}). The cells were treated with either control (siCTRL) or siRNA-oligos targeting KLHL21 (siKLHL21) and imaged by wide field microscopy. (AVI 11099 kb)
Supplementary Movie 6
Cortex enlarged-Mt dynamic on crossbow micro-pattern. Enlarged zone from movie 5. (AVI 4788 kb)
Supplementary Movie 7
Single cell motility. HeLa cells stably expressing GFP-EB1 or GFP-EB1K100R and treated with siRNA as indicated. Cortical dynamics were imaged for several hours. (AVI 3534 kb)
Supplementary Movie 8
GFP-EB1 or GFP-EB1K100R and actin dynamics. U2OS cells expressing GFP-EB1 or GFP-EB1K100R (green) were plated on fibronectin-coated crossbow micro patterns (Cytoo{copyright, serif}) and stained with SIR-Actin dye (red). (AVI 5653 kb)
Supplementary Movie 9
GFP-EB1, RFP-KLHL21 and actin dynamics at cell cortex. HeLa cells stably expressing GFP-EB1 (green) and transiently expressing RFP-KLHL21 (red) were stained with SIR-Actin dye (blue). The cell cortex was imaged by RING TIRF microscopy. (AVI 4583 kb)
Supplementary Movie 10
Enlarged zone from movie 9. Inset of an EB1 comet reaching a KLHL21 spot at an actin fibber from movie 9. (AVI 62 kb)
Supplementary Movie 11
GFP-EB1, RFP-KLHL21 and actin dynamics at cell cortex. HeLa cells stably expressing GFP-EB1K100R (green) and transiently expressing RFP-KLHL21 (red) were stained with SIR-Actin dye (blue). The cell cortex was imaged by RING TIRF microscopy. (AVI 5646 kb)
Rights and permissions
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
About this article
Cite this article
Courtheoux, T., Enchev, R., Lampert, F. et al. Cortical dynamics during cell motility are regulated by CRL3KLHL21 E3 ubiquitin ligase. Nat Commun 7, 12810 (2016). https://doi.org/10.1038/ncomms12810
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/ncomms12810
This article is cited by
-
Altered pathways and targeted therapy in double hit lymphoma
Journal of Hematology & Oncology (2022)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.