Phase-shifting the circadian glucocorticoid profile induces disordered feeding behaviour by dysregulating hypothalamic neuropeptide gene expression

Yoshimura, Mitsuhiro; Flynn, Benjamin P.; Kershaw, Yvonne M.; Zhao, Zidong; Ueta, Yoichi; Lightman, Stafford L.; Conway-Campbell, Becky L.

doi:10.1038/s42003-023-05347-3

Download PDF

Article
Open access
Published: 29 September 2023

Phase-shifting the circadian glucocorticoid profile induces disordered feeding behaviour by dysregulating hypothalamic neuropeptide gene expression

Communications Biology volume 6, Article number: 998 (2023) Cite this article

3011 Accesses
261 Altmetric
Metrics details

Subjects

Abstract

Here we demonstrate, in rodents, how the timing of feeding behaviour becomes disordered when circulating glucocorticoid rhythms are dissociated from lighting cues; a phenomenon most commonly associated with shift-work and transmeridian travel ‘jetlag’. Adrenalectomized rats are infused with physiological patterns of corticosterone modelled on the endogenous adrenal secretory profile, either in-phase or out-of-phase with lighting cues. For the in-phase group, food intake is significantly greater during the rats’ active period compared to their inactive period; a feeding pattern similar to adrenal-intact control rats. In contrast, the feeding pattern of the out-of-phase group is significantly dysregulated. Consistent with a direct hypothalamic modulation of feeding behaviour, this altered timing is accompanied by dysregulated timing of anorexigenic and orexigenic neuropeptide gene expression. For Neuropeptide Y (Npy), we report a glucocorticoid-dependent direct transcriptional regulation mechanism mediated by the glucocorticoid receptor (GR). Taken together, our data highlight the adverse behavioural outcomes that can arise when two circadian systems have anti-phasic cues, in this case impacting on the glucocorticoid-regulation of a process as fundamental to health as feeding behaviour. Our findings further highlight the need for development of rational approaches in the prevention of metabolic dysfunction in circadian-disrupting activities such as transmeridian travel and shift-work.

Induction of internal circadian desynchrony by misaligning zeitgebers

Article Open access 31 January 2022

The intersection between ghrelin, metabolism and circadian rhythms

Article 20 December 2023

Differentiating external zeitgeber impact on peripheral circadian clock resetting

Article Open access 27 December 2019

Introduction

Secretion of adrenal glucocorticoids (corticosterone (CORT) in rats and cortisol in humans) is regulated by the hypothalamic-pituitary-adrenal (HPA) axis, and characterised by both circadian and ultradian rhythmicity. These daily and hourly fluctuations in adrenal glucocorticoid secretion result in rapid changes of circulating hormone levels in the blood and within target tissues including the brain^1,2. Ultradian glucocorticoid pulse amplitude rises steeply in the hours before waking, in an ‘anticipatory’ response to the active phase, then gradually diminishes throughout the day reaching a nadir during the inactive phase^3,4. The functional relevance of ultradian glucocorticoid pulses is still not fully understood; however, some ambitious studies have demonstrated that pulsatile activation is necessary to maintain optimal transcriptional activity of glucocorticoid receptors (GRs) in cell lines, and rat liver and brain^5,6,7,8, as well as HPA axis sensitivity, neuronal activation and behavioural responses to stress in rats⁹. In humans, an oscillating pattern of plasma cortisol has been demonstrated to be important for maintenance of healthy brain functions, including normal emotional and cognitive responses¹⁰.

Feeding behaviour is another fundamental glucocorticoid-responsive activity¹¹, yet its regulation by physiological circadian and ultradian glucocorticoid rhythms has not been assessed despite its obvious importance for individuals whose natural rhythms are disrupted due to shift-work. To date, the basis of our understanding about feeding behaviour and glucocorticoids has been from seminal studies which used non-physiological glucocorticoid manipulations. For example, exogenous chronic CORT treatment in mice, delivered ad libitum in drinking water, resulted in high CORT levels during the daily active phase¹², reflecting increased drinking behaviour during this time, as previously shown¹³. These mice exhibited hyperphagia and obesity along with increased hypothalamic gene expression of agouti-related neuropeptide (Agrp), but without significant effect on neuropeptide Y (Npy), proopiomelanocortin (Pomc) or cocaine and amphetamine regulated transcript (CART) prepropeptide (Cartpt)¹². AgRP and NPY are known for their role in promoting feeding behaviour, whereas POMC and CART are associated with satiety. In another early elegant study, chronic pharmacological level CORT exposure in adrenalectomized rats was induced experimentally by subcutaneously implanted CORT pellets, resulting in elevated Npy gene expression in the arcuate nucleus, as well as increased peptide synthesis, receptor activity, and feeding behaviour^14,15. However, there was little impact of reduced CORT levels on Npy gene expression, peptide levels or receptor binding in adrenalectomized rats, leading to speculation that the rhythmic increase in CORT levels closely followed by a sharp rise in Npy expression at the start of the active phase may be the basis of the functional interaction.

In our current study we investigate the mechanisms underlying the adverse metabolic effects associated with phase shifting the circadian glucocorticoid profile. Using our model of physiological CORT replacement in adrenalectomized rats, we have assessed how feeding behaviour becomes dysregulated when the circulating CORT rhythm is out of phase with daily light:dark cues. To achieve this, our first experimental group was replaced with pulsatile CORT in-phase with light:dark cues, which is the most faithful representation of normal circadian and ultradian CORT exposure (Fig. 1a, c). The second group was replaced with the same pattern of CORT but exactly 12 h shifted out-of-phase with light:dark cues (Fig. 1b, d). The dose of CORT delivered was chosen to match average endogenous circulating CORT determined from our automated blood sampling system of adrenal-intact rats (S Fig. 1). Circadian activity and core body temperature profiles, timing and amount of food and water ingested, as well as gene expression of feeding regulating neuropeptides in the hypothalamus and clock genes in the suprachiasmatic nucleus, were assessed in comparison to sham-operated (adrenal-intact) control rats, hereafter referred to as the control group.

**Fig. 1: Schematic of circadian and ultradian CORT infusion profiles.**

To interrogate the glucocorticoid-dependence of the phenomenon, in the absence of time of day influence, we analysed dissected tissue containing the hypothalamic arcuate nucleus from adrenalectomized rats treated with an acute CORT injection at ZT2. Using chromatin immunoprecipitation (ChIP) with antibodies specific for GR, and the active initiating form of RNA Polymerase 2, phosphorylated on Serine 5 (pSer5 RNA-Pol2), we first confirmed that the well characterised CORT-responsive Period1 (Per1) gene’s glucocorticoid response element (GRE) and transcriptional start site (TSS) became GR bound and enriched with pSer5 RNA-Pol2 respectively, in a CORT-dependent manner, in the hypothalamic arcuate nucleus. Using the same chromatin preparations, we were able to identify CORT-dependent GR binding at a GRE in the 5’-regulatory region of Npy¹⁶, along with a concomitant increase in pSer5 RNA-Pol2 occupancy at the TSS of the Npy gene. Taken together, these data support a direct glucocorticoid-dependent transcriptional regulation of Npy similarly to that previously shown for Per1. This supports our hypothesis that expression of Npy can become dysregulated during out-of-phase CORT exposure resulting in orexigenic behaviour independent of environmental daily cues.

Results

Timing of food intake is disordered when corticosterone is out-of-phase with daily light cues

Surgery was carried out on Day 0. CORT infusions commenced on Day 1. Twelve-hourly food intake was measured until day 4. Total amount of food intake (g) per day was comparable between in-phase, out-of-phase, and sham-operated control groups during the experiment (Fig. 2a). However, the timing of food intake was significantly altered in the out-of-phase group. For the in-phase group, food intake was significantly lower during the light period (1.72 ± 1.27 g) than during the dark period (13.89 ± 2.55 g); comparable to the feeding behaviour of the sham-operated control group (light period, 1.94 ± 0.83 g; dark period, 13.50 ± 2.82 g). In contrast, the out-of-phase group ingested significantly more food during the light period (6.75 ± 1.87 g) compared to either in-phase or control groups. In fact, the amount of food ingested by the out-of-phase group during the light period was not significantly different to the amount they consumed during the dark period (7.83 ± 2.88 g) (Fig. 2b). Therefore, for the out-of-phase group, only 53.6% of food consumption occurred during the dark period (Fig. 2c), which was markedly different to both the in-phase and control groups that consumed most of their food during the dark period (89.1% and 88.4% respectively). Cumulative food intake analysis revealed a striking time of day pattern in food consumption for the in-phase group, which was ablated in the out-of-phase group (Fig. 2d). However, the timing of water intake was not altered in the out-of-phase group (S Fig. 2). Furthermore, body weight remained unchanged between both groups, and the out-of-phase CORT treatment had no impact on subcutaneous and epididymal fat mass (S Fig. 3).

**Fig. 2: Dysregulated feeding pattern during out-of-phase glucocorticoid exposure.**

Daily timing of gene expression for the hypothalamic feeding regulating neuropeptides is reversed when corticosterone is out-of-phase with environmental daily light cues

In situ hybridization histochemistry (ISHH) was performed on brains taken from rats in each of the three groups at either Zeitgeber Time (ZT) 1 or 13, on the final day of the experiment. Feeding regulating neuropeptides in the arcuate nucleus and lateral hypothalamic area were analysed (Fig. 3a). The gene expression of Npy, Agrp, Pomc, and Cartpt in the arcuate nucleus and pro-melanin-concentrating-hormone (Pmch) in the lateral hypothalamic area were measured (Fig. 3b). The captured photographs are featured within supplementary materials (S Fig. 4). Npy, Agrp, and Pmch, which are known orexigenic neuropeptides, were significantly increased at ZT13 in both the in-phase and control groups (Npy, in-phase 1.83 ± 0.31, control 1.74 ± 0.30; Agrp, in-phase 1.69 ± 0.38, control 1.56 ± 0.22; Pmch, in-phase 1.62 ± 0.26, control 1.46 ± 0.21) compared to ZT1 (Npy, in-phase 1.13 ± 0.12, control 1.00 ± 0.18; Agrp, in-phase 1.05 ± 0.27, control 1.00 ± 0.21; Pmch, in-phase 1.03 ± 0.20, control 1.00 ± 0.17) (Fig. 3c). In stark contrast, the orexigenic gene expression pattern was reversed in the out-of-phase group, with all significantly decreased at ZT13 (Npy, 1.11 ± 0.32; Agrp, 1.12 ± 0.11; Pmch, 1.03 ± 0.16) compared to ZT1 (Npy, 1.78 ± 0.47; Agrp, 1.56 ± 0.22; Pmch, 1.35 ± 0.21) (Fig. 3c). Compared to the orexigenic neuropeptides, an expected opposing expression pattern was evident for the anorexigenic Pomc and Cartpt. These were significantly decreased at ZT13 for both the in-phase and control groups (Pomc, in-phase 0.73 ± 0.06, control, 0.72 ± 0.08; Cartpt, in-phase 0.65 ± 0.12, control, 0.82 ± 0.11) compared to ZT1 (Pomc, in-phase 1.02 ± 0.11, control 1.00 ± 0.09; Cartpt, in-phase 0.93 ± 0.10, control 1.00 ± 0.16) (Fig. 3d). However, the reverse was seen for the out-of-phase group. Pomc and Cartpt were markedly increased at ZT13 (Pomc, 1.14 ± 0.16; Cartpt, 1.08 ± 0.15) in comparison to ZT1 (Pomc, 0.79 ± 0.13; Cartpt, 0.75 ± 0.04) (Fig. 3d).

**Fig. 3: Altered expression of hypothalamic feeding regulating neuropeptide genes during out-of-phase glucocorticoid exposure.**

Effects of out-of-phase corticosterone exposure on HPA axis, oxytocin (Oxt), and arginine vasopressin (Avp)

The effect of out-of-phase CORT exposure on the HPA axis was next assessed. Gene expression of corticotrophin releasing hormone (Crh) in the paraventricular nucleus and Pomc in the anterior pituitary were measured by ISHH (Fig. 4a, b). For both in-phase and control groups, Crh and Pomc were significantly higher at ZT13 (Crh, in-phase 1.61 ± 0.41, control 1.57 ± 0.24; Pomc, in-phase 2.83 ± 0.70, control 2.49 ± 0.38) compared to ZT1 (Crh, in-phase 0.99 ± 0.25, control 1.00 ± 0.18; Pomc, in-phase 1.60 ± 0.20, control 1.00 ± 0.34) in each group (Fig. 4c). Whilst they were also increased in the out-of-phase group at ZT13 (Crh, 1.85 ± 0.26; Pomc, 4.09 ± 0.72) compared to ZT1 (Crh, 1.07 ± 0.21; Pomc, 2.34 ± 0.67); increased Pomc expression at ZT13 in out-of-phase was markedly elevated (Fig. 4c). Plasma adrenocorticotrophic hormone (ACTH) was markedly increased at ZT13, for both in-phase (652.9 ± 543.9 pg/mL) and out-of-phase (1808.3 ± 559.6 pg/mL) groups, in comparison to ZT1 (in-phase, 92.6 ± 38.6 pg/mL; out-of-phase, 148.4 ± 207.4 pg/mL); however ACTH at ZT13 was much higher in the out-of-phase than the in-phase group (Fig. 4d) consistent with the results of ISHH. As with the expected CORT profiles from our programmed infusion pump settings, plasma CORT concentration was significantly higher at ZT13 for the in-phase (256.1 ± 63.8 ng/mL) and at ZT1 for the out-of-phase (391.2 ± 83.5 ng/mL) groups, compared to ZT1 for the in-phase (103.1 ± 75.3 ng/mL) and ZT13 for the out-of-phase (161.7 ± 97.0 ng/mL) groups, respectively (Fig. 4e).

**Fig. 4: Differential gene expression pattern of HPA axis regulators *Crh* and *Pomc* between in-phase and out-of-phase CORT exposure.**

Oxt and Avp gene expression in the supraoptic nucleus and paraventricular nucleus were also analysed by ISHH (Fig. 5a). They were both significantly decreased in both in-phase and control groups at ZT13 (Oxt in the supraoptic nucleus, in-phase 0.66 ± 0.15, control 0.58 ± 0.12; Oxt in the paraventricular nucleus, in-phase 0.67 ± 0.16, control 0.75 ± 0.15; Avp in the supraoptic nucleus, in-phase 0.62 ± 0.23, control 0.74 ± 0.19; Avp in the paraventricular nucleus, in-phase 0.76 ± 0.24, control 0.63 ± 0.27) compared to ZT1 (Oxt in the supraoptic nucleus, in-phase 0.95 ± 0.13, control 1.00 ± 0.14; Oxt in the paraventricular nucleus, in-phase 0.99 ± 0.12, control 1.00 ± 0.19; Avp in the supraoptic nucleus, in-phase 1.04 ± 0.13, control 1.00 ± 0.21; Avp in the paraventricular nucleus, in-phase 1.03 ± 0.32, control 1.00 ± 0.30) (Fig. 5b). Similar to our findings with the orexigenic and anorexigenic neuropeptides, these expression patterns were reversed in the out-of-phase group, with significantly increased expression at ZT13 (Oxt in the supraoptic nucleus, 0.89 ± 0.11; Oxt in the paraventricular nucleus, 1.06 ± 0.20; Avp in the supraoptic nucleus, 1.05 ± 0.18; Avp in the paraventricular nucleus, 1.07 ± 0.27) compared to ZT1 (Oxt in the supraoptic nucleus, 0.58 ± 0.06; Oxt in the paraventricular nucleus, 0.83 ± 0.14; Avp in the supraoptic nucleus, 0.71 ± 0.18; Avp in the paraventricular nucleus, 0.69 ± 0.18) (Fig. 5b). The captured photographs are featured within supplementary materials (S Fig. 5).

**Fig. 5: Differential gene expression pattern of *Oxt* and *Avp* between in-phase and out-of-phase CORT exposure.**

Circadian core body temperature (CBT), activity, and clock genes

Significant differences in CBT between the in-phase and out-of-phase groups were restricted to the early part of the active phase. The out-of-phase group had higher CBT at ZT0-ZT6 (37.34 ± 0.15 °C) compared to in-phase (37.16 ± 0.11 °C) (Fig. 6a, c). There were no statistically significant differences between in-phase and out-of-phase groups at ZT12-ZT18 (in-phase 37.58 ± 0.14 °C, out-of-phase 37.58 ± 0.11 °C), ZT18-ZT24 (in-phase 37.51 ± 0.13 °C, out-of-phase 37.62 ± 0.10 °C), and ZT6- ZT12 (in-phase 37.17 ± 0.11 °C, out-of-phase 37.28 ± 0.09 °C) (Fig. 6c). Overall, mean core body temperature during the light period was still markedly lower compared to mean core body temperature during the dark period (Fig. 6c) irrespective of group.

**Fig. 6: Effects of dysregulated glucocorticoid exposure on core body temperature, but not locomotor activity.**

As the elevated CBT levels were restricted to the highest amplitude CORT pulses at the start of the inactive phase, we speculated that this may be due to a direct CORT effect rather than a simple post-prandial hyperthermic effect. To test this, CBT was monitored over a 6 h fasting period from ZT23 to ZT5. At ZT1, either VEH (HBC-Saline) or CORT-HBC-Saline (3 mg/kg) was injected subcutaneously. CBT rose sharply in the CORT treated rats, and remained elevated for approximately 2 h after the injection (S Fig. 6). No effect on CBT was found for the HBC-Saline treated rats.

In contrast to CBT, locomotor activity was not affected by out-of-phase CORT infusion (Fig. 6b, d). No significant difference was evident in locomotor activity, assessed in 6 h epochs, between in-phase and out-of-phase groups (ZT12-ZT18, in-phase 5085.2 ± 1185.3, out-of-phase 4201.4 ± 956.5; ZT18-ZT24, in-phase 5260.0 ± 1400.2, out-of-phase 4980.3 ± 1174.4; ZT0-ZT6, in-phase 2325.6 ± 498.8, out-of-phase 2874.8 ± 650.3; ZT6-ZT12, in-phase 1741.8 ± 462.7, out-of-phase 2098.7 ± 517.8). As expected, locomotor activity was significantly lower during the light period than during the dark period in both groups (Fig. 6d).

Per1, Per2, and heteronuclear (hn) Avp gene expression in the suprachiasmatic nucleus and Hcrt in the lateral hypothalamic area were analysed by ISHH (Fig. 7a). For all groups, Per1 and hnAvp expression were significantly decreased at ZT13 (Per1, in-phase, 0.41 ± 0.05, out-of-phase 0.35 ± 0.03, control, 0.46 ± 0.04; hnAvp, in-phase, 0.27 ± 0.09, out-of-phase 0.33 ± 0.09, control, 0.28 ± 0.06) compared to ZT1 (Per1, in-phase, 0.95 ± 0.14, out-of-phase 0.91 ± 0.06, control, 1.00 ± 0.09; hnAvp, in-phase, 1.15 ± 0.28, out-of-phase 1.01 ± 0.15, control, 1.00 ± 0.15) (Fig. 7b). For all groups, Per2 expression was markedly increased at ZT13 (in-phase, 5.44 ± 2.13, out-of-phase 4.26 ± 1.36, control, 5.85 ± 1.30) in comparison to ZT1 (in-phase, 0.74 ± 0.32, out-of-phase 0.75 ± 0.25, control, 1.00 ± 0.18) in all groups (Fig. 7c). Hcrt was dramatically increased at ZT13 (in-phase, 2.33 ± 0.26, out-of-phase 2.15 ± 0.31, control, 2.20 ± 0.23) compared to ZT1 (in-phase, 1.02 ± 0.11, out-of-phase 1.03 ± 0.13, control, 1.00 ± 0.19) in all groups (Fig. 7d). Taken together, these data indicate that clock genes in the suprachiasmatic nucleus and Hcrt in the lateral hypothalamic area remain entrained by light/dark cues and are not disrupted by out-of-phase CORT exposure. The captured photographs are featured within supplementary materials (S Fig. 7).

**Fig. 7: Effects of dysregulated glucocorticoid exposure on Clock-regulating genes and *Hypocretin neuropeptide precursor Orexin*.**

CORT-induced GR binding at GRE sites and pSer5 RNA Pol2 enrichment at TSS of Per1 and Npy genes in the arcuate nucleus

Finally, to determine whether CORT exposure is necessary and sufficient to induce increased transcription rate of the Npy gene, we performed a reductionist experiment to test the effect of an acute CORT treatment at ZT2. Adrenalectomized rats were treated with an acute subcutaneous injection of either CORT (3 mg/kg)-HBC-Saline or HBC-Saline (Vehicle control) at ZT1, then exactly one hour later at ZT2, the rats were euthanized and hypothalamic arcuate nucleus regions dissected and fixed for ChIP assay (Fig. 8a). As expected, plasma CORT concentrations were extremely low in adrenalectomized rats, and consistently elevated at 1 h after CORT injection (Fig. 8b). As a positive control to confirm CORT-responsiveness within the arcuate nucleus, GR binding at the hypersensitive Per1 GRE was first tested. The acute CORT treatment was seen to induce a robust increase of 15.58 ± 3.07 fold change in GR detected at the Per1 GRE (Fig. 8c). Unpaired t test indicated the change to be statistically significant (p = 0.0019). A concomitant robust increase of 16.63 ± 2.49 fold change in pSer5 RNA Pol2 enrichment at Per1 TSS was similarly statistically significant (p = 0.0010) (Fig. 8d). For GR binding at a relatively less well-characterized GRE, which has been described at a site upstream of the Npy gene¹⁶, a fold change of 6.77 ± 1.32 in CORT-inducibility was also found to be statistically significant (p = 0.0015) (Fig. 8e). A concomitant increase of 3.82 ± 1.13 fold change in pSer5 RNA Pol2 enrichment at Npy TSS was also found to be statistically significant (p = 0.0106) (Fig. 8f) indicating that acute CORT exposure at ZT2 was necessary and sufficient to induce GR binding at the Npy gene’s upstream GRE and increased pSer5 Pol2 occupancy at the Npy gene’s TSS.

Discussion

We have demonstrated that desynchronizing circulating CORT rhythms from daily light cues has a significant impact on feeding behaviour. The timing of food intake was significantly affected when CORT exposure was out-of-phase with light:dark cues, resulting in a profound shift in time of eating. Notably, we found increased appetitive behaviour during the inactive phase of the day in the out-of-phase group. The altered profile in food intake was associated with aberrant timing in the regulation of orexigenic and anorexigenic neuropeptides in the hypothalamus. Circadian activity profiles remained entrained by daily light:dark cues, along with maintenance of entrained oscillations of clock genes in the suprachiasmatic nucleus and Hcrt in the lateral hypothalamic area, irrespective of CORT rhythm. To our knowledge, this study provides the first evidence that synchronization of environmental daily light:dark cues with the ‘endogenous’ circulating CORT profile in rats is essential for maintaining appetitive behaviour for increased food consumption during the active phase and decreased food consumption during the inactive phase.

Although food intake is often considered a homoeostatic behaviour, there is less understanding how food intake may act as an automatic response to an acute shortage of energy. As food intake mainly occurs during the dark period in nocturnal animals when under ad libitum fed conditions, onset of the ‘lights off’ signal is considered as one of the possible major factors that drives food intake¹⁷. However, the amount of food consumption is generally determined by numerous hormones and neuropeptides which are secreted both in the central nervous system and other peripheral organs in response to digested nutrients^18,19,20, and importantly, other factors such as stress, learning, and palatability, which all affect the amount and timing of food intake²¹.

In the present study, the total amount of food consumed per day was similar between the in-phase, out-of-phase, and sham-operated control groups. Importantly for our study design, the relative food intake during the active versus inactive periods was comparable between in-phase and control groups, strongly indicating that our programmed CORT infusion pattern, which was modelled on adrenal-intact rats, faithfully recapitulated a physiologically realistic endogenous CORT secretion pattern. Interestingly, rats in the out-of-phase group ate continuously, even during the inactive period. Although CORT exposure was expected to induce feeding¹⁴, food intake still occurred during the active phase, potentially indicating that when daily light cues are misaligned to CORT levels there is a continued drive to eat throughout the inactive as well as the active phase.

The results of ISHH, with regard to the feeding regulating neuropeptides in the hypothalamus, were also consistent with our hypothesis based on previous work. The orexigenic neuropeptide transcripts (Npy, Agrp and Pmch) were significantly up-regulated at ZT13 in both in-phase and control groups, as they ate much more during the dark period, ZT12–ZT24, compared to ZT0–ZT12. However, in the out-of-phase group, the observed reversed expression pattern of Npy, Agrp and Pmch would most certainly be the cause of decreased food consumption during dark period. For the anorexigenic neuropeptide transcripts (Pomc and Cart), food consumption would be expected to increase when their expression decreased. A previous study has shown that CORT directly binds to glucocorticoid type II receptors (GRs) expressed by NPY producing neurons to directly induce Npy gene expression, peptide synthesis, receptor activity, and NPY-induced feeding¹⁴. There is also abundant expression of GRs in the arcuate nucleus and lateral hypothalamic area. However no co-localization was observed in melanin-concentrating hormone neurons²². Thus, CORT most likely influences NPY, AgRP, POMC, and CART neurons by direct actions, whereas gene expression of Pmch is more likely influenced indirectly via a negative feedback mechanism of the positive or negative energy balance.

At the cellular level, two major subsets of arcuate nucleus neurons that co-express NPY and AgRP were found to have abundant GR expression and exhibit electrophysiological and transcriptional CORT responsiveness^23,24,25. Furthermore, an ambitious study by Leon-Mercado et al²⁶ assessing a novel function of the arcuate nucleus in negative feedback of the HPA axis, used local arcuate nucleus microdialysis with mineralocorticoid receptor (MR) and GR antagonists during either the circadian nadir or circadian peak. They found that arcuate nucleus sensitivity to CORT stimulation was GR dominant during the active time of day, consistent with the notion of a principle role for GR in these AgRP/NPY neurons. While functionally distinct from the regulation of feeding behaviour assessed in our study, the findings of Leon-Mercado et al²⁶ are consistent with a primary role for GR in AgRP/NPY circadian regulation of appetitive behaviour.

Interestingly, we also found Agrp expression was significantly altered in the out-of-phase treatment group. The regulation of Agrp is known to be more complex than that of Npy, with the fasting-induced brain-specific homeobox factor Bsx required to act together with GR to induce Agrp transcription²⁷. As feeding behaviour is altered with out-of-phase CORT exposure, any manipulation of fed/fasted state required to assess Agrp regulation would introduce a major confounding factor. Therefore, we have been unable to interrogate GR-specific regulation of Agrp in the context of our experimental question.

Our data clearly demonstrates corticosterone-inducible GR binding at a GRE site in the Npy promoter and concomitant increase in enrichment of pSer5 RNA Pol2 at the Npy TSS. Although there is data from the ‘dimerization mutant’ GRdim mouse²⁸ suggesting Npy regulation may not need GR²⁷, more recent data has revealed that the GRdim model is in fact functional in certain contexts^29,30,31,32, which is further supported by our current data.

This evidence for GR’s involvement in the transcriptional regulation of Npy in the arcuate nucleus does not preclude an additional involvement of the MR since both GR and MR are highly expressed in the arcuate nucleus^33,34,35. However, because MR has 10 fold higher affinity for CORT than GR it is near maximally bound even at low CORT levels circulating during the circadian nadir, while in contrast the lower affinity GR becomes activated with the higher CORT levels of an ultradian pulse peak within the circadian active phase^36,37,38,39 and therefore provides a more responsive and dynamic sensor of fluctuating CORT levels over the day. Accordingly, GR is generally thought to be more likely to initiate transcriptional responses to higher CORT levels. Therefore, while it seems unlikely that the changes in appetitive behaviour are solely MR-mediated, it is possible that MR is involved in augmenting GR’s transcriptional action on Npy, by acting in complex with GR in a manner similar to that described by Rivers et al⁴⁰.

With regards to the physiological data, drinking profiles were similar among the groups, even for the out-of-phase group (S Fig. 2). It was expected that the fluid intake profile would be altered along with the food intake profile in the out-of-phase group, as rats normally drink more when they eat; an important physiological adaptation to maintain the integrity of the fluid compartment of the body and balance osmolytes from food^41,42. An experimental limitation to consider here, is that all adrenalectomized rats in the study were provided with 0.9% physiological saline instead of tap water for drinking, which is a requirement after adrenalectomy to maintain salt balance in the absence of adrenal mineralocorticoids^43,44. Although we cannot explain the dissociation of the two closely related behaviours of increased eating without increased drinking, we can conclude that CORT was involved in feeding but not in drinking behaviour in this study design at least.

It should be noted that no change in body weight, subcutaneous fat mass nor epididymal fat mass was observed (S Fig. 3), presumably because the 5-day time course of our study was too brief to see any difference in these metabolic parameters. A much longer experimental time course, potentially along with the choice of a more palatable high fat/high sugar diet would be required to see changes in parameters such as body weight and fat deposition. Nevertheless, the remarkably robust changes in feeding behaviour were evident immediately and remained consistent throughout each of the five days of the experiment.

The AM/PM differences found by ISHH of Crh in the paraventricular nucleus and Pomc in the anterior pituitary indicate that their circadian rhythm remained intact in all groups, which is consistent with the expected pattern from previous reports⁴⁵. However, Crh and Pomc mRNA expression, as well as circulating ACTH levels in the out-of-phase group were significantly elevated at ZT13 compared to the both in-phase and control groups at ZT13. Likely reflecting the lack of CORT-dependent negative feedback⁴⁶ at that time in the out-of-phase group.

The gene expression of Oxt and Avp exhibit AM/PM differences, as well as other feeding regulating neuropeptides in the hypothalamus^47,48,49. These molecules are regarded as anorexigenic peptides as many studies have demonstrated that OXT and AVP decrease food intake^50,51. The variation in expression of these genes was similar to those of anorexigenic neuropeptides in the arcuate nucleus. In addition, Itoi et al. have reported that gene expression of Oxt and Avp in the paraventricular nucleus were significantly downregulated by CORT exposure⁵², supporting our results.

Strikingly, the rats’ circadian activity profile remained normal even with out-of-phase CORT infusion. Circadian activity is mainly regulated by the master circadian clock in the suprachiasmatic nucleus as has been previously described⁵³. The suprachiasmatic nucleus has been reported to be relatively devoid of GR expression³³, potentially explaining the lack of change in circadian activity in our study. In support of this hypothesis, dysregulated CORT infusion pattern did not affect any clock genes in the suprachiasmatic nucleus. In addition, the gene expression of Hcrt in the lateral hypothalamic area, which plays an important physiological role in regulating the sleep-wake state⁵⁴ was not affected by dysregulated CORT infusion pattern. Taken together, these data indicate that suprachiasmatic nucleus mediated circadian activity is primarily regulated by light:dark cues, and is unaffected by CORT.

Intriguingly, the out-of-phase group experienced a significant elevation in CBT at a time coinciding with the high amplitude CORT pulses delivered at the start of the inactive phase. The elevated temperature could not be simply assigned to post-prandial hyperthermia, as we also found a similar temperature rise in fasting rats treated with an acute CORT treatment (S Fig. 6). While the precise mechanism of elevated temperature is yet to be resolved, it most likely involves a combination of central regulation of thermogenesis and downstream peripheral metabolic effects^{55,56,57,58,59}. Nevertheless, this represents an important finding, especially as a similar misalignment between daily activity cycles, body temperature and cortisol has recently been reported in nurses who work night shifts⁶⁰.

In conclusion, a normal circadian profile of CORT secretion is essential for appropriate timing of food intake. This has significant implications for human physiology in situations of shift work, jet lag, and chronic sleep disturbance; all of which have been found to be associated with adverse metabolic effects^61,62,63. Our data contribute to an improved understanding of the mechanisms underlying these metabolic effects and should help provide a framework for a rational approach for prevention of these disorders and for developing improved therapeutics.

Materials and methods

Animals and ethical approval

Adult male Sprague-Dawley (SD) rats (220–240 g, Harlan-Olac, Oxon, UK) were singly housed with ad libitum access to food and water or 0.9% physiological saline water. They were kept under 12:12 light/dark (light on at 08.00 h) with normal laboratory conditions. We have complied with all relevant ethical regulations for animal testing. All animal procedures were carried out in accordance with the ARRIVE guidelines^64,65, UK Home Office animal welfare regulations, and approved by written consent from the Animal Welfare and Ethical Review Body (University of Bristol).

Bilateral adrenalectomy, and implantation of intravenous cannulae and telemetry probes

Intravenous cannulation of the jugular vein was performed as described⁸. Briefly, after deep anaesthesia with isofluorane the right jugular vein was cannulated by inserting a polythene cannulae (Scientific Commodities, Lake Havasu City, Arizon, US). During the same surgery, bilateral adrenal glands were removed by the dorsal approach. A telemetry probe (Nanotag®, Kissei Comtec, Japan) that recorded both locomotor activity and core body temperature at 5 min intervals was implanted into the peritoneal cavity. Nonsteroidal anti-inflammatory drug (5 mg/kg of rimadyl®, Zoetis, U.S.A.) and glucose saline (100 ml/kg) were administered peri-operatively by subcutaneous injection. Animals were individually housed in specially designed twin-sensory cages (Tecniplast UK) with counter balanced tethers attaching the infusion cannulae to 360° mechanical swivels that allowed maximal freedom of movement. Animals had free access to food and 0.9% saline throughout the experiment. Sham-operated control rats were subjected to the same incisions as the adrenalectomized rats, but the adrenal glands were not removed.

CORT-HBC delivery by programmable infusion pump

A schematic pattern of the CORT-HBC (Sigma-Aldrich, U.S.A.) delivery can be found in Fig. 1. CORT-HBC was dissolved in 0.9% heparinized saline (10 U⁄mL heparin; CP Pharmaceuticals Ltd, UK). One day after surgery, at ZT12, animals were connected to an automated infusion system (Harvard syringe pump®, Harvard Apparatus, U.S.A.). The dose of CORT delivered was chosen to match average endogenous circulating CORT determined from our automated blood sampling system of adrenal-intact rats (S Fig. 1). Animals (n = 8 in each group) were infused with either in-phase or out-of-phase CORT (Fig. 1). Both groups were infused with the same total amount of CORT (area under the curve, 0.92 mg CORT over 24 h). Frequency of one portion of pulsatile infusion was 60 min with 20 min on-rate and 40 min off-rate.

Measurement of food intake

All rats were handled for 5 days before the experiment. They were housed in twin sensory cages 2 days before the surgery to habituate. One day following the surgery, CORT infusions started at ZT12, and measurement of food intake commenced. Food intake was measured manually every 12 h for 5 days.

Sample collection

After 5 days of CORT-HBC pulsatile infusion, rats were decapitated under terminal anaesthesia (inhalable isofluorane) and trunk blood, brains, and pituitaries were collected at ZT1 and ZT13 for further analysis. Blood samples were collected in 50 mL conical-bottom centrifuge tube containing ethylene diamine tetra acetic acid (0.5 M, pH 7.4) on ice. Brains and pituitaries were frozen immediately on dry ice.

Measurement of ACTH and CORT

Blood samples were centrifuged for 15 min at 4000 rpm at 4 °C. Plasma was stored at −70 °C until assayed. Plasma ACTH levels were determined, using 100 μL, via immunoradiometric assay (Diasorin Ltd., Dartford, UK) according to the manufacturer’s instructions. Total CORT was measured in the trunk blood plasma samples using our well established in house radio-immuno assay^8,66. Antiserum was kindly donated by G. Makara (Institute of Experimental Medicine, Budapest, Hungary). [125I]-corticosterone was obtained from Izotop (Institute of Isotopes Co. Ltd., Budapest, Hungary) with a specific activity of 2 mCi⁄mL. The sensitivity of the assay at the blood dilutions used was 1 ng⁄mL. All samples were processed in the same assay to exclude inter-assay variability. Intra-assay coefficients of variation are 2.8 and 7.3% for the ACTH and CORT assay, respectively⁹.

In situ hybridization histochemistry

Brains were cut into coronal 12 μm sections, and thaw mounted on gelatin/chrome alum-coated slides. The locations of the nuclei including the suprachiasmatic nucleus, supraoptic nucleus, paraventricular nucleus, arcuate nucleus, lateral hypothalamic area were determined according to the coordinates in the rat brain atlas⁶⁷. ³⁵S 3’-end-labelled deoxyoligonucleotide complementary probe sequences to transcripts encoding Per1, Per2, hnAvp, Avp, Oxt, Crh, Pomc, Cartpt, Npy, Agrp, Mch and Hcrt were used.

Per1:CTCTTGTCAGGAGGAATCCGGGGAGCTTCATAACCAGAGTGGATG

Per2:GTGGCCTTCCGGGATGGGATGTTGGCTGGGAACTCGCACTTTCTT

hnAvp:GCACTGTCAGCAGCCCTGAACGGACCACAGTGGTAC

Avp:CAGCTCCCGGGCTGGCCCGTCCAGCT

Oxt:CTCGGAGAAGGCAGACTCAGGGTCGCAGGC

Crh:CAGTTTCCTGTTGCTGTGAGCTTGCTGAGCTAACTGCTCTGCCCTGGC

Pomc:CTTCTTGCCCACCGGCTTGCCCCAGCAGAAGTGCTCCATGGACTAGGA

Cartpt:TGGGGACTTGGCCGTACTTCTTCTCATAGATCGGAATGCG

Npy:GGAGTAGTATCTGGCCATGTCCTCTGCTGGCGCGTC

Agrp:CGACGCGGAGAACGAGACTCGCGGTTCTGTGGATCTAGCACCTCTGCC

Pmch:CCAACAGGGTCGGTAGACTCGTCCCAGCAT

Hcrt:TTCGTAGAGACGGCAGGAACACGTCTTCTGGCGACA

Our well established ISHH protocol was used^41,68,69. Briefly sections were fixed in 4% (w/v) formaldehyde for 5 min and incubated in saline containing 0.25% (v/v) acetic anhydride and 0.1 M triethanolamine for 10 min. Sections were then dehydrated in ethanol, delipidated in chloroform, and partially rehydrated. Hybridization was carried out overnight at 37 °C in 45 μL of hybridization buffer under a Nescofilm (Bando Kagaku, Osaka, Japan) cover slip. A total count of 1 × 10⁵c.p.m. for Oxt and Avp transcripts, 1 × 10⁶c.p.m. for Per1, Per2, hnAvp, Crh, Pomc, Cartpt, Npy, Agrp, Pmch and Hcrt transcripts per slide were used for ISHH. After hybridization, sections were washed 4 times with SSC (150 mM NaCl and 15 mM sodium citrate) for 1 hour at 65 °C and for an additional hour with two changes of SSC at room temperature. Hybridized sections were exposed for autoradiography (Hyperfilm, Amersham, Bucks, UK) for 6 hours for Oxt probe, 12 hours for Avp probe, 5 days for Pmch and Hcrt probes, and 1 week for Per1, Per2, hnAvp, Crh, Pomc, Cartpt, Npy and Agrp probes. The amount of bound probe to mRNA was analysed in comparison to ¹⁴C-labelled standards (Amersham, Bucks, UK) using image analysis software (NIH Image 1.6.2, W.Rasband, NIH, Bethesda, MD, USA). The obtained results were represented in arbitrary units setting the mean optical density (OD) obtained from sham-operated control rats. Representative images are shown in our supplementary information (S Figs. 4, 5, and 7).

Chromatin immunoprecipitation assays: tissue collection

Adrenalectomized rats were injected with CORT-HBC (3 mg/kg; subcutaneous) at ZT1. After exactly 1 h post-injection, rats were decapitated under terminal anaesthesia (inhalable isofluorane) and brains dissected using a coronal brain matrix (Harvard apparatus) to collect 3mm² brain sections containing hypothalamic arcuate nucleus.

The tissue was immediately fixed according to our well established protocol^8,70 in 1% (v/v) formaldehyde (Sigma, UK), phosphate buffered saline (1.37 M NaCl, 2.68 mM KCl, 10.14 mM Na₂HPO₄, pH 7.4) solution for 10 min at room temperature. Formaldehyde cross-linking was quenched with addition of glycine (final conc. 125 mM) for 5 min and washed three times in ice cold phosphate buffered saline supplemented with 2 mM NaF, 0.2 mM sodium orthovanadate and 1X cOmplete protease inhibitor (Roche Diagnostics). Fixed tissue was stored at –70 °C in 500 μl of S1 Buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 15 mM MgCl₂, 0.1 mM (EDTA), pH 8) supplemented with 0.5 mM Dithiothreitol and 2 mM NaF, 0.2 mM sodium orthovanadate and 1X cOmplete protease inhibitor.

Chromatin immunoprecipitation assays: Chromatin fragmentation

Samples were thawed slowly on ice and adjusted to a final volume of 1 ml with supplemented S1 buffer and Dounce homogenized. Lysate was centrifuged at 2000xg (4 °C) and lysed in supplemented (2 mM NaF and 0.2 mM sodium orthovanadate and 1X cOmplete protease inhibitor) sodium dodecyl sulphate (SDS) lysis buffer (2% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.1)). Soluble chromatin was prepared according to a protocol developed in house^71,72 using MNase digestion [50 mM Tris-HCl, pH 7.5, 4 mM MgCl₂, 1 mM CaCl₂, 0.32 mM sucrose, 2 mM NaF, 0.2 mM NaVan] with 2 units of MNase (Sigma, UK)/180 μg chromatin.

Chromatin immunoprecipitation assay

ChIP buffers were prepared in house, as described in the EZ ChIP kit protocol (Upstate Bio- technology, Lake Placid, NY, USA) with some modifications for use with brain tissue. MNase digested chromatin was diluted to 50 μg in 100 μl of SDS lysis buffer and 0.9 ml with supplemented (2 mM NaF, 0.2 mM NaVan and 1X cOmplete protease inhibitor) ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl pH 8.1, 167 mM NaCl). After a pre-clearing step with protein A Dynabeads to reduce non-specific binding, samples were immunoprecipitated with either anti-GR antibody [2 μg; catalogue number 24050-1-AP (Proteintech)], anti-pSer5 RNA Pol2 [10 μl; catalogue number 39233 (ACTIVE MOTIF)] or normal rabbit IgG [2 μg; catalogue number 2729 S (Cell Signalling Technology)], incubated overnight at 4 °C. DNA-Protein-antibody complexes were captured by incubation with protein A Dynabeads for 4 h at 4 °C (Sigma-Aldrich, UK), followed by sequentially washes with 150 mM salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1), 500 mM salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1), LiCl buffer (0.25 M LiCl, 1% IGEPAL-CA630, 1% deoxycholic acid sodium salt, 1 mM EDTA, 10 mM Tris-HCl pH 8.1) and TE buffer (10 mM Tris-HCl, 1 mM EDTA pH 8.0). Complexes were eluted from the Dynabeads in 1% SDS 100 mM and 0.1 M NaHCO3. NaCl was added (300 mM final concentration) and crosslinks reversed overnight at 65 °C. RNA was removed using RNase treatment (Roche Diagnostics) at 65 °C and protein was digested using proteinase K (Ambion, Huntington, UK) after adjusting each solution with EDTA (1 mM final) and Tris-HCl (4 mM final) at 45 °C. DNA was extracted using 25:24:1 phenol-chloroform-isoamyl alcohol (Sigma, UK) followed by 24:1 chloroform-isoamyl alcohol (Sigma, UK). DNA in the aqueous phase was precipitated overnight at -20 °C in 2.5 VOL 100% ethanol and 20 μg glycogen (Sigma-Aldrich, UK). DNA was pelleted by centrifugation at 13,000 rpm, 4 °C and washed in 70% Ethanol (13,000 rpm, 4 °C), air dried and suspended in 40 μl nuclease free water (Ambion, Huntington, UK).

Quantitative real time PCR

RT-qPCR was performed using PowerUp SYBR Green Master Mix (A25742; Applied Biosystems) and the following primers:

rPer1_GRE_For: CCAAGGCTGAGTGCATGTC

rPer1_GRE_Rev: GCGGCCAGCGCACTA

rPer1_TSS_For: TGGCTGATGACACTGATGCAA

rPer1_TSS_Rev: GAGCTGAGTCCTTGCCATTG

rNpy_GRE_For: TAGACCGCATGTGGAGAACC

rNpy_GRE_Rev: TGGGTTTGAGTGAAAGGGGG

rNpy_TSS_For: CGCTCCATAAAAGCCCGTTG

rNpy_TSS_Rev: CTGCGAGGAATGAGCTCCAC

Statistics and reproducibility

All data shown are from individual rats (biological replicates; number of replicates are indicated in the figure legend for each experiment). Rats were randomly assigned in all experiments. The results were double-blinded in all experiments. All data were tested for normal distribution using D’Agnostino & Pearson, Anderson-Darling, Shapiro-Wilk and Kolmogorov-Smirnov tests, and found to pass normality test (alpha = 0.05) in at least one test. Data were then analysed by 2-WAY ANOVA, either with repeated measures for cumulative food and water intake, locomotor activity and body temperature, or ordinary 2-WAY ANOVA with time and treatment as the main factors for the ISHH data analyses. When a main effect of treatment or time, or an interaction between treatment and time was found by 2-WAY ANOVA, Bonferroni multiple comparison post-tests were performed to identify significant one-to-one differences between timepoints (within the same treatment) shown on the graphs as *p < 0.05, **p < 0.01, ***p < 0.001,****p < 0.0001 and significant differences between treatment (at the same timepoint) shown on the graphs as ^$p < 0.05, ^$$p < 0.01, ^$$$p < 0.001,^$$$$p < 0.0001. For the ChIP data, which measured CORT-induced effects relative to saline-treated controls, unpaired T Test with Welch’s correction for unequal variances was used, and significant differences were shown on the graphs *p < 0.05, **p < 0.01, ***p < 0.001,****p < 0.0001. In all cases, mean ± SEM was plotted graphically.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

All data supporting the findings of this study are available within the paper and in Supplementary Information (Supplementary Data 1). Further experimental data and materials are available from the corresponding author (or other sources, as applicable) upon reasonable request.

References

Droste, S. K. et al. Corticosterone levels in the brain show a distinct ultradian rhythm but a delayed response to forced swim stress. Endocrinology 149, 3244–3253, https://doi.org/10.1210/en.2008-0103 (2008).
Article CAS PubMed Google Scholar
Lightman, S. L. & Conway-Campbell, B. L. The crucial role of pulsatile activity of the HPA axis for continuous dynamic equilibration. Nat. Rev. Neurosci. 11, 710–718, https://doi.org/10.1038/nrn2914 (2010).
Article CAS PubMed Google Scholar
Qian, X., Droste, S. K., Lightman, S. L., Reul, J. M. & Linthorst, A. C. Circadian and ultradian rhythms of free glucocorticoid hormone are highly synchronized between the blood, the subcutaneous tissue, and the brain. Endocrinology 153, 4346–4353, https://doi.org/10.1210/en.2012-1484 (2012).
Article CAS PubMed PubMed Central Google Scholar
Russell, G. & Lightman, S. The human stress response. Nat. Rev. Endocrinol 15, 525–534, https://doi.org/10.1038/s41574-019-0228-0 (2019).
Article PubMed Google Scholar
Sarabdjitsingh, R. A. et al. Disrupted corticosterone pulsatile patterns attenuate responsiveness to glucocorticoid signaling in rat brain. Endocrinology 151, 1177–1186, https://doi.org/10.1210/en.2009-1119 (2010).
Article CAS PubMed Google Scholar
Stavreva, D. A. et al. Ultradian hormone stimulation induces glucocorticoid receptor-mediated pulses of gene transcription. Nat. Cell Biol. 11, 1093–1102, https://doi.org/10.1038/ncb1922 (2009).
Article CAS PubMed PubMed Central Google Scholar
Conway-Campbell, B. L., Pooley, J. R., Hager, G. L. & Lightman, S. L. Molecular dynamics of ultradian glucocorticoid receptor action. Mol. Cell Endocrinol 348, 383–393, https://doi.org/10.1016/j.mce.2011.08.014 (2012).
Article CAS PubMed Google Scholar
Flynn, B. P. et al. Corticosterone pattern-dependent glucocorticoid receptor binding and transcriptional regulation within the liver. PLoS Genet 17, e1009737, https://doi.org/10.1371/journal.pgen.1009737 (2021).
Article CAS PubMed PubMed Central Google Scholar
Sarabdjitsingh, R. A. et al. Stress responsiveness varies over the ultradian glucocorticoid cycle in a brain-region-specific manner. Endocrinology 151, 5369–5379, https://doi.org/10.1210/en.2010-0832 (2010).
Article CAS PubMed Google Scholar
Kalafatakis, K. et al. Ultradian rhythmicity of plasma cortisol is necessary for normal emotional and cognitive responses in man. Proc. Natl. Acad. Sci. USA 115, E4091–E4100, https://doi.org/10.1073/pnas.1714239115 (2018).
Article CAS PubMed PubMed Central Google Scholar
Dallman, M. F. et al. Minireview: glucocorticoids-food intake, abdominal obesity, and wealthy nations in 2004. Endocrinology 145, 2633–2638, https://doi.org/10.1210/en.2004-0037 (2004).
Article CAS PubMed Google Scholar
Sefton, C. et al. Elevated hypothalamic glucocorticoid levels are associated with obesity and hyperphagia in male mice. Endocrinology 157, 4257–4265, https://doi.org/10.1210/en.2016-1571 (2016).
Article CAS PubMed PubMed Central Google Scholar
Stamper, C. E. et al. Role of the dorsomedial hypothalamus in glucocorticoid-mediated feedback inhibition of the hypothalamic-pituitary-adrenal axis. Stress 18, 76–87, https://doi.org/10.3109/10253890.2015.1004537 (2015).
Article CAS PubMed PubMed Central Google Scholar
Leibowitz, S. F. & Wortley, K. E. Hypothalamic control of energy balance: different peptides, different functions. Peptides 25, 473–504, https://doi.org/10.1016/j.peptides.2004.02.006 (2004).
Article CAS PubMed Google Scholar
Akabayashi, A. et al. Hypothalamic neuropeptide Y, its gene expression and receptor activity: relation to circulating corticosterone in adrenalectomized rats. Brain Res. 665, 201–212, https://doi.org/10.1016/0006-8993(94)91339-0 (1994).
Article CAS PubMed Google Scholar
Misaki, N., Higuchi, H., Yamagata, K. & Miki, N. Identification of glucocorticoid responsive elements (GREs) at far upstream of rat NPY gene. Neurochem. Int. 21, 185–189, https://doi.org/10.1016/0197-0186(92)90145-h (1992).
Article CAS PubMed Google Scholar
Plata-Salamán, C. R. & Oomura, Y. Food intake dependence on acute changes in light schedule. Physiol. Behav. 41, 135–140, https://doi.org/10.1016/0031-9384(87)90143-0 (1987).
Article PubMed Google Scholar
Yoshimura, M. et al. Effects of food deprivation on the hypothalamic feeding-regulating peptides gene expressions in serotonin depleted rats. J. Physiol. Sci. 64, 97–104, https://doi.org/10.1007/s12576-013-0296-1 (2014).
Article CAS PubMed Google Scholar
Buss, J. et al. Associations of ghrelin with eating behaviors, stress, metabolic factors, and telomere length among overweight and obese women: preliminary evidence of attenuated ghrelin effects in obesity? Appetite 76, 84–94, https://doi.org/10.1016/j.appet.2014.01.011 (2014).
Article PubMed PubMed Central Google Scholar
Murray, S., Tulloch, A., Gold, M. S. & Avena, N. M. Hormonal and neural mechanisms of food reward, eating behaviour and obesity. Nat. Rev. Endocrinol 10, 540–552, https://doi.org/10.1038/nrendo.2014.91 (2014).
Article CAS PubMed Google Scholar
Adam, T. C. & Epel, E. S. Stress, eating and the reward system. Physiol Behav. 91, 449–458, https://doi.org/10.1016/j.physbeh.2007.04.011 (2007).
Article CAS PubMed Google Scholar
Drazen, D. L. et al. Differential effects of adrenalectomy on melanin-concentrating hormone and orexin A. Endocrinology 145, 3404–3412, https://doi.org/10.1210/en.2003-1760 (2004).
Article CAS PubMed Google Scholar
Shimizu, H. et al. Glucocorticoids increase neuropeptide Y and agouti-related peptide gene expression via adenosine monophosphate-activated protein kinase signaling in the arcuate nucleus of rats. Endocrinology 149, 4544–4553, https://doi.org/10.1210/en.2008-0229 (2008).
Article CAS PubMed Google Scholar
Shimizu, H. et al. Glucocorticoids increase NPY gene expression in the arcuate nucleus by inhibiting mTOR signaling in rat hypothalamic organotypic cultures. Peptides 31, 145–149, https://doi.org/10.1016/j.peptides.2009.09.036 (2010).
Article CAS PubMed Google Scholar
Gyengesi, E. et al. Corticosterone regulates synaptic input organization of POMC and NPY/AgRP neurons in adult mice. Endocrinology 151, 5395–5402, https://doi.org/10.1210/en.2010-0681 (2010).
Article CAS PubMed PubMed Central Google Scholar
Leon-Mercado, L. et al. The arcuate nucleus: A site of fast negative feedback for corticosterone secretion in male rats. eNeuro 4, ENEURO.0350–16.2017, https://doi.org/10.1523/eneuro.0350-16.2017 (2017).
Article CAS PubMed Google Scholar
Lee, B. et al. Brain-specific homeobox factor as a target selector for glucocorticoid receptor in energy balance. Mol. Cell Biol 33, 2650–2658, https://doi.org/10.1128/mcb.00094-13 (2013).
Article CAS PubMed PubMed Central Google Scholar
Reichardt, H. M. et al. DNA binding of the glucocorticoid receptor is not essential for survival. Cell 93, 531–541, https://doi.org/10.1016/s0092-8674(00)81183-6 (1998).
Article CAS PubMed Google Scholar
Timmermans, S., Vandewalle, J. & Libert, C. Dimerization of the glucocorticoid receptor and its importance in (patho)physiology: A primer. Cells 11, 683, https://doi.org/10.3390/cells11040683 (2022).
Article CAS PubMed PubMed Central Google Scholar
Presman, D. M. et al. DNA binding triggers tetramerization of the glucocorticoid receptor in live cells. Proc. Natl. Acad. Sci. USA 113, 8236–8241, https://doi.org/10.1073/pnas.1606774113 (2016).
Article CAS PubMed PubMed Central Google Scholar
Johnson, T. A., Paakinaho, V., Kim, S., Hager, G. L. & Presman, D. M. Genome-wide binding potential and regulatory activity of the glucocorticoid receptor’s monomeric and dimeric forms. Nat Commun 12, 1987, https://doi.org/10.1038/s41467-021-22234-9 (2021).
Article CAS PubMed PubMed Central Google Scholar
Presman, D. M. et al. Live cell imaging unveils multiple domain requirements for in vivo dimerization of the glucocorticoid receptor. PLoS Biol 12, e1001813, https://doi.org/10.1371/journal.pbio.1001813 (2014).
Article CAS PubMed PubMed Central Google Scholar
Morimoto, M., Morita, N., Ozawa, H., Yokoyama, K. & Kawata, M. Distribution of glucocorticoid receptor immunoreactivity and mRNA in the rat brain: an immunohistochemical and in situ hybridization study. Neurosci Res. 26, 235–269, https://doi.org/10.1016/s0168-0102(96)01105-4 (1996).
Article CAS PubMed Google Scholar
Nishi, M., Tanaka, M., Matsuda, K., Sunaguchi, M. & Kawata, M. Visualization of glucocorticoid receptor and mineralocorticoid receptor interactions in living cells with GFP-based fluorescence resonance energy transfer. J. Neurosci. 24, 4918–4927, https://doi.org/10.1523/jneurosci.5495-03.2004 (2004).
Article CAS PubMed PubMed Central Google Scholar
Han, F., Ozawa, H., Matsuda, K., Nishi, M. & Kawata, M. Colocalization of mineralocorticoid receptor and glucocorticoid receptor in the hippocampus and hypothalamus. Neurosci. Res. 51, 371–381, https://doi.org/10.1016/j.neures.2004.12.013 (2005).
Article CAS PubMed Google Scholar
Reul, J. M. & de Kloet, E. R. Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. Endocrinology 117, 2505–2511, https://doi.org/10.1210/endo-117-6-2505 (1985).
Article CAS PubMed Google Scholar
Reul, J. M., van den Bosch, F. R. & de Kloet, E. R. Differential response of type I and type II corticosteroid receptors to changes in plasma steroid level and circadian rhythmicity. Neuroendocrinology 45, 407–412, https://doi.org/10.1159/000124766 (1987).
Article CAS PubMed Google Scholar
De Kloet, E. R. et al. Plasticity and function of brain corticosteroid receptors during aging. Acta Endocrinol (Copenh) 125, 65–72 (1991).
PubMed Google Scholar
Birnie, M. T. et al. Circadian regulation of hippocampal function is disrupted with corticosteroid treatment. Proc. Natl. Acad. Sci. USA 120, e2211996120, https://doi.org/10.1073/pnas.2211996120 (2023).
Article CAS PubMed PubMed Central Google Scholar
Rivers, C. A. et al. Glucocorticoid receptor-tethered mineralocorticoid receptors increase glucocorticoid-induced transcriptional responses. Endocrinology 160, 1044–1056, https://doi.org/10.1210/en.2018-00819 (2019).
Article CAS PubMed PubMed Central Google Scholar
Yoshimura, M. et al. A role of nesfatin-1/NucB2 in dehydration-induced anorexia. Am. J. Physiol. Regul. Integr. Comp. Physiol. 307, R225–R236, https://doi.org/10.1152/ajpregu.00488.2013 (2014).
Article CAS PubMed Google Scholar
Watts, A. G. & Boyle, C. N. The functional architecture of dehydration-anorexia. Physiol Behav. 100, 472–477, https://doi.org/10.1016/j.physbeh.2010.04.010 (2010).
Article CAS PubMed PubMed Central Google Scholar
Berger, S., Bleich, M., Schmid, W., Greger, R. & Schütz, G. Mineralocorticoid receptor knockout mice: lessons on Na+ metabolism. Kidney Int. 57, 1295–1298, https://doi.org/10.1046/j.1523-1755.2000.00965.x (2000).
Article CAS PubMed Google Scholar
Bleich, M. et al. Rescue of the mineralocorticoid receptor knock-out mouse. Pflugers Arch 438, 245–254, https://doi.org/10.1007/s004240050906 (1999).
Article CAS PubMed Google Scholar
Spiga, F., Walker, J. J., Terry, J. R. & Lightman, S. L. HPA axis-rhythms. Compr. Physiol. 4, 1273–1298, https://doi.org/10.1002/cphy.c140003 (2014).
Article PubMed Google Scholar
Lightman, S. L., Birnie, M. T. & Conway-Campbell, B. L. Dynamics of ACTH and Cortisol Secretion and Implications for Disease. Endocr. Rev. 41, bnaa002, https://doi.org/10.1210/endrev/bnaa002 (2020).
Article PubMed PubMed Central Google Scholar
Devarajan, K. & Rusak, B. Oxytocin levels in the plasma and cerebrospinal fluid of male rats: effects of circadian phase, light and stress. Neurosci. Lett. 367, 144–147, https://doi.org/10.1016/j.neulet.2004.05.112 (2004).
Article CAS PubMed Google Scholar
Trudel, E. & Bourque, C. W. Circadian modulation of osmoregulated firing in rat supraoptic nucleus neurones. J. Neuroendocrinol 24, 577–586, https://doi.org/10.1111/j.1365-2826.2012.02298.x (2012).
Article CAS PubMed Google Scholar
Zhang, R., Lahens, N. F., Ballance, H. I., Hughes, M. E. & Hogenesch, J. B. A circadian gene expression atlas in mammals: implications for biology and medicine. Proc. Natl. Acad. Sci. USA 111, 16219–16224, https://doi.org/10.1073/pnas.1408886111 (2014).
Article CAS PubMed PubMed Central Google Scholar
Yoshimura, M. et al. Activation of endogenous arginine vasopressin neurons inhibit food intake: by using a novel transgenic rat line with DREADDs system. Sci Rep 7, 15728, https://doi.org/10.1038/s41598-017-16049-2 (2017).
Article CAS PubMed PubMed Central Google Scholar
Maejima, Y. et al. Nesfatin-1-regulated oxytocinergic signaling in the paraventricular nucleus causes anorexia through a leptin-independent melanocortin pathway. Cell Metab 10, 355–365, https://doi.org/10.1016/j.cmet.2009.09.002 (2009).
Article CAS PubMed Google Scholar
Itoi, K. et al. Genome-wide analysis of glucocorticoid-responsive transcripts in the hypothalamic paraventricular region of male rats. Endocrinology 160, 38–54, https://doi.org/10.1210/en.2018-00535 (2019).
Article CAS PubMed Google Scholar
Mohawk, J. A., Green, C. B. & Takahashi, J. S. Central and peripheral circadian clocks in mammals. Annu. Rev. Neurosci. 35, 445–462, https://doi.org/10.1146/annurev-neuro-060909-153128 (2012).
Article CAS PubMed PubMed Central Google Scholar
Piper, D. C., Upton, N., Smith, M. I. & Hunter, A. J. The novel brain neuropeptide, orexin-A, modulates the sleep-wake cycle of rats. Eur. J. Neurosci. 12, 726–730, https://doi.org/10.1046/j.1460-9568.2000.00919.x (2000).
Article CAS PubMed Google Scholar
Rothwell, N. J. CNS regulation of thermogenesis. Crit Rev. Neurobiol 8, 1–10 (1994).
CAS PubMed Google Scholar
Morrison, S. F., Madden, C. J. & Tupone, D. Central neural regulation of brown adipose tissue thermogenesis and energy expenditure. Cell Metab. 19, 741–756, https://doi.org/10.1016/j.cmet.2014.02.007 (2014).
Article CAS PubMed PubMed Central Google Scholar
Shi, Y. C. et al. Arcuate NPY controls sympathetic output and BAT function via a relay of tyrosine hydroxylase neurons in the PVN. Cell Metab. 17, 236–248, https://doi.org/10.1016/j.cmet.2013.01.006 (2013).
Article CAS PubMed Google Scholar
Tupone, D., Madden, C. J., Cano, G. & Morrison, S. F. An orexinergic projection from perifornical hypothalamus to raphe pallidus increases rat brown adipose tissue thermogenesis. J. Neurosci. 31, 15944–15955, https://doi.org/10.1523/jneurosci.3909-11.2011 (2011).
Article CAS PubMed PubMed Central Google Scholar
Bhave, V. M. & Nectow, A. R. The dorsal raphe nucleus in the control of energy balance. Trends Neurosci. 44, 946–960, https://doi.org/10.1016/j.tins.2021.09.004 (2021).
Article CAS PubMed Google Scholar
Bracci, M. et al. Peripheral skin temperature and circadian biological clock in shift nurses after a day off. Int. J. Mol. Sci. 17, 623, https://doi.org/10.3390/ijms17050623 (2016).
Article PubMed PubMed Central Google Scholar
Ye, B. J. Association between shift work and metabolic syndrome: A 4-year retrospective cohort study. Healthcare (Basel) 11, 802, https://doi.org/10.3390/healthcare11060802 (2023).
Article PubMed Google Scholar
Bouman, E. J. et al. The association between social jetlag and parameters of metabolic syndrome and type 2 diabetes: a systematic review and meta-analysis. J. Sleep Res. 32, e13770, https://doi.org/10.1111/jsr.13770 (2023).
Article PubMed Google Scholar
Hu, J. et al. Association of sleep duration and sleep quality with the risk of metabolic syndrome in adults: a systematic review and meta-analysis. Endokrynol Pol. 73, 968–987, https://doi.org/10.5603/EP.a2022.0058 (2022).
Article PubMed Google Scholar
Percie du Sert, N. et al. The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. BMJ Open Sci. 4, e100115, https://doi.org/10.1136/bmjos-2020-100115 (2020).
Article PubMed PubMed Central Google Scholar
Kilkenny, C., Browne, W. J., Cuthill, I. C., Emerson, M. & Altman, D. G. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. PLoS Biol 8, e1000412, https://doi.org/10.1371/journal.pbio.1000412 (2010).
Article CAS PubMed PubMed Central Google Scholar
Conway-Campbell, B. L. et al. Proteasome-dependent down-regulation of activated nuclear hippocampal glucocorticoid receptors determines dynamic responses to corticosterone. Endocrinology 148, 5470–5477, https://doi.org/10.1210/en.2007-0585 (2007).
Article CAS PubMed Google Scholar
Paxinos, G. The Rat Brain in Stereotaxic Coordinates Fourth Edition. (1998).
Yoshimura, M. et al. The gene expression of the hypothalamic feeding-regulating peptides in cisplatin-induced anorexic rats. Peptides 46, 13–19, https://doi.org/10.1016/j.peptides.2013.04.019 (2013).
Article CAS PubMed Google Scholar
Nishimura, H. et al. Endogenous oxytocin exerts anti-nociceptive and anti-inflammatory effects in rats. Commun Biol. 5, 907, https://doi.org/10.1038/s42003-022-03879-8 (2022).
Article CAS PubMed PubMed Central Google Scholar
Pooley, J. R. et al. Genome-wide identification of basic helix-loop-helix and NF-1 motifs underlying GR binding sites in male rat Hippocampus. Endocrinology 158, 1486–1501, https://doi.org/10.1210/en.2016-1929 (2017).
Article CAS PubMed PubMed Central Google Scholar
Stubbs, F. E. et al. Identification of a novel GR-ARID1a-P53BP1 protein complex involved in DNA damage repair and cell cycle regulation. Oncogene 41, 5347–5360, https://doi.org/10.1038/s41388-022-02516-2 (2022).
Article CAS PubMed PubMed Central Google Scholar
Stubbs, F. E., Birnie, M. T., Biddie, S. C., Lightman, S. L. & Conway-Campbell, B. L. SKOV3 cells containing a truncated ARID1a protein have a restricted genome-wide response to glucocorticoids. Mol. Cell Endocrinol 461, 226–235, https://doi.org/10.1016/j.mce.2017.09.018 (2018).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This paper was supported by a Grant-in-Aid for Scientific Research (C) (21K06779) KAKENHI for M.Y. from the Ministry of Education, Culture, Sports, Science, and Technology (MEXT), Japan; and a University of Occupational and Environmental Health (UOEH) Grant-in-Aid for Priority Research in the Field of Occupational Medicine (2021, 2022) for M.Y. from the UOEH, Japan. S.L., B.CC., B.F., Y.K., Z.Z. were supported by United Kingdom Medical Research Council grant MR/R010919/1. Costs of all animal work and experimental reagents and consumables were supported by United Kingdom Medical Research Council grant MR/R010919/1.

Author information

These authors jointly supervised this work: Stafford L. Lightman and Becky L. Conway-Campbell.

Authors and Affiliations

Translational Health Sciences, Bristol Medical School, University of Bristol Dorothy Hodgkin Building, Whitson Street, Bristol, BS1 3NY, UK
Mitsuhiro Yoshimura, Benjamin P. Flynn, Yvonne M. Kershaw, Zidong Zhao, Stafford L. Lightman & Becky L. Conway-Campbell
Department of Physiology, University of Occupational and Environmental Health, Japan 1-1 Iseigaoka, Yahatanishi-ku, Kitakyushu, 807-8555, Japan
Mitsuhiro Yoshimura & Yoichi Ueta

Authors

Mitsuhiro Yoshimura
View author publications
You can also search for this author in PubMed Google Scholar
Benjamin P. Flynn
View author publications
You can also search for this author in PubMed Google Scholar
Yvonne M. Kershaw
View author publications
You can also search for this author in PubMed Google Scholar
Zidong Zhao
View author publications
You can also search for this author in PubMed Google Scholar
Yoichi Ueta
View author publications
You can also search for this author in PubMed Google Scholar
Stafford L. Lightman
View author publications
You can also search for this author in PubMed Google Scholar
Becky L. Conway-Campbell
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

This study was designed by M.Y^1,2, B.F.¹, B.CC.¹. Experiments were performed by M.Y.^1,2, B.F.¹, Y.K.¹, Z.Z.¹, and B.CC.¹. Data were analysed and interpreted by M.Y.^1,2, B.CC.¹, Y.U.², and S.L.¹. Draft and Figures are prepared by M.Y.^1,2 and B.CC¹. Final Approval was made by S.L.¹. All authors approved the final version of the manuscript and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy. All authors designated as authors qualify for authorship, and all those who qualify for authorship are listed.

Corresponding author

Correspondence to Becky L. Conway-Campbell.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Communications Biology thanks Mariana Astiz and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Primary Handling Editors: Karli Montague-Cardoso and Christina Karlsson Rosenthal. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Copyright Permission

License Agreement between Dr Becky L. Conway-Campbell / University of Bristol and Copyright Clearance Centre, Inc. (“CCC”) on behalf of Elsevier Science & Technology Journals for use of image/photo/illustrations from ‘The rat brain in stereotaxic coordinates’⁶⁷ (Fourth edition, published 01/01/1998). License ID 1394840-1. ISBN-13. 9780125476195.

Supplementary information

Peer Review File

Supplementary Information

Description of Additional Supplementary Files

Supplementary Data 1

Reporting Summary

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Yoshimura, M., Flynn, B.P., Kershaw, Y.M. et al. Phase-shifting the circadian glucocorticoid profile induces disordered feeding behaviour by dysregulating hypothalamic neuropeptide gene expression. Commun Biol 6, 998 (2023). https://doi.org/10.1038/s42003-023-05347-3

Download citation

Received: 05 October 2021
Accepted: 12 September 2023
Published: 29 September 2023
DOI: https://doi.org/10.1038/s42003-023-05347-3

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.