Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

NRMT is an α-N-methyltransferase that methylates RCC1 and retinoblastoma protein

This article has been updated

Abstract

The post-translational methylation of α-amino groups was first discovered over 30 years ago on the bacterial ribosomal proteins L16 and L33 (refs 1, 2), but almost nothing is known about the function or enzymology of this modification. Several other bacterial and eukaryotic proteins have since been shown to be α-N-methylated3,4,5,6,7,8,9,10. However, the Ran guanine nucleotide-exchange factor, RCC1, is the only protein for which any biological function of α-N-methylation has been identified3,11. Methylation-defective mutants of RCC1 have reduced affinity for DNA and cause mitotic defects3,11, but further characterization of this modification has been hindered by ignorance of the responsible methyltransferase. All fungal and animal N-terminally methylated proteins contain a unique N-terminal motif, Met-(Ala/Pro/Ser)-Pro-Lys, indicating that they may be targets of the same, unknown enzyme3,12. The initiating Met is cleaved, and the exposed α-amino group is mono-, di- or trimethylated. Here we report the discovery of the first α-N-methyltransferase, which we named N-terminal RCC1 methyltransferase (NRMT). Substrate docking and mutational analysis of RCC1 defined the NRMT recognition sequence and enabled the identification of numerous new methylation targets, including SET (also known as TAF-I or PHAPII) and the retinoblastoma protein, RB. Knockdown of NRMT recapitulates the multi-spindle phenotype seen with methylation-defective RCC1 mutants3, demonstrating the importance of α-N-methylation for normal bipolar spindle formation and chromosome segregation.

Main

To purify the RCC1 N-terminal methyltransferase, soluble HeLa nuclear extract was fractionated over hydroxyapatite13,14,15 (Fig. 1a). Step-elutions were performed with increasing sodium phosphate. Fractions were assayed for activity by immunoblotting methyltransferase assays with anti-me2-SPK (Ser-Pro-Lys) or by enzyme-linked immunosorbent assay (ELISA) assay (Supplementary Fig. 3a). RCC1 methylation activity eluted in the 40–60 mM fractions (Fig. 1b). The 40 mM fraction was analysed by mass spectrometry (MS). Among peptides for >100 genes, two were detected and manually confirmed for an uncharacterized methyltransferase, METTL11a (also known as C9orf32 or Ad-003) (ref. 16; Gene ID: 28989). METTL11a (now renamed NRMT) encodes a 25 kDa protein in the methyltransferase 11 family, most members of which methylate metabolites or other small molecules. NRMT lacks a SET domain but possesses a Rossman-like α/β fold. According to GeneNote and Oncomine, it is ubiquitously expressed in normal tissue and robustly overexpressed in gastrointestinal cancers. It has been conserved throughout eukaryotic evolution (Supplementary Fig. 1), but next to nothing is known about the function of NRMT orthologues in any model organism.

Figure 1: Mettl11a is the α-N-RCC1 methyltransferase (NRMT).
figure1

a, Purification scheme for RCC1 N-terminal methyltransferase. b, In vitro methylation assay (NE, nuclear extract; D, dialysed nuclear extract; FT, flow through, W, wash) showing activity elutes in the 40 and 60 mM NaP fractions. c, ELISA assay showing NRMT overexpression increases RCC1 α-N methylation. Data were analysed by two-tailed independent t tests. n = 3–5 independent reactions per condition. Error bars represent ± 1 s.d. d, Lentiviral knockdown of NRMT in 293LT cells significantly decreases NRMT (arrowhead), di- and trimethylated RCC1, and levels of another methylated protein, later shown to be SET(*), as compared to control cells. β-catenin was the loading control. e, Expression of murine NRMT–Flag rescues RCC1 methylation levels in NRMT knockdown (KD) cells. f, In vitro methylation assays showing that immunoprecipitated Flag–NRMT methylates RCC1–His6 (1, IP input; 2, substrate only; 3, Flag–NRMT elution; 4, Flag–NRMT elution without substrate; 5, control IP elution). g, His6–NRMT di- and trimethylates SPK-RCC1–His6 and dimethylates PPK-RCC1–His6. h, Immunofluorescence of endogenous NRMT in HeLa cells with or without NRMT siRNA.

PowerPoint slide

To determine whether NRMT is the authentic RCC1 α-N-methyltransferase, we overexpressed it in HEK 293LT cells and tested nuclear extracts for RCC1 methylation activity by ELISA. Overexpression of NRMT increased α-N-methylation threefold as compared to a pK–YFP (yellow fluorescent protein)-transfected control (Fig. 1c). Similar results were obtained using N-terminally tagged Flag–NRMT (Fig. 1c). Flag–NRMT immunoprecipitated from 293LT cells and eluted with Flag peptide also methylated recombinant RCC1–His6 in vitro (Fig. 1f). The methylation was verified to be on the N-terminal Ser by Fourier transform mass spectrometry (FTMS) (Supplementary Fig. 2a). This method was used because standard approaches cannot readily distinguish between trimethylation and acetylation. Depleting NRMT in 293LT cells, using lentivirus, significantly decreased methylation of endogenous RCC1, while not affecting overall RCC1 level (Fig. 1d). Similar results were obtained by depleting NRMT in HeLa cells using short interfering RNAs (siRNAs) (Supplementary Fig. 3b). Rabbit polyclonal antibodies generated against a unique C-terminal NRMT peptide confirmed effective knockdown of NRMT levels by the lentivirus and siRNAs (Fig. 1d and Supplementary Fig. 3b). Control virus had no effect as compared to untransfected 293LT cells (Supplementary Fig. 3c). Importantly, RCC1 methylation was rescued by expression of murine NRMT–Flag, which is not targeted by the human short hairpin RNA (shRNA; Fig. 1e), confirming that off-target effects of the RNA interference were not responsible for the loss of methylation. Together, these data conclusively prove that NRMT is the predominant α-N-methyltransferase for RCC1.

Rabbit polyclonal antibody (anti-me2-PPK (Pro-Pro-Lys)) against a methylated peptide corresponding to mouse RCC1 also detected methylation by NRMT of RCC1 possessing a Pro 2 residue (Fig. 1g). This Pro 2 residue is present in all mammalian species except humans and chimpanzees. RCC1 methylation activity was originally found in the nuclear extract of HeLa cells3 and immunofluorescence of endogenous NRMT, or imaging of a NRMT–GFP (green fluorescent protein) fusion protein, showed that the enzyme is predominantly nuclear (Fig. 1h and Supplementary Figs. 3d, e). siRNA against NRMT abolished the nuclear staining, confirming this localization pattern (Fig. 1h). Together, these data prove that NRMT is the authentic α-N-RCC1 methyltransferase and that it can recognize variants of the consensus sequence from different species.

The crystal structure of NRMT in complex with S-adenosylhomocysteine (SAH) was solved to 1.75 Å resolution by the Structural Genomics Consortium (PDB entry 2EX4). A large cavity opposite the SAH binding site could accommodate N-terminal peptides (Fig. 2a) and contains an arrangement of aromatic residues similar to those in chromodomains. We used ICM-PRO (Internal Coordinate Mechanics Professional) software to model an RCC1 N-terminal peptide (Ser-Pro-Lys-Arg-Ile-Ala) in the putative active site (Fig. 2a). In this model, only the first three residues (Ser-Pro-Lys) interact with NRMT. The optimum conformation positions the substrate α-NH2 close to the SAH, in the correct orientation for methyl transfer, within 3.6 Å of the sulphur atom. The peptide Lys 4 side chain forms hydrogen bonds and electrostatic interactions with acidic residues at the lip of the active site. A stabilizing effect on Lys 4 results mainly from Asp 178 and Asp 181 (2.9 Å, and 3.4 Å from the ε-NH2, respectively) plus a weaker effect of Ser 183 (Fig. 2b). A similar structural motif was reported previously to coordinate lysine residues17. Other peptides, with Pro 2 or Ala 2, adopt the same conformation (data not shown); however, substitution of Lys 4 by Gln prevented interactions with the basic residues at the lip of the active site (Fig. 2c).

Figure 2: Substrate recognition motif of NRMT.
figure2

a, NRMT structure with distribution of electrostatic potential. Electrostatic potential was calculated using APBS Tools plug-in23 with default settings, visualized with PyMol program (DeLano Scientific LLC) and coloured from red (−1 kT) to blue (+1 kT). SPK-RCC1 hexapeptide (SPKRIA) is modelled into the active site. b, Schematic view of the interactions between the RCC1 substrate peptide (light blue) and the conserved residues of NRMT. Interactions between Lys 4 of the RCC1 peptide and Asp 178, Asp 181 and Ser 183 of NRMT are shown. All distances are in Å. c, Modelling of RCC1 mutant hexapeptide (yellow), in which Lys 4 was replaced by Gln, into NRMT active site. d, Mutational analysis of NRMT residues predicted to be involved in SPK-RCC1 recognition. e, The affinity of the enzyme was measured using isothermal titration calorimetry. Wild-type 12-residue RCC1 N-terminal peptide showed exothermic binding to NRMT (ΔH = −9.8 kcal mol−1) with a Kd = 70 μM (left panel). A mutant peptide in which Gln replaced Lys 4 showed no detectable binding (right panel).

PowerPoint slide

To test the requirement for Lys 4 in substrate binding to NRMT, we measured its affinity, by isothermal titration calorimetry, for wild-type RCC1 N-terminal peptide and a mutant peptide in which Gln replaced Lys 4. Wild-type peptide showed exothermic binding to NRMT (ΔH = −9.8 kcal mol−1, Kd = 70 μM), whereas RCC1(Gln 4) did not bind detectably (Fig. 2e). Lys 4 is, therefore, an essential determinant of NRMT substrate specificity. In vitro methylation assays confirmed that only the wild-type peptide can be methylated by recombinant NRMT (Supplementary Fig. 3f). A second key interaction involves H-bonding between the Pro 3 carbonyl and the Asn 169 amido group (Fig. 2b). NRMT(Lys 169) had no activity (Fig. 2d), whereas mutation of Asp 168, which does not interact with the peptide substrate, had no effect on methylation (Fig. 2d). Mutating residues (Asp 178, Asp 181) at the lip of the active site to Ala decreased enzyme activity, which was further decreased by reverse-charge mutagenesis to Lys (Fig. 2d). Mutating Ser 183 to Lys also decreased activity (Fig. 2d). Together, these data strongly support the model for substrate binding predicted from the structure and docking analysis.

We found previously that α-N-methylation occurred on RCC1 containing Ser 2, Pro 2 or Ala 2 (ref. 3). To extend this analysis, we mutated the second residue to each of the other 17 amino acids, using a system in which Factor X cleavage provides efficient exposure of this residue. Testing the cleaved proteins for methylation revealed the enzyme to be promiscuous. Only acidic residues, some hydrophobic residues, and Trp gave no detectable methylation (Fig. 3a). Downstream of the x-Pro-Lys motif, mutagenesis had variable effects, but did not abolish methylation by NRMT (data not shown). We conclude that the x-Pro-Lys motif is important for recognition by NRMT, but that substrate specificity is likely also controlled by the efficiency with which the initiating Met is cleaved.

Figure 3: NRMT methylates many targets, including SETα and RB.
figure3

a, His6–NRMT can methylate RCC1–His6 with any amino acid in the second position except Leu, Ile, Trp, Asp and Glu. Data were compared to the unmethylatable SPQ mutant by two-tailed independent t tests. * P < 0.01. n = 3 independent reactions per mutant. Error bars ± 1 s.d. b, Coomassie stain of 40 kDa protein immunoprecipitated by anti-me3-SPK (*). c, SETα–GFP is recognized by the anti-me3-SPK antibody. d, MS analysis showing SETα–Flag is stoichiometrically N-terminally trimethylated in HeLa cells. Mutation of SETα Lys 4 to Gln abolishes methylation. e, Immunoprecipitations with anti-me3-SPK from mouse spleen (shown) and heart lysate produce at least three specific bands visible by Coomassie staining (*). These bands (*), and one additional (+), are recognized by immunoblotting with anti-me3-SPK and correspond to the sizes of the identified mouse proteins (kelch-like 31 = 70 kDa, RCC1 = 45 kDa, SET = 33 kDa, and myosin light chain or ribosomal protein L23a 20 kDa). f, Table of N-terminal sequence and methylation status of identified targets. g, NRMT–His6 can methylate in vitro the N termini of SET and RB fused to GFP. h, Endogenous RB from HCT116 cells, but not HeLa cells, is recognized by the anti-me2-PPK antibody (left panel) and depletion of NRMT in HCT116 cells substantially reduces RB α-N methylation (right panel).

PowerPoint slide

Using Met-(Ala/Ser/Pro)-Pro-Lys, we searched GenBank for candidate substrates of NRMT. More than 35 annotated genes contain this N-terminal motif (Supplementary Table 1). To screen tissues for α-N-methylated proteins, we immunoblotted mouse tissue lysates with our anti-me3-SPK and anti-me2-PPK antibodies. In addition to RCC1, the immunoblots picked up >10 other proteins (Supplementary Fig. 4a). All tissues contained RCC1 N-methylation activity (Supplementary Fig. 4b). To validate the GenBank search, we checked if any proteins detected by the antibodies corresponded to predicted substrates. Proteins were precipitated from HeLa cell lysates using anti-me3-SPK and separated by SDS–polyacrylamide gel electrophoresis. Besides RCC1 and antibody chains, one additional band was visible at a size also detected by immunoblotting (Fig. 3b). This band was identified by MS as SET (also known as TAF-I or PHAP-II), a predicted substrate for NRMT (Supplementary Table 1). SET has two splice variants, α and β. Only SETα begins with the NRMT consensus. When C-terminally tagged SETα–GFP and SETβ–GFP were expressed in HeLa cells, only SETα was recognized by anti-me3-SPK (Fig. 3c). In addition, SETα–Flag was expressed in Hela cells, immunoprecipitated, and analysed by MS. The protein was 96.5% trimethylated on its N-terminal Ser (Fig. 3d and Supplementary Fig. 2b). Similar to RCC1 (ref. 3), SETα–Flag with a Gln 4 mutation was mostly unmodified, with only 4% mono-methylation, further confirming the importance of Lys 4 (Fig. 3d). Finally, a band corresponding to methylated SET was reduced in cells expressing shRNA or siRNA against NRMT (Fig. 1d and Supplementary Fig. 3b).

We next used the anti-me3-SPK antibody, cross-linked to Protein A/G agarose, to immunoprecipitate proteins from mouse spleen and cardiac lysates. Multiple methylated bands were detected (Fig. 3e), and six N-terminally methylated proteins were identified by MS (Fig. 3f and Supplementary Fig. 5). Two, RCC1 and SET, confirm the validity of the approach (Supplementary Fig. 6). The other four—kelch-like protein 31 (ref. 18; Supplementary Fig. 4c), ribosomal protein L23a, myosin light chain 2 and myosin light chain 3 (Supplementary Figs. 7 and 8)—confirm the predictive power of the identified motif, and expand the verified NRMT substrates.

Among the predicted substrates was the tumour suppressor protein RB. Given the importance of this protein in cell cycle control, we checked whether it too is a bona fide NRMT substrate. First, recombinant NRMT was able to methylate the N-terminal tails of both SETα and RB in vitro (Fig. 3g). Second, endogenous RB immunoprecipitated from the colon cancer line HCT116, which has high levels of functional RB19, was recognized by anti-me2-PPK (Fig. 3h). Third, when NRMT was depleted from HCT116 cells, RB methylation was substantially reduced (Fig. 3h and Supplementary Fig. 3g). Surprisingly, RB from HeLa cells, which is inactivated by the E7 oncoprotein20,21, was not methylated (Fig. 3h), even though HeLa cells express NRMT and contain methylated RCC1 and SET.

Non-methylatable mutants of RCC1 are defective in chromatin association, and their expression in a wild-type background produces supernumerary spindle poles and mis-segregation of mitotic chromosomes, most likely due to the disruption of the Ran gradient3,11. To test directly the importance of RCC1 α-N-methylation for its function, we used stably silenced NRMT expression in 293LT cells (Fig. 1d), and examined the distribution of RCC1 during mitosis. RCC1 was significantly more diffuse in mitotic cells lacking NRMT than in control cells (Fig. 4a). The mean chromatin/cytoplasm intensity ratio of RCC1 immunofluorescence was twofold greater in the control cells (Fig. 4a). This redistribution could also be observed in living 293LT cells depleted of NRMT and expressing RCC1–RFP (Fig. 4b).

Figure 4: Silencing NRMT reduces RCC1 association with chromatin, and increases frequency of mitotic defects.
figure4

a, Lentiviral silencing of NRMT decreases RCC1 association with chromatin in mitotic (arrowheads) 293LT cells. Chromatin to cytoplasmic ratio of endogenous RCC1 is twice higher in control compared to NRMT-depleted mitotic cells. Data analysed by two-tailed independent t tests. n = 50 mitotic cells for each condition. Error bars, ± 1 s.e.m. b, Lentiviral silencing of NRMT decreases the association of RCC1–RFP with chromatin in live 293LT cells. Data were analysed by two-tailed independent t tests. n = 50 mitotic cells for each condition. Error bars, ± 1 s.e.m. c, Lentiviral silencing of NRMT increases the frequency of supernumerary spindles to three times higher than that of control cells. Data were analysed by a χ2 test. n = 109 mitotic cells for each condition. Error bars, ± 1 s.d.

PowerPoint slide

Strikingly, NRMT-depleted 293LT cells in mitosis exhibited >threefold more supernumerary spindles than the control (Fig. 4c). These data, together with our previous studies3, show that one essential role for methylation of RCC1 is to stabilize chromatin association, and that this association is necessary for proper mitotic division. However, neither silencing of NRMT nor mutation of the methylation motif significantly altered RB nuclear localization or intranuclear dynamics in HCT116 cells (Supplementary Fig. 9), indicating that the function of the α-N-methylation is not solely to stabilize chromatin associations, but may have a more general role in the regulation of electrostatic interactions.

This study identifies the long-sought eukaryotic α-N-methyltransferase as a conserved member of a superfamily of non-SET domain enzymes and verifies six new protein targets. It is likely that NRMT orthologues throughout the Eukarya possess the same specificity and function, because recent screens have detected N-terminal dimethylation of the Arabidopsis and yeast L12 proteins, which possess the same NRMT consensus motif (PPK) as is found in almost all other eukaryotes5,22. Further analysis of L12 and other target proteins will likely reveal multiple functions for α-N-methylation.

Note added in proof: While this paper was in press, the yeast N-terminal methyltransferase was identified (K. J. Webb, R. S. Lipson, Q. Al-Hadid, J. P. Whitelegge & S. G. Clarke Biochemistry 49, 5225–5235; 2010).

Methods Summary

In vitro methylation assays

Substrate proteins were expressed with C-terminal His6 tags, and assayed in 50 mM Tris, 50 mM potassium acetate, pH 8.0, with 100 μM SAM as the methyl donor. All reactions were incubated 1 h at 30 °C and analysed for methylation by immunoblot. For ELISA assays, substrates and enzyme were mixed with 0.55 μCi 3H-S-adenosyl-l-methionine (SAM). Reactions were incubated as above then transferred to Protein A-coated ELISA plates pretreated with anti-me2-SPK. After 1 h, the reaction was removed and wells were treated with 1% SDS for 30 min. This solution was then quantified for incorporated 3H-methyl by scintillation counting.

Screening mutant NRMT substrates

Efficient removal of the initiating Met is dependent on the identity of the second residue. To avoid this problem, we created fusions from residues 2–10 of RCC1 with His6–tag plus Factor X cleavage site at the N terminus, and C-terminal GFP. Cleavage with Factor X exposes the second residue of the RCC1 N terminus. Substrate proteins containing all possible amino acids at residue 2 were expressed in Escherichia coli and purified on Ni-NTA beads, then cleaved using Factor X.

LC-MS/MS identification of novel NRMT substrates

On-bead endoproteinase Glu-C and Asp-N digestions were used to identify the immunoprecipitated proteins. The retained N termini were then eluted from the beads and analysed for methylation (Supplementary Fig. 5).

Online Methods

Constructs and antibodies

All RCC1 constructs were as previously described3. Wild-type and K4Q mutant SET vectors were designed as for the RCC1 vectors but using human SET cDNA. The human RB1 ORF (Open Biosystems) was amplified to introduce a 5′ HindIII restriction site, C-terminal Flag tag and 3′ BamHI site, and subcloned into the mammalian expression vector pRK7. The human NRMT ORF (Open Biosystems) was amplified to introduce a 5′ XbaI restriction site, C-terminal Flag tag and 3′ EcoRI site, and subcloned into pRK7. The Flag tag was alternatively included in the 5′ primer to create the N-terminally tagged NRMT. NRMT was also cloned into the XbaI and BamHI sites of pKGFP2, and into the NdeI and XhoI sites of pET30a to produce NRMT–His6. All His6 proteins were purified as previously24.

Rabbit anti-me2-SPK and anti-me3-SPK antibodies were as described previously3. They were used in immunoblots at 1:5,000 and 1:10,000 dilutions, respectively. Rabbit anti-me2-PPK antibody was produced against 2me-P-P-K-R-I-A-K-R-R-S-C synthesized by American Peptide. Rabbit anti-NRMT was produced against the C-terminal C-R-Q-E-N-L-P-D-E-I-Y-H-V-Y-S peptide synthesized by GenScript. This peptide sequence is common to human, mouse and dog. Both peptides were coupled to activated keyhole limpet haemocyanin, and antisera were produced by Cocalico Biologicals. Anti-me2-PPK was purified as described for the anti-me2-SPK and anti-me3-SPK antisera, to remove antibodies against non-methylated peptide3. Both antibodies were diluted 1:1,000 for immunoblots. The following antibodies were also used for immunoblots: mouse anti-RB1 (1:2,000, Cell Signaling Technology), mouse anti-Flag M2–horseradish peroxidase (1:1,000 Sigma-Aldrich), mouse anti-β-catenin (1:3,000 BD Biosciences), and rabbit anti–GFP (1:1,000 Invitrogen).

In vitro methylation assays

To assay column fractions, 50 μl samples were buffer-exchanged into MTase buffer (50 mM Tris, 50 mM potassium acetate, pH 8.0) using Centri Spin columns (Princeton Separations). His6–RCC1 (1 μg) was added as substrate and 100 μM SAM was added as the methyl donor. For assays on immunoprecipitates, Flag–NRMT was eluted from M2 agarose (Sigma) in MTase buffer with 0.1 mg ml−1 Flag peptide, then His6–RCC1 and SAM were added as above. For testing recombinant NRMT activity, 0.3 μg His6–NRMT was mixed with same amounts of RCC1–His6 and SAM and brought to 50 μl with MTase buffer. All reactions were incubated 1 h at 30 °C and analysed for methylation by immunoblot.

For ELISA methylation assays, HEK 293LT cells were calcium phosphate-transfected with 6 μg pKVenus, NRMT-pCMV-SPORT6, or Flag–NRMT. Cells were harvested 24 h post-transfection and used to make nuclear extract25. Nuclear extract (10 μg) was mixed with 1 μg RCC1–His6 and 0.55 μCi 3H-SAM and brought to 50 μl with MTase buffer. Reactions were incubated 1 h at 30 °C and transferred to Pierce Protein A-coated ELISA plates (Thermo Scientific) pretreated with 1:200 anti-me2-SPK. After 1 h, the reaction was removed and wells were treated with 1% SDS for 30 min. This solution was then quantified for incorporated 3H-methyl by scintillation counting.

Expression, purification and Factor X digestion of XPK–EGFP mutant substrates

XPK–EGFP substrate proteins were expressed from a modified pET15b (Novagen) expression vector in BL21 E. coli and purified on Ni-NTA beads, then cleaved using Factor X (Sigma-Aldrich). Reactions (50 μl) were performed in MTase buffer, using 3.0 pmol of recombinant NRMT plus 120 pmol of XPK–EGFP. The reaction was started by addition of 1 µl of 3H-SAM (0.55 µCi µl−1), and incubated for 2 h at 30 °C. Reactions were filtered through nitrocellulose, washed with 50 mM sodium bicarbonate and subjected to scintillation counting.

Mass spectrometry

For in-solution enzymatic digestion, active and adjacent non-active HAP fractions were dried, and reconstituted in 100 mM ammonium bicarbonate (Sigma-Aldrich). The sample was reduced, alkylated and digested with trypsin (Promega) at an enzyme:protein ratio of 1:20 at 37 °C for 6 h (ref. 26). For in-gel enzymatic digestion, Coomassie-stained SETα–Flag bands were excised and subjected to in-gel digestion as described previously27, with slight modification. Gel pieces were incubated with endoproteinase GluC (Roche) overnight at room temperature followed by peptide extraction. Extracted peptides were dried by using a SpeedVac concentrator (Savant Instruments), resuspended in 0.1% glacial acetic acid, and stored at −35 °C until analysis. For both methods, an aliquot of peptide solution was loaded onto a capillary precolumn (360-μm outer diameter, 75-μm inner diameter) packed with irregular C18 packing material (5−20 μm)26,28. The precolumn was washed with 0.1% acetic acid and then connected with Teflon tubing to an analytical column packed with regular C18 packing material (5 μm) and a 5-μm emitter tip26,28. Samples were analysed by nanoflow HPLC-microelectrospray ionization on a linear quadrupole ion trap-Fourier transform mass spectrometer (LTQ-FT; Thermo Electron)29. GluC-digested SETα–Flag was also analysed using a Thermo LTQ instrument modified for electron transfer dissociation (ETD) (90 ms ETD reaction) for adequate tandem mass spectrometry (MS/MS)30,31. All spectra were interpreted manually.

For analysis of the tissue immunoprecipitations, while still on beads, the purified proteins were reduced and carbamidomethylated on Cys residues and half of each was proteolytically digested in 100 mM ammonium bicarbonate (pH 8) using either endoproteinase Asp-N or Glu-C (Roche) for 6 h at room temperature as similarly described27. Following digestion, the generated peptides were removed from the N-terminal peptides still associated with the anti-me antibody on the agarose beads and later acidified to pH 3.5 using glacial acetic acid. An aliquot of the endoproteinase Asp-N- and Glu-C-generated peptides were pressure-loaded onto an irregular C18 (6 cm in length, 5–20 μm diameter, 120 Å pore size, YMC) capillary precolumn (360-μm outer diameter, 75-μm inner diameter) and washed with 0.1% acetic acid (Sigma Aldrich) before connecting the precolumn to a C18 (8 cm in length, 5 μm diameter, 120 Å pore size, YMC) analytical capillary column (360-μm outer diameter, 50-μm inner diameter) equipped with an electrospray emitter tip as described26,28. Digested samples were gradient-eluted for mass analysis at a flow rate of 60 nl min−1 using nanoflow HPLC and electrospray ionization into a linear ion trap and Fourier transform hybrid mass spectrometer (LTQ-FTMS or LTQ-Orbitrap, Thermo Scientific) as described above. Mass spectrometers used were front end ETD (FETD)-enabled to allow both CAD and ETD analyses for each digested sample in addition to high resolution precursor mass measurements. Mass analyses were completed with one high resolution (60,000 resolution at 400 m/z) MS1 scan followed by 8–10 CAD or ETD data-dependent MS2 scans. For ETD experiments, MS2 parameters were set as follows: 35 ms reaction time, 3 m/z precursor isolation window, charge state rejection ‘on’ for +1 and +2 charge state precursor ions, 2 × 105 FTMS full AGC target, 1 × 104 ITMS AGC target, 2 × 105 reagent target with azulene as the electron transfer reagent. All data were searched using the Open Mass Spectrometry Search Algorithm (OMSSA) against the entire mouse RefSeq database (downloaded June 2009) followed by manual confirmation.

To reduce the number of sample analyses, the separated bead aliquots from each digest were recombined for N-terminally modified peptide analyses. Peptides resulting from the Asp-N/Glu-C digests yet still retained on agarose beads were placed on a spin column (Thermo Scientific) washed with two 20 μl aliquots of Elution Buffer pH 2.8 (Pierce Crosslink Immunoprecipitation kit, Thermo Scientific) and centrifuged at 3,000g for 2 min to elute the newly released N-terminal peptides through the molecular weight cutoff filter. N-terminal peptides were reconstituted in 0.1% acetic acid, loaded and mass analysed as described above. However, a top 5 data-dependent CAD/ETD MS2 toggle instrument method was implemented. All data were search using OMSSA and all N-terminally modified peptides were verified by manual confirmation.

siRNA and lentiviral knockdowns

HeLa and HEK 293LT cells were grown in DMEM supplemented with 5% calf serum and 5% FCS, 100 U ml−1 penicillin and 100 U ml−1 streptomycin (GIBCO). HCT116 cells were grown in McCoy’s 5A Medium supplemented with 5% calf serum and 5% FCS, 100 U ml−1 penicillin and 100 U ml−1 streptomycin (Quality Biologicals). Control, human RCC1 and human NRMT siRNA SMARTpools were obtained from Thermo Scientific. The sequences of the RCC1 SMARTpool were described previously11. Sequences of the NRMT SMARTpool are: GCAAGAGGGUGAGGAACUA, GGAAGUUUCUGCAGAGGUU, GCCAAGACCUACUGGAAAC and UAGAAGACGAGAAGCAAUU. Hela cells were transferred to antibiotic-free medium for 24 h, then transfected with siRNA SMARTpools using the Oligofectamine protocol from Invitrogen, with 180 pmol of siRNA per 35 mm plate. Cells were harvested after 72 h and analysed by immunoblot.

The human and mouse NRMT lentiviral shRNAmir pGIPZ constructs were obtained from Open Biosystems and grown and purified according to their protocol. The targeting sequence of the shRNA against NRMT is AGAGAAGCAATTCTATTCCAAG; and the control sequence is CCCTGCCAGACAGTACCAATTA. To make virus, 2.5 × 106 293LT cells were calcium-phosphate-transfected with 20 μg of the NRMT pGIPZ plasmid, 6 μg of the vesicular stomatitis virus coat protein plasmid (pMD2G), and 15 μg of packaging plasmid (psPAX2). Viral supernatants were collected after 48 h, concentrated with 100K ultrafilters (Millipore) and titred in 293LT cells. 293LT or HCT116 cells (2 × 104) were then infected with virus to a multiplicity of infection (m.o.i.) of 1 or 5. After 3 days, 2 μg ml−1 puromycin was added, to select for transduced cells, and surviving cells were maintained in the same medium. For the rescue, 10,000 293LT cells were infected with lentivirus (control, NRMT shRNAmir, or NRMT shRNAmir co-expressing murine NRMT–Flag) to an m.o.i. of 3. The cells were grown for 2 days and lentivector-expressing cells were selected by addition of 2 μg ml−1 puromycin. The cells were grown two additional days and lysed (500 mM NaCl; 50 mM Tris pH 8.0; 5 mM MgCl2; 1 mM EDTA; 1 mM EGTA; 0.1% NP-40; BME and protease inhibitors). Each lysate (50 μg) was analysed by western blot.

SPK peptide docking analysis

ICM-PRO software (Molsoft LLC) was used for docking of the model substrate peptide SPKRIA to NRMT32. A rigid ICM model of the protein was prepared from the PDB coordinates (PDB ID: 2EX4) using the ICM conversion procedure that includes the addition and local minimization of hydrogen atoms in the internal coordinate space and the selection of energetically favourable side chains for His, Asn and Gln. All water molecules were removed from the structure and only one protein molecule from the asymmetric unit was taken for the calculations. ICM-PRO was then used for the identification of possible binding sites (pockets) in the receptor structure from maps calculated with a grid size of 0.5 Å. The hexapeptide SPKRIA model was generated using the Monte Carlo conformational procedures in Macromodel 7.1 (Schrodinger). An optimized peptide model was placed in the vicinity of the identified pocket and the docking was performed applying the ICM-PRO template docking approach.

Isothermal titration calorimetry

Isothermal titration calorimetry (ITC) experiments were performed using an ITC200 microcalorimeter (MicroCal). Recombinant NRMT was dialysed overnight at 4 °C against methyltransferase buffer. Peptides were purchased from GenScript in lyophilized form, and dissolved in the same buffer. Exothermic heats of reaction (µcal s−1) were measured at 25 °C by repeated, automated injection of the SPK or SPQ peptides (40 µl, 610 µM), spaced at 2-min intervals, into 280 µl of NRMT (61.12 µM). Binding curves were analysed by nonlinear least squares fitting of the data using the Origin (MicroCal) software package.

Immunofluorescence and live cell imaging

293LT cells grown on Lab-Tek II chambers (Nunc) were fixed in 1:1 methanol/acetone then blocked in 1% gelatin. Endogenous RCC1 was detected with the RCC1(N-19) antibody from Santa Cruz Biotechnology at a dilution of 1:200. Alexa-Fluor 488-conjugated donkey anti-goat secondary antibody was used at 1:1,000 (Invitrogen). Cells were counterstained with 1:1,000 Draq5 (Alexis). HeLa cells expressing NRMT–GFP were fixed in 4% paraformaldehyde (PFA), permeabilized in 0.5% Triton X-100, and counterstained with 1:1,000 Draq 5. Imaging was performed on a Zeiss LSM510 Meta confocal microscope, using a ×100 oil immersion lens (NA 1.3), at 512 × 512 pixel resolution, and a zoom of 2.0. Images were processed and quantified using ImageJ 1.41b software.

Endogenous NRMT staining was performed on HeLa cells fixed in 4% PFA, permeabilized in 0.5% Triton X-100, and blocked in 1% gelatin. Anti-NRMT was purified using the C-terminal NRMT peptide and diluted 1:200. Alexa-Fluor 594-conjugated goat anti-rabbit secondary was used at 1:1,000 (Invitrogen). The cells were counterstained with DAPI (1 ng ml−1). For mitotic spindle staining, stably transduced 293LT cells were fixed as the HeLas. Tubulin was detected with mouse anti-α-tubulin at 1:500 (Sigma). Alexa-Fluor 594-conjugated goat anti-mouse secondary was used at 1:1,000 (Invitrogen). Cells were counterstained with DAPI. Both experiments were visualized using a wide field microscope (Eclipse T200; Nikon) equipped with a ×60 NA 1.2 plan-achromatic water immersion lens and a charge-coupled device camera (Orca C472-95-12NRB; Hamamatsu Phototonics). Images were collected at a 12-bit depth and 1,024 × 1,280 pixel resolution with 1 × 1 binning using Openlab 4.0 software (Improvision). Images were processed using ImageJ 1.41b software.

For live cell imaging, stably transduced 293LT cells were plated in 2-well Lab-Tek II coverglass (Nunc) in DMEM/F12 50/50 without phenol red (Cellgro) supplemented with 10% FBS (Gibco) and transiently transfected with 1.6 μg pK-RCC1–RFP using lipofectamine 2000 (Invitrogen). After 24 h, cells were counterstained with Hoechst dye (1 μg ml−1), visualized on a Nikon (Eclipse TE2000-E) with a Yokogawa spinning disk confocal system (Solamere Technologies) using a ×60 (NA 1.40) objective lens (Solamere Technology). Images were processed and quantified using ImageJ 1.41b software.

Tissue immunoprecipitations

Normal rabbit IgG (10 μg; Santa Cruz Biotechnology) and 5 μl (approximately 10 μg) of purified anti-me3-SPK serum were covalently crosslinked to Protein A/G resin using the Pierce Crosslink Immunoprecipitation kit (Thermo Scientific). Whole mouse spleen or cardiac tissue were lysed in tissue lysis buffer (50 mM Tris-HCL, pH 8.0; 150 mM NaCl; 1 mM EDTA; 10 mM MgCl2; 0.1% NP40 and protease inhibitors) and homogenized. The resuspension was spun at 16,100g at 4 °C for 10 min. The supernatant was then passed through an empty Handee Spin Column (Thermo Scientific) to remove remaining debris and added to the appropriate columns. The immunoprecipitation was performed as recommended by the manufacturer (Thermo Scientific). Samples dedicated for mass spectrometry were washed and analysed on-bead. Sample used for Coomassie and western blot analysis were eluted according to the protocol.

Change history

  • 26 August 2010

    A note was added in proof.

References

  1. 1

    Brosius, J. & Chen, R. The primary structure of protein L16 located at the peptidyltransferase center of Escherichia coli ribosomes. FEBS Lett. 68, 105–109 (1976)

    CAS  Article  Google Scholar 

  2. 2

    Wittmann-Liebold, B. & Pannenbecker, R. Primary structure of protein L33 from the large subunit of the Escherichia coli ribosome. FEBS Lett. 68, 115–118 (1976)

    CAS  Article  Google Scholar 

  3. 3

    Chen, T. et al. N-terminal α-methylation of RCC1 is necessary for stable chromatin association and normal mitosis. Nature Cell Biol. 9, 596–603 (2007)

    CAS  Article  Google Scholar 

  4. 4

    Meng, F. et al. Molecular-level description of proteins from Saccharomyces cerevisiae using quadrupole FT hybrid mass spectrometry for top down proteomics. Anal. Chem. 76, 2852–2858 (2004)

    CAS  Article  Google Scholar 

  5. 5

    Sadaie, M., Shinmyozu, K. & Nakayama, J. A conserved SET domain methyltransferase, Set11, modifies ribosomal protein Rpl12 in fission yeast. J. Biol. Chem. 283, 7185–7195 (2008)

    CAS  Article  Google Scholar 

  6. 6

    Pettigrew, G. W. & Smith, G. M. Novel N-terminal protein blocking group identified as dimethylproline. Nature 265, 661–662 (1977)

    ADS  CAS  Article  Google Scholar 

  7. 7

    Martinage, A., Briand, G., Van Dorsselaer, A., Turner, C. H. & Sautiere, P. Primary structure of histone H2B from gonads of the starfish Asterias rubens. Identification of an N-dimethylproline residue at the amino-terminal. Eur. J. Biochem. 147, 351–359 (1985)

    CAS  Article  Google Scholar 

  8. 8

    Nomoto, M., Hayashi, H. & Iwai, K. Tetrahymena histone H2B. Complete amino acid sequence. J. Biochem. 91, 897–904 (1982)

    CAS  Article  Google Scholar 

  9. 9

    Grimm, R. et al. Postimport methylation of the small subunit of ribulose-1,5-bisphosphate carboxylase in chloroplasts. FEBS Lett. 408, 350–354 (1997)

    CAS  Article  Google Scholar 

  10. 10

    Henry, G. D. et al. The occurrence of α-N-trimethylalanine as the N-terminal amino acid of some myosin light chains. FEBS Lett. 144, 11–15 (1982)

    CAS  Article  Google Scholar 

  11. 11

    Hao, Y. & Macara, I. G. Regulation of chromatin binding by a conformational switch in the tail of the Ran exchange factor RCC1. J. Cell Biol. 182, 827–836 (2008)

    CAS  Article  Google Scholar 

  12. 12

    Stock, A., Clarke, S., Clarke, C. & Stock, J. N-terminal methylation of proteins: structure, function and specificity. FEBS Lett. 220, 8–14 (1987)

    CAS  Article  Google Scholar 

  13. 13

    Bloom, K. S. & Anderson, J. N. Fractionation and characterization of chromosomal proteins by the hydroxyapatite dissociation method. J. Biol. Chem. 253, 4446–4450 (1978)

    CAS  PubMed  Google Scholar 

  14. 14

    Simon, R. H. & Felsenfeld, G. A new procedure for purifying histone pairs H2A+H2B and H3+H4 from chromatin using hydroxylapatite. Nucleic Acids Res. 6, 689–696 (1979)

    CAS  Article  Google Scholar 

  15. 15

    Duncan, E. M. et al. Cathepsin L proteolytically processes histone H3 during mouse embryonic stem cell differentiation. Cell 135, 284–294 (2008)

    CAS  Article  Google Scholar 

  16. 16

    Hu, R. M. et al. Gene expression profiling in the human hypothalamus-pituitary-adrenal axis and full-length cDNA cloning. Proc. Natl Acad. Sci. USA 97, 9543–9548 (2000)

    ADS  CAS  Article  Google Scholar 

  17. 17

    Scheerer, P. et al. Crystal structure of opsin in its G-protein-interacting conformation. Nature 455, 497–502 (2008)

    ADS  CAS  Article  Google Scholar 

  18. 18

    Yu, W. et al. A novel human BTB-kelch protein KLHL31, strongly expressed in muscle and heart, inhibits transcriptional activities of TRE and SRE. Mol. Cells 26, 443–453 (2008)

    CAS  PubMed  Google Scholar 

  19. 19

    Yamamoto, H. et al. Paradoxical increase in retinoblastoma protein in colorectal carcinomas may protect cells from apoptosis. Clin. Cancer Res. 5, 1805–1815 (1999)

    CAS  PubMed  Google Scholar 

  20. 20

    Boyer, S. N., Wazer, D. E. & Band, V. E7 protein of human papilloma virus-16 induces degradation of retinoblastoma protein through the ubiquitin-proteasome pathway. Cancer Res. 56, 4620–4624 (1996)

    CAS  PubMed  Google Scholar 

  21. 21

    Dyson, N., Howley, P. M., Munger, K. & Harlow, E. The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science 243, 934–937 (1989)

    ADS  CAS  Article  Google Scholar 

  22. 22

    Carroll, A. J., Heazlewood, J. L., Ito, J. & Millar, A. H. Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. Mol. Cell. Proteomics 7, 347–369 (2008)

    CAS  Article  Google Scholar 

  23. 23

    Baker, N. A., Sept, D., Joseph, S., Holst, M. J. & McCammon, J. A. Electrostatics of nanosystems: application to microtubules and the ribosome. Proc. Natl Acad. Sci. USA 98, 10037–10041 (2001)

    ADS  CAS  Article  Google Scholar 

  24. 24

    Chen, T., Brownawell, A. M. & Macara, I. G. Nucleocytoplasmic shuttling of JAZ, a new cargo protein for exportin-5. Mol. Cell. Biol. 24, 6608–6619 (2004)

    CAS  Article  Google Scholar 

  25. 25

    Dignani, J. D., Lebovitz, R. M. & Roeder, R. G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 1475–1489 (1983)

    Article  Google Scholar 

  26. 26

    Schroeder, M. J., Shabanowitz, J., Schwartz, J. C., Hunt, D. F. & Coon, J. J. A neutral loss activation method for improved phosphopeptide sequence analysis by quadrupole ion trap mass spectrometry. Anal. Chem. 76, 3590–3598 (2004)

    CAS  Article  Google Scholar 

  27. 27

    Shevchenko, A., Wilm, M., Vorm, O. & Mann, M. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68, 850–858 (1996)

    CAS  Article  Google Scholar 

  28. 28

    Martin, S. E., Shabanowitz, J., Hunt, D. F. & Marto, J. A. Subfemtomole MS and MS/MS peptide sequence analysis using nano-HPLC micro-ESI Fourier transform ion cyclotron resonance mass spectrometry. Anal. Chem. 72, 4266–4274 (2000)

    CAS  Article  Google Scholar 

  29. 29

    Syka, J. E. et al. Novel linear quadrupole ion trap/FT mass spectrometer: performance characterization and use in the comparative analysis of histone H3 post-translational modifications. J. Proteome Res. 3, 621–626 (2004)

    CAS  Article  Google Scholar 

  30. 30

    Syka, J. E., Coon, J. J., Schroeder, M. J., Shabanowitz, J. & Hunt, D. F. Peptide and protein sequence analysis by electron transfer dissociation mass spectrometry. Proc. Natl Acad. Sci. USA 101, 9528–9533 (2004)

    ADS  CAS  Article  Google Scholar 

  31. 31

    Udeshi, N. D., Compton, P. D., Shabanowitz, J., Hunt, D. F. & Rose, K. L. Methods for analyzing peptides and proteins on a chromatographic timescale by electron-transfer dissociation mass spectrometry. Nature Protocols 3, 1709–1717 (2008)

    CAS  Article  Google Scholar 

  32. 32

    Abagyan, R., Totrov, M. & Kuznetsov, D. J. ICM–a new method for protein modeling and design: applications to docking and structure prediction from the distorted native conformation. J. Comput. Chem. 15, 488–506 (1994)

    CAS  Article  Google Scholar 

Download references

Acknowledgements

This work was supported by research grants from the National Institutes of Health to I.G.M., D.F.H., and W.M.; C.E.S.T. was the recipient of a post-doctoral fellowship from the National Institutes of Health.

Author information

Affiliations

Authors

Contributions

C.E.S.T. purified NRMT and performed the experiments characterizing its function and targets and wrote the paper with I.G.M.; J.J.P. performed the ITC experiments and the RCC1 mutagenesis, and the docking experiments with the aid of M.S.; T.L.M.-S. and J.L.B. performed the mass spectrometry with J.S.; D.F.H. directed the mass spectrometry. W.M. coordinated the experiments of J.J.P.; I.G.M directed the biochemical and cell biological studies.

Corresponding author

Correspondence to Christine E. Schaner Tooley.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Information

This file contains Supplementary Table 1 and Supplementary Figures 1-9 with legends. (PDF 5259 kb)

PowerPoint slides

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Schaner Tooley, C., Petkowski, J., Muratore-Schroeder, T. et al. NRMT is an α-N-methyltransferase that methylates RCC1 and retinoblastoma protein. Nature 466, 1125–1128 (2010). https://doi.org/10.1038/nature09343

Download citation

Further reading

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing