The generation of neutrophils in the bone marrow is controlled by autophagy

Rožman, S; Yousefi, S; Oberson, K; Kaufmann, T; Benarafa, C; Simon, H U

doi:10.1038/cdd.2014.169

Download PDF

Original Paper
Published: 17 October 2014

The generation of neutrophils in the bone marrow is controlled by autophagy

S Rožman¹,
S Yousefi¹,
K Oberson¹,
T Kaufmann ORCID: orcid.org/0000-0001-9906-874X¹,
C Benarafa ORCID: orcid.org/0000-0002-2049-7769^2,3 &
…
H U Simon¹

Cell Death & Differentiation volume 22, pages 445–456 (2015)Cite this article

8079 Accesses
89 Citations
10 Altmetric
Metrics details

Subjects

Inflammation

Abstract

Autophagy has been demonstrated to have an essential function in several cellular hematopoietic differentiation processes, for example, the differentiation of reticulocytes. To investigate the role of autophagy in neutrophil granulopoiesis, we studied neutrophils lacking autophagy-related (Atg) 5, a gene encoding a protein essential for autophagosome formation. Using Cre-recombinase mediated gene deletion, Atg5-deficient neutrophils showed no evidence of abnormalities in morphology, granule protein content, apoptosis regulation, migration, or effector functions. In such mice, however, we observed an increased proliferation rate in the neutrophil precursor cells of the bone marrow as well as an accelerated process of neutrophil differentiation, resulting in an accumulation of mature neutrophils in the bone marrow, blood, spleen, and lymph nodes. To directly study the role of autophagy in neutrophils, we employed an in vitro model of differentiating neutrophils that allowed modulating the levels of ATG5 expression, or, alternatively, intervening pharmacologically with autophagy-regulating drugs. We could show that autophagic activity correlated inversely with the rate of neutrophil differentiation. Moreover, pharmacological inhibition of p38 MAPK or mTORC1 induced autophagy in neutrophilic precursor cells and blocked their differentiation, suggesting that autophagy is negatively controlled by the p38 MAPK–mTORC1 signaling pathway. On the other hand, we obtained no evidence for an involvement of the PI3K-AKT or ERK1/2 signaling pathways in the regulation of neutrophil differentiation. Taken together, these findings show that, in contrast to erythropoiesis, autophagy is not essential for neutrophil granulopoiesis, having instead a negative impact on the generation of neutrophils. Thus, autophagy and differentiation exhibit a reciprocal regulation by the p38–mTORC1 axis.

Essential role of autophagy in protecting neonatal haematopoietic stem cells from oxidative stress in a p62-independent manner

Article Open access 18 January 2021

Selective activation of STAT3 and STAT5 dictates the fate of myeloid progenitor cells

Article Open access 28 July 2023

Blocking the CD47-SIRPα interaction reverses the disease phenotype in a polycythemia vera mouse model

Article Open access 24 April 2023

Main

Autophagy is an evolutionarily conserved mechanism, by which portions of cytoplasm are engulfed in a double-membrane structure, known as the autophagosome, and delivered to lysosomes for subsequent degradation. Autophagy is dependent on autophagy-related (ATG) proteins.¹ Autophagosome formation, elongation, and completion of enclosure require two ubiquitin-like conjugation systems: the first one generates the ATG5-ATG12 conjugate, which functions as a complex together with ATG16, and binds to the sequestering (pre-autophagosomal) phagophore. The second system conjugates an ATG8 homolog, LC3-I, with phosphatidylethanolamine to generate the lipidated LC3-II that associates with autophagosomes.^{2, 3, 4} The conversion of LC3-I into LC3-II represents a hallmark of autophagic activity and is widely used for the detection of autophagosome formation. Another frequently used marker for monitoring autophagic activity is p62, a protein, which is specifically degraded through autophagy.⁵

The vital role of autophagy in cell growth, development, and homeostasis has long been appreciated. Recent data also indicate its involvement in the differentiation of hematopoietic cells. For instance, the importance of autophagy for efficient differentiation of leukocytes has been demonstrated with lymphocytes,^{6, 7, 8} monocytes,⁹ and dendritic cells,¹⁰ as well as reticulocytes.^11,12 Since granulopoiesis in the bone marrow is characterized by significant morphological changes and the acquisition of a range of effector functions, we hypothesized that autophagy might have a crucial role in the differentiation of neutrophils.

ATG5 is an essential protein for the elongation of pre-autophagosomal structures and subsequent autophagosome formation. Therefore, it represents a suitable genetic target for blocking autophagy. Using this strategy, we demonstrate here that neutrophil differentiation is controlled by autophagy, which in turn is negatively regulated by the p38 signaling pathway. Surprisingly, and in contrast to differentiation in other non-granulocytic hematopoietic lineages, autophagy was downregulated during physiological neutrophil differentiation and its inappropriate induction delayed the differentiation process.

Results

Knocking out Atg5 in the neutrophil lineage is associated with neutrophilia in vivo

Because mice deficient for the gene encoding Atg5 die within a few days after birth,¹³ mice with a floxed Atg5 allele were generated¹⁴ to investigate the function of ATG5 in vivo in tissue-specific settings. We crossed mice bearing an Atg5^flox allele, in which exon 3 of the Atg5 gene is flanked by two loxP sequences (Atg5^flox/flox mice)¹⁴ with transgenic mice, expressing Cre recombinase under the control of the lysozyme 2 promoter, which is predominantly active in neutrophils, monocytes, and macrophages, but not in dendritic cells (Lyz2^Cre/Cre mice).¹⁵ Indeed, it has been earlier reported that macrophages of Atg5^flox/flox-Lyz2^Cre/Cre mice lack ATG5 expression and fail to kill intracellular pathogens.¹⁶ In this study, we used Atg5^flox/flox-Lyz2^Cre/Cre mice to study the effects of Atg5 deletion in the neutrophil lineage (designated Atg5^NΔ mice, henceforth). Atg5^flox/flox and Lyz2^Cre/Cre mice were used as controls throughout our experiments and are referred to as wild-type (WT) mice.

Mature bone marrow neutrophils of Atg5^NΔ mice displayed a complete Atg5 knockout at the mRNA level, though in immature neutrophil populations small amounts of Atg5 mRNA were detectable (Figure 1a). The latter might have been responsible for the traces of ATG5 protein barely detectable in mature bone marrow neutrophils (Figure 1b). The lack of ATG5 protein expression was at least partially specific for neutrophils, since neutrophil-depleted bone marrow cells clearly expressed ATG5 (Figure 1b). It should be noted, however, that a 70% reduction of ATG5 was also detectable in the neutrophil-depleted bone marrow fraction, most likely due to the presence of ATG5-deficient monocytes (mean 7.6%) and immature myelocytes (mean 4.7%), which demonstrated an incomplete reduction in ATG5 expression (Figure 1a). In addition, the neutrophil depletion was not complete in these experiments (10–12% remaining neutrophils).

Mature neutrophils from Atg5^NΔ mice exhibited reduced autophagic flux as assessed by p62 degradation (Figure 1b). Also, in contrast to WT neutrophils, mature neutrophils of Atg5^NΔ mice were unable to form autophagosomes, even when stimulated with rapamycin (Figure 1c). We conclude that mature neutrophils of Atg5^NΔ mice lack ATG5 and are autophagy deficient.

Autophagy-deficient, mature bone marrow neutrophils of Atg5^NΔ mice demonstrated a normal morphology and exhibited no difference in the release of granule proteins following in vitro activation as compared with neutrophils from WT mice (Supplementary Figure S1). In fact, we measured similar levels of cathepsin G (primary granules), lactoferrin (secondary granules), and MMP-9 (tertiary granules), suggesting that neutrophils of Atg5^NΔ mice contain the full spectrum of intact and fully matured granules after differentiation (Supplementary Figure S1).

We next measured neutrophil numbers and found elevated relative and absolute neutrophil numbers in the peripheral blood, lymph nodes, and spleen of Atg5^NΔ mice as compared with WT mice (Figure 2a,Supplementary Figure S2). In the bone marrow, relative, but not absolute neutrophil numbers were increased in association with the deficiency in neutrophil autophagy (Figure 2a,Supplementary Figure S2). It should be noted that monocyte/macrophage numbers did not significantly differ between Atg5^NΔ and WT mice (mean relative numbers of CD45⁺CD11b⁺CD115⁺ cells: bone marrow, 8.11 versus 7.64%; blood, 3.43 versus 3.52%; spleen, 2.5 versus 2.1%; and lymph nodes, 0.65 versus 0.48%). We also did not observe significant differences in the numbers of B cells (mean relative numbers of CD45^±B220^± cells: bone marrow, 25.9 versus 28.7%; blood, 48.2 versus 54.1%; spleen, 51.1 versus 50.7%; and lymph nodes, 44.1 versus 39.1%).

The differentiation of neutrophils is largely regulated by granulocyte colony-stimulating factor (G-CSF) and, to a lesser extent, by granulocyte/macrophage colony-stimulating factor (GM-CSF).^{17, 18, 19} Therefore, we analyzed serum levels of G-CSF and GM-CSF; these, however, did not differ between Atg5^NΔ and WT mice (Supplementary Figure S3a). Increased neutrophil numbers of Atg5^NΔ mice were associated with significant splenomegaly and an increase in the ratio between spleen weight and total mouse weight (Supplementary Figure S3b). Histological analysis of the spleen revealed that, as in WT mice, neutrophils of Atg5^NΔ mice resided in the red pulp of the spleen, particularly in close proximity to the white pulp, in the area adjacent to the marginal zone (Supplementary Figure S3c).

Neutrophils of WT and Atg5^NΔ mice were equally recruited to the peritoneal cavity following intraperitoneal injection of IL-8, suggesting that an ATG5 deficiency does not result in a defect in migration in response to chemoattractants (Supplementary Figure S4a). We also performed in vitro experiments to test whether ATG5-deficient neutrophils exhibit any functional defects. Analyzing the stimulated production of reactive oxygen species (ROS) by mature bone marrow neutrophils, as well as their capacity to phagocytose and to kill bacteria revealed no differences between Atg5^NΔ and WT mice (Supplementary Figure S4b–d), suggesting that ATG5 or autophagy in these cells is not required for their effector functions within the innate immune system.

Knocking out Atg5 in the neutrophil lineage is associated with increased and more rapid neutrophil production in vivo

We evaluated the proliferative status of neutrophil precursors in the bone marrow, using the Ki-67 marker, which is expressed in actively proliferating cells, but absent in resting cells (G₀).²⁰ At the early promyelocytic/myelocytic stages of neutrophil differentiation, it is known that cells rapidly proliferate, thus forming a pool of immature neutrophil precursors. The proliferation ceases as these cells mature into metamyelocytes, band cells, and segmented neutrophils.^21,22 The mitotic pool of immature neutrophil precursors in the bone marrow of Atg5^NΔ mice exhibited a significantly higher proliferation rate when compared with WT mice, whereas the proliferation rate of mature neutrophils was, as expected, comparably low in all genotypes (Figure 2b). Atg5 mRNA expression in these immature neutrophil populations was reduced by 75.3±18.9% compared with WT mice (Figure 1a). These data indicate that ATG5 limits proliferation of immature neutrophils under in vivo conditions.

To assess the kinetics of differentiation of neutrophil precursors in vivo, we examined the blood of WT and Atg5^NΔ mice after a pulse of ethynyl deoxyuridine (EdU), a nucleotide analog of thymidine that incorporates into the DNA of dividing cells.²³ EdU incorporation into the proliferating neutrophil precursors in the bone marrow allowed us to chase EdU⁺ neutrophils reaching the blood stream after maturation. The egress of EdU⁺ neutrophils of Atg5^NΔ mice from the bone marrow into the blood stream started already after 48 h and reached its peak at 72 h following the pulse (Figure 2c). In contrast, in WT mice, the maximum output of EdU⁺ neutrophils was detected after 96 h (Figure 2c). The observed earlier output of EdU⁺ neutrophils in Atg5^NΔ mice suggests an increased proliferation of the mitotic pool and an accelerated maturation of the post-mitotic pool of ATG5-deficient neutrophils as compared with normal neutrophils.

Autophagy is tightly linked to the survival of cells and their susceptibility to undergoing cell death. The kinetics of in vitro cell death, however, did not differ between ATG5-deficient and WT mature blood or bone marrow neutrophils (Supplementary Figure S5a and b). Both ATG5-deficient and WT mature bone marrow neutrophils could be protected from cell death by the addition of the broad spectrum caspase inhibitor Q-VD-OPh, indicating that apoptosis was the predominant form of cell death regardless of ATG5 expression levels (Supplementary Figure S5b). Taken together, our findings indicate that the lack of ATG5 in the neutrophil lineage results in a neutrophilia that is the consequence of both increased and accelerated, but cytokine-independent, neutrophil production, rather than being due to a reduced cell death.

ATG5 regulates neutrophil differentiation in vitro

To investigate whether the accelerated neutrophil production observed in Atg5^NΔ mice is direct, and if so, it’s underlying mechanism, we performed in vitro studies. To this end, we employed stem cell factor (SCF)-dependent conditional Hoxb8 neutrophils (Hoxb8 neutrophils, henceforth), which represent 4-hydroxytamoxifen (4-OHT)-regulated mouse neutrophil progenitors that undergo normal neutrophil differentiation upon Hoxb8 inactivation (Supplementary Figure S6a).^24,25 During the differentiation process, the cells upregulate expression of neutrophil cell surface markers, such as Gr-1 and CD11b, and concurrently downregulate the SCF receptor (c-KIT, CD117) (Supplementary Figure S6b). Gelatinase B/matrix metalloproteinase 9 (MMP-9) is an enzyme present in tertiary neutrophil granules, which are identified by their late appearance in myeloid differentiation.²⁶ As Hoxb8 neutrophil precursors mature, the expression of MMP-9 is gradually upregulated and no difference in MMP-9 expression levels was detectable as compared with primary mature bone marrow neutrophils after reaching full maturation (Supplementary Figure S6c). Hoxb8 neutrophils were also functionally competent and performed basic neutrophil effector functions, such as phagocytosis and ROS production, with no detectable difference as compared with primary mature bone marrow neutrophils (Supplementary Figure S6d), confirming previously published work.^24,25

We transduced Hoxb8 neutrophils with a lentiviral vector expressing Tet-regulated shRNA for the knockdown of Atg5 mRNA transcripts. In this inducible system, the shRNA Atg5 production was regulated by the presence or absence of doxycycline. Upon a 24-h doxycycline treatment, we observed an approximately 40% downregulation of Atg5 mRNA (Figure 3a). Moreover, ATG5 protein expression was reduced; similarly, autophagic activity decreased as reflected by reduced LC3-II and increased p62 levels, respectively (Figure 3b). The shRNA Atg5 Hoxb8 neutrophils were always compared with control Hoxb8 neutrophils, which had been transduced with a control shRNA vector. The control and Atg5-downregulated neutrophil progenitors were at the same stage of differentiation when kept in 4-OHT-containing culture medium, having the morphological and biomolecular characteristics of promyelocytes (Supplementary Figure S7a and b). After downregulating the expression of Atg5 (0.1 μg/ml doxycycline for 24 h), the differentiation process was initiated by removing 4-OHT. Immature Hoxb8 neutrophils with reduced ATG5 expression demonstrated an accelerated differentiation process as assessed by morphology (Figure 3c), as well as Gr-1 (Figure 3d) and MMP-9 expression (Figure 3e).

Next, using lentiviral transduction, we generated Atg5-overexpressing Hoxb8 neutrophils that were compared with Hoxb8 neutrophils transduced with a control empty vector (Figures 4a and b). Again, when kept in 4-OHT-containing culture medium, both neutrophil lines were at the same, promyelocytic stage of differentiation (Supplementary Figure S7c and d). The ATG5-overexpressing immature neutrophils exhibited increased autophagic activity compared with control Hoxb8 precursors, as was evident from increased LC3-II and reduced p62 levels, respectively (Figure 4b). After the initiation of the differentiation process, immature Hoxb8 neutrophils with increased ATG5 expression demonstrated a delayed differentiation process as assessed by morphology (Figure 4c), as well as Gr-1 (Figure 4d) and MMP-9 expression (Figure 4e). Taken together, these data suggest that ATG5, in modulating autophagy, impacts neutrophil differentiation in a cell autonomous manner.

Neutrophil differentiation is regulated by autophagy

The observation that ATG5 levels influence the process of neutrophil differentiation suggested that autophagy participates in the regulation of this process. To address this question, we analyzed Hoxb8 neutrophils during the differentiation process from promyelocytes to mature neutrophils. As assessed with LC3 and p62 immunoblotting, we found an increased autophagic activity in promyelocytes and myelocytes compared with later stages of neutrophil differentiation (Figure 5a). In fact, autophagy appeared to decline at day 3 after the initiation of the differentiation process (Figure 5a). By this time point, cells had largely matured into metamyelocytes and band cells (Supplementary Figure S6a). The lowest levels of autophagy were observed at day 5 (Figure 5a), a time point by which all cells had undergone terminal differentiation (Supplementary Figure S6a). These data support our observation that a reduction in ATG5 expression (and, thereby, a reduction in autophagy) promotes the differentiation process of neutrophils (Figure 3). The physiological process of autophagy during neutrophil differentiation, however, does not appear to be regulated by modulating ATG5 expression levels (Figure 5a). Similarly, the expression of Beclin 1 (ATG6) did not change significantly during neutrophil differentiation (Figure 5a).

Therefore, we searched for other candidates that might be regulating the process of autophagy during the differentiation of neutrophils. Mammalian target of rapamycin complex 1 (mTORC1) is known to be a key regulator of autophagy. mTORC1 activity inhibits autophagy and is regulated by availability of nutrients and growth factors and by other upstream signaling pathways.^27,28 We analyzed the activation level of mTORC1 by monitoring phosphorylation of p70S6 kinase (p70S6K), a well-characterized mTORC1 target that regulates protein synthesis by phosphorylating the S6 ribosomal protein.^29,30 In correlation with the observed decrease in autophagic activity during neutrophil differentiation, the levels of phosphorylated p70S6K increased as neutrophils matured (Figure 5a, lower panel).

To demonstrate functionally the importance of mTORC1 for regulation of autophagy and neutrophil differentiation, rapamycin was used to directly inhibit mTORC1. Indeed, rapamycin blocked mTORC1 and, as expected, induced autophagy (Figure 5b). As observed with ectopically ATG5-induced autophagy, rapamycin-induced autophagy also drastically blocked neutrophil differentiation as assessed by flow cytometric surface Gr-1 expression (Figure 5c). Similarly, trifluoperazine and carbamazepine, two other known autophagy-inducing drugs,^{31, 32, 33} also inhibited the differentiation of neutrophils (Supplementary Figure S8). In summary, autophagy appears to have a counter-regulatory role in the process of neutrophil differentiation.

Autophagy and neutrophil differentiation underlie a reciprocal regulation by p38

To determine the upstream signals responsible for an autophagic regulation of differentiation for neutrophil precursors, we studied several pathways converging at mTORC1. Class I phosphatidylinositide 3-kinases (PI3K-I) activate phosphoinositide dependent protein kinase-1 (PDK1) in the PI3K-I/PDK1/protein kinase B (AKT) signaling pathway, which is known to suppress autophagy by activating mTORC1.^34,35 However, we obtained no evidence for the activation of this pathway during differentiation of Hoxb8 neutrophils (Supplementary Figure S9a) and pharmacological inhibition of PI3K-I or AKT kinase had no effect on the generation of mature neutrophils as assessed by flow-cytometric surface Gr-1 expression (Supplementary Figure S9b).

On the other hand, mTORC1 can also be activated by the p38 MAPK cascade through inhibition of tuberin (TSC2), a critical negative regulator of mTORC1.³⁶ Indeed, the phosphorylation of p38 increased during differentiation of Hoxb8 neutrophils and was the highest in band cells and fully mature neutrophils (Figure 6a). Pharmacological inhibition of the p38 pathway with the specific p38 inhibitor PD169316 induced autophagy (Figure 6b) and drastically inhibited neutrophil differentiation as assessed by flow-cytometric surface Gr-1 expression (Figure 6c). Inhibiting the p38 pathway also caused the inhibition of p70S6K phosphorylation (Figure 6d), thus verifying mTORC1 as the molecular link between activated p38 and autophagy inhibition. In contrast to p38, ERK1/2 phosphorylation was reduced at later differentiation stages of Hoxb8 neutrophils (Figure 6a) and blocking the ERK1/2 signaling pathway with the ERK pathway inhibitor SD98059 had no effect on neutrophil differentiation (Figure 6c). In summary, these results demonstrate that neutrophil differentiation and autophagy are reciprocally regulated by the p38-mTORC1 pathway, whereas the PI3K and ERK signaling pathways do not seem to have a role.

Discussion

Although autophagy has been implicated in innate and adaptive immune responses,³⁷ its role in neutrophil biology has not been investigated previously. In this study, we report that ATG5-deficient neutrophils exhibit normal effector functions (ROS production, phagocytosis, granule protein release, and bacterial killing), at least under in vitro conditions. On the other hand, we demonstrate that autophagy contributes to the regulation of neutrophil numbers by modulating their production in the bone marrow. However, ATG5-deficient neutrophils do not display any differences in their survival and rates of spontaneous apoptosis. Delayed apoptosis in the presence of survival cytokines was also not dependent on the presence of ATG5. These data suggest that autophagy can modulate neutrophil numbers solely at the level of production, but not by regulating the apoptosis of mature neutrophils.

Using genetic and pharmacological, as well as combined in vivo and in vitro approaches, we show that autophagy limits and delays neutrophil differentiation, a finding that was largely unexpected, since previously published work consistently suggested an essential role for autophagy in the process of differentiation of multiple hematopoietic and non-hematopoietic cells. For instance, autophagy has been demonstrated to be required for organelle clearance during the differentiation of reticulocytes.^12,38 Similarly, B-cell differentiation was blocked at the pro-B cell stage in bone marrow in the absence of ATG5.⁸ ATG5-deficient B cells were also unable to differentiate to plasma cells.³⁹ Furthermore, autophagy is required during monocyte differentiation and acquisition of macrophage effector functions^9,40 as well as for megakaryocyte differentiation.⁴¹ Autophagy has also been shown to maintain hematopoietic stem cells.^{42, 43, 44} In addition, a requirement for autophagy in differentiation has been reported in non-hematopoietic cells, such as adipocytes^{45, 46, 47} and osteoblasts.⁴⁸

Differentiation is associated with rapid cellular changes. Our findings provoke the question: Why is such a cellular remodeling process not required during neutrophil differentiation as is obviously the case in other cell lineages? The major changes that appear during neutrophil differentiation are cytoplasmic granule formation and changes in nuclear morphology. We found no evidence that ATG5-deficient mature neutrophils obtained from Atg5^NΔ mice were different from mature neutrophils of WT mice in terms of granule composition or nuclear morphology. It is possible that the numbers of mitochondria are increased as a consequence of the absence of ATG5, but, even if this were to be the case, it did not affect neutrophil morphology or function. Perhaps, due to the relatively short life span of mature neutrophils, the removal of mitochondria is less crucial than with reticulocytes.^11,12 The short life span may also explain why mature neutrophils, as post-mitotic cells, apparently do not require active autophagy for cellular homeostasis as is, for example, the case in neurons.^14,49

Interestingly, it has been shown that the induction of autophagy is required for the differentiation of acute myeloid leukemia (AML) cells.^50,51 The accelerated differentiation might be explained, at least partially, by the autophagic degradation of the driving oncoprotein.⁵² The question arises, whether the induction of differentiation by autophagy regulators is differently regulated in AML cells than in healthy immature neutrophils, a possibility which, if true, could open up new avenues for treatment of AML. However, it has also been reported that inhibition of autophagy by chloroquine enhanced AML cell differentiation,⁵³ pointing to the possibility that AML cell and neutrophil differentiation are not really differently regulated, since in both cases differentiation seems to be promoted by a reduction in autophagy.

Although the data obtained in Atg5^NΔ mice clearly indicate that autophagy is not required for the later differentiation processes of neutrophils, our Hoxb8 neutrophil system allowed us to follow in detail the levels of autophagy associated with neutrophil differentiation, at least from the promyelocytic stage onwards until terminal differentiation. The highest autophagic activity was observed during early granulopoiesis, at the promyelocytic and myelocytic stages of differentiation. At the transition from myelocytes to metamyelocytes and in mature neutrophils, autophagy appeared to decline. Interestingly, these changes in autophagic activity were associated with increased p38 and decreased ERK1/2 phosphorylation levels. Using a pharmacological approach, we demonstrated that autophagy in neutrophils, and reciprocally in consequence, differentiation, are regulated by the p38–mTORC1 axis. Our data for the importance of p38 in the regulation of neutrophil differentiation are in agreement with previously published work demonstrating that the phosphatase Wip1 blocks the differentiation process of neutrophils through the inhibition of the p38 MAPK-STAT1 pathway.⁵⁴ In addition, neutropenia has been recognized as an important adverse event of rapamycin therapy,⁵⁵ pointing to the possibility that mTOR-regulated autophagy in neutrophil precursors is responsible for this phenomenon.

The proliferation of immature neutrophils at the promyelocytic/myelocytic stages inversely correlated with levels of autophagy under in vivo conditions. Previously published work reported that the deletion of Atg7 in the hematopoietic system results in a severe myeloproliferation,⁴³ a finding that supports the assumption that autophagy negatively regulates the proliferation of myeloid precursor cells. Moreover, similar observations have been made in melanoma cells,⁵⁶ as well as in lung and breast cancer cells.^57,58 Furthermore, autophagy and p38 have been demonstrated to have an important role in mediating senescence.^59,60 Similarly, ATG7, another protein essential for autophagosome formation, has been shown to be essential for cell-cycle arrest.⁶¹ The molecular mechanisms whereby autophagy mediates anti-proliferative effects remain unclear. However, modulation of key autophagic components such as ULK3, ATG5, or ATG7 has been shown to control senescence, possibly through feedback control of the PI3K-AKT-mTOR pathway.⁶² On the other hand, more direct effects of autophagy on the regulation of mitosis by degradation of active RHOA⁶³ or ATG5–survivin interactions in the nucleus⁶⁴ may also have a role. Moreover, both ATG5⁶⁵ and ATG7⁶¹ have been shown to increase p53 expression and/or function that could also have a role in the initiation of senescence.

Taken together, our findings indicate that autophagy negatively impacts on neutrophil differentiation. Interestingly, our work may explain why p73 knockout mice suffer from a general neutrophilic inflammation,⁶⁶ since these mice exhibit strongly reduced ATG5 levels in multiple cell lineages.⁶⁷ Reduced ATG5 levels in immature neutrophils clearly stimulate neutrophil production as demonstrated in this work. We further show that autophagy is regulated, at least partially, by the p38–mTORC1 signaling pathway. Autophagy-deficient neutrophils exhibit normal morphology and no evidence for a defect in granule protein release or a deregulation in apoptosis. Further work is required to rule out the possibility that autophagy-deficient neutrophils exhibit other functional abnormalities. Moreover, the potential for modulating autophagy in immature neutrophils with drugs should be explored as an option for normalizing neutrophil numbers under pathological conditions.

Materials and Methods

Antibodies

The antibodies used for immunoblotting were polyclonal rabbit anti-ATG5 (1 : 500; Novus Biologicals, LuBioScience GmbH, Lucerne, Switzerland), polyclonal rabbit anti-p62 (1 : 4000; Novus Biologicals), monoclonal mouse anti-LC3 (1 : 500; Nanotools, Teningen, Germany), monoclonal mouse anti-Beclin 1 (1 : 1000; Abgent, LuBioScience GmbH), polyclonal rabbit anti-MMP-9 (1 : 1000; Abcam, Cambridge, UK), and monoclonal mouse anti-GAPDH (1 : 5000; Millipore, Bedford, MA, USA). From Cell Signaling Technology (Danvers, MA, USA), we obtained the following antibodies for immunoblotting: monoclonal rabbit anti-phospho-p70S6K (1 : 500), monoclonal rabbit anti-p70S6K (1 : 500), polyclonal rabbit anti-phospho-p38 (1 : 1000), polyclonal rabbit anti-p38 (1 : 1000), monoclonal rabbit anti-phospho-ERK1/2 (1 : 1000), monoclonal rabbit anti-ERK1/2 (1 : 1000), polyclonal rabbit anti-phospho-PDK1 (1 : 1000), polyclonal rabbit anti-PDK1 (1 : 1000), polyclonal rabbit anti-phospho-Akt (1 : 1000), and polyclonal rabbit anti-Akt (1 : 1000). Horseradish peroxidase (HRP)-conjugated goat anti-mouse and HRP-conjugated donkey anti-rabbit antibodies were from GE Healthcare (Little Chalfont, UK). The antibodies against cell surface markers used for flow cytometry and cell sorting were all rat anti-mouse antibodies directed against CD45, Ly6G, CD11b, CD115, Gr-1, and c-KIT (all from Biolegend, Lucerna-Chem AG, Lucerne, Switzerland). The rat IgG2b, κ isotype control was from Biolegend (Lucerna-Chem AG). The polyclonal rabbit anti-Ki-67 for intracellular staining was from Abgent (LuBioScience GmbH) and the rabbit IgG isotype control was from Novus Biologicals. PerCP-conjugated goat-anti-rabbit antibody was from Santa Cruz Biotechnology (Santa Cruz, Labforce AG, Nunningen, Switzerland).

Reagents

RPMI-1640/GlutaMAX medium and penicillin/streptomycin were from Invitrogen (LuBioScience GmbH). All media were supplemented with 10% fetal calf serum (FCS) (GE Healthcare). Q-VD-OPh was from SM Biochemicals (Anaheim, CA, USA). β-Mercaptoethanol, 4-OHT, hexadimethrine bromide (polybrene) and puromycin were from Sigma-Aldrich (Buchs, Switzerland), doxycycline was from Clontech (Saint-Germain-en-Laye, France). Rapamycin was from LC Laboratories (Lucerna-Chem AG); trifluoperazine and carbamazepine were from Sigma-Aldrich; PD169316, PD98059, LY294002, and wortmannin were from Merck KGaA (Darmstadt, Germany); TGX-221 was from Cayman Chemical Company (Adipogen AG, Liestal, Switzerland); and SH-6 was purchased from Enzo Life Sciences (Lausen, Switzerland). Mouse SCF-secreting Chinese hamster ovary cells (CHO/SCF) were kindly provided by Dr Georg Häcker (University of Freiburg, Germany).

Mice

Atg5^flox/flox mice¹⁴ were kindly provided by Dr Christian Münz (University of Zurich, Switzerland). Lyz2^Cre/Cre mice (B6.129P2-Lyz2^tm1(cre)Ifo) were purchased from Jackson Laboratories (Bar Harbor, ME, USA) at backcross generation N6 and were further backcrossed to N10 with C57BL6/J mice.¹⁵ Atg5^flox/flox were crossed with Lyz2^Cre/Cre mice to obtain Atg5^flox/flox-Lyz2^Cre/Cre (Atg5^NΔ) mice. Atg5^flox/flox mice were genotyped as described.¹⁴ The animal studies were approved by Cantonal Veterinary Office of Bern, Switzerland.

Sample collection from mouse bone marrow, blood, spleen, and lymph node

All mice were analyzed between 8 and 12 weeks of age. Blood was collected from retro-orbital sinus of sedated mice, using heparinized disposable glass pipettes (Provet AG, Lyssach, Switzerland). Total leukocyte cell counts in blood were measured on a Scil Vet ABC hematology analyser (Horiba Medical, Montpellier, France). For serum preparation, the blood was left to clot for 2 h at room temperature and centrifuged (20 min, 3000 r.p.m., 4°C).

Bone marrow cells were collected by flushing the femur with 5 ml of medium (100 U/ml penicillin/100 μg/ml streptomycin, 1% FCS in PBS), using a 26-gauge needle, and filtering through a sterile 70-μm nylon cell strainer. Spleen samples were pressed through a sterile 70-μm nylon cell strainer with 5 ml of medium and erythrocytes were lysed for 10 min by adding nine parts of lysis buffer (0.16 M NH₄Cl, 0.01 M KHCO₃, 0.12 mM EDTA). Brachial and axillary lymph nodes were pressed through a sterile 70-μm nylon cell strainer with 2 ml of medium. Bone marrow, spleen, and lymph-node single-cell suspensions were then washed with medium and the cells counted with hemocytometer, using the Türk’s staining solution (Dr Grogg Chemie AG, Stettlen, Switzerland).

Primary bone marrow neutrophils were isolated by the negative selection technique, using an EasySep Mouse Neutrophil Enrichment Kit (Stemcell Technologies, Grenoble, France). Neutrophil purity was always higher than 93% and was assessed by staining with the Hematocolor Set (Merck KGaA) followed by light microscopy analysis.

Hoxb8 neutrophils

SCF-dependent conditional Hoxb8-immortalized neutrophil progenitor lines from WT mice were generated as described.^24,25 Undifferentiated Hoxb8 neutrophil precursor cells were kept in culture medium (RPMI-1640, supplemented with 10% FCS, 50 μM β-mercaptoethanol, 100 U/ml penicillin/100 μg/ml streptomycin, 5% of CHO/SCF cell conditioned medium (as a source of murine SCF), 100 nM 4-OHT). To set up differentiation, cells were washed two times with PBS and resuspended in differentiation medium (RPMI-1640, supplemented with 10% FCS, 50 μM β-mercaptoethanol, 100 U/ml penicillin/100 μg/ml streptomycin, 5% of CHO/SCF cell conditioned medium) in the absence of 4-OHT.

Flow cytometry and cell sorting

Heparinized blood (30 μl) was stained with fluorochrome-labeled monoclonal antibodies for cell-surface markers for 45 min on ice. After staining, erythrocytes were lysed for 10 min at room temperature (BD FACS Lysing Solution; BD Biosciences, San Jose, CA, USA), and cells were washed two times with washing buffer (1% FCS in PBS).

Single-cell suspensions from bone marrow, spleen, and lymph nodes, or Hoxb8 neutrophils (0.5–1 × 10⁶) were washed with 1 ml of washing buffer, blocked in the blocking solution (10% FCS, with 1% normal rat serum and 1% mouse serum in PBS) and stained with fluorochrome-labeled monoclonal antibodies for cell-surface staining for 45 min on ice.

For Ki-67 detection, the surface staining was followed by permeabilization of the cell membrane (CytoFix/CytoPerm; BD Biosciences). Cells were washed two times, incubated with Ki-67 antibody (2.5 μg/ml) or rabbit IgG isotype control (2.5 μg/ml) for 1 h on ice, washed again, and then stained with the secondary PerCP-conjugated goat-anti-rabbit antibody for 40 min on ice (15 μg/ml).

Flow cytometry was performed on BD FACSCalibur flow cytometer (BD, Heidelberg, Germany). Data were analyzed using the FloJo 7.6.5. software (Tree Star, Ashland, OR, USA).

Cell sorting of neutrophil precursors (CD45⁺CD11b⁺Ly6G^-CD115^-SSC^high) and GFP-positive Hoxb8 neutrophil precursors was done on the BD FACSAria cell sorter (BD).

EdU staining of cycling bone marrow cells and chase into the peripheral blood

Briefly, 100 μl of EdU (Invitrogen) at the final concentration of 2 mg/ml in PBS was injected intravenously in the retro-orbital plexus of anesthetized mice. Some mice were left untreated as controls. Blood was harvested at five different time points and total leukocyte counts were determined using Scil Vet ABC hematology analyser. Whole blood was stained with fluorochrome-conjugated surface antibodies against CD45 and Ly6G. EdU-positive cells in CD45⁺Ly6G⁺ population were then detected using the Click-iT EdU Imaging Kit (Invitrogen).

Quantitative real-time reverse transcription-PCR

Primary bone marrow-derived neutrophils, sorted neutrophil precursors, or Hoxb8 neutrophils were lysed with RNA Lysis buffer (Promega, Duebendorf, Switzerland) and stored at −80°C until PCR analysis. RNA was isolated with the SV Total RNA Isolation System (Promega). In all, 300 ng of total RNA was used for cDNA synthesis at 50°C for 1 h with SuperScript III Reverse Transcriptase (Invitrogen). The reverse transcription was followed by quantitative real-time PCR with the iCycler iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA), using the following mouse Atg5 primers (forward: 5'-CAC ACC CCT GAA ATG GCA TTA TCC-3′; reverse: 5'- AGC CTC AAC CGC ATC CTT GG-3′) and SYBR Green Supermix (Bio-Rad) for the detection of PCR products. The constitutively expressed housekeeping gene S18 was used to normalize the expression of Atg5.

Immunoblotting

Cell lysates of primary bone marrow-derived neutrophils, sorted neutrophil precursors, or Hoxb8 neutrophils were prepared by lysing the cells with the lysis buffer containing 50 mM Tris pH 7.4, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM EDTA, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 200 μM Na₃VO₄ and 1 mM PMSF in H₂O. Shortly before use, a protease inhibitor cocktail (Sigma-Aldrich) was added to the lysis buffer. Cells were lysed for 25 min on ice, with frequent vortexing. After the lysis, supernatants were collected following high-speed centrifugation (10 min, 13 000 r.p.m., 4°C). In all, 50 μg of protein was loaded on the 12% sodium dodecyl sulfate (SDS) polyacrylamide gel (Expedeon, Lucerna-Chem). The lysates were separated by electrophoresis under reducing conditions and transferred onto polyvinylidene difluoride (PVDF) membranes (Immobilon-P; Millipore, Carrigtwohill, Ireland). Membranes were blocked with 5% non-fat dry milk in Tris-buffered saline solution containing 0.1% Tween 20 (TBST) for 1 h and then incubated with primary antibodies (see Antibodies) in TBST and 5% non-fat dry milk at 4°C overnight. Membranes were washed using TBST and then incubated with the corresponding HRP-conjugated secondary antibodies and visualized by chemiluminescence (ECL Western Blotting Analysis System; GE Healthcare or Luminata Forte; Millipore Corporation, Billerica, MA, USA).

Detecting autophagosome formation by Autodot staining

Primary bone marrow-derived neutrophils were incubated on a coverslip in a 24-well plate (1 h, 37°C, 5% CO₂) at the concentration of 3 × 10⁶ cells/ml in 100 μl of RPMI-1640 medium, supplemented with 10% FCS. The cells were left untreated or stimulated with 100 nM rapamycin for 1 h. After the incubation, the medium was gently removed from the coverslip and the cells were stained with 100 μl of AUTOdot Autophagy Visualization Dye (0.15 mM monodansylpentane in PBS; Abgent) at 33°C for 15 min. The dye was gently removed and the cells were fixed with 4% paraformaldehyde solution for 5 min at room temperature, washed three times with 500 μl of PBS, mounted on a microscope slide with 3 μl mounting medium (Dako, Baar, Switzerland) and stored at 4°C overnight, protected from light. The slides were analyzed the next day by confocal laser scanning microscopy (Carl Zeiss AG, Jena, Germany) equipped with argon, blue diode, and helium-neon lasers. The intensity of the staining was analyzed by the ImageJ software (http://rsb.info.nih.gov/ij/) and calculated as the mean maximum fluorescence intensity of a cell. A hundred cells per condition were analyzed.

Lentiviral gene transfer

In all, 0.5 × 10⁶ Hoxb8 neutrophil precursors were resuspended in 500 μl of culture medium and transduced with custom mouse shRNA Atg5 lentiviral construct: pRSI-U6Tet-shm.Atg5_cust-UbiC-TetR-2A-TagGFP2-W (Cellecta, Mountain View, CA, USA) with the target sequence GCAGAACCATACTATTTGCTT, at the multiplicity of infection of 40. Control cells were transduced with an empty lentiviral construct: pRSI-U6Tet-sh-UbiC-TetR-2A-TagGFP2-W. After spin infection (1 h, 1500 r.p.m., 30°C) in the presence of polybrene (5 μg/ml), 1.5 ml of fresh culture medium was added to the cells. Three to five days after infection, the cells were sorted for GFP-positive population. Before setting up the differentiation, the expression of shRNA was induced by doxycycline treatment (100 ng/ml, 24 h). During differentiation, the doxycycline-containing medium was refreshed every 48 h.

Mouse Atg5 (Gene ID: 158508499, NM_053069) was sub-cloned in pRRL-cPPT-hPGK-mcs-WPRE vector with addition of GFP under ubiquitin promoter obtained from Dr Didier Trono (EPFL, Lausanne, Switzerland), using forward primer for mouse Atg5, containing a PmeI restriction site: 5′-GCG CGT TTA AAC ATG ACA GAT GAC AAA GAT GTG CTT CGA G-3′ and reverse primer, containing a NheI restriction site: 5′-GCG CGC TAG CTC AAT CTG TTG GCT GGG GGA CA-3′. Recombinant virus constructs were produced by calcium phosphate transfection together with the envelope vector PMD2.G and the packaging vectors psPAX2 for lentivirus (all provided by Dr Trono) into 293T cells. For virus stocks, the supernatant was collected 24, 48, and 72 h after transfection and cleared by passing through sterile 0.45 μM pore size filter and 10x concentrated at 4°C in a Beckman Coulter ultracentrifuge (Palo Alto, CA, USA) with the SW41-Ti rotor (90 min, 55 000 g). Pellets were resuspended in RPMI-1640, supplemented with 10% FCS, and aliquoted and stored at −80 °C. In all, 0.5 × 10⁶ Hoxb8 neutrophil precursors were resuspended in 500 μl of culture medium and transduced with the Atg5 lentivirus or the empty vector, at a multiplicity of infection of 25. After spin infection (1 h, 1500 r.p.m., 30°C) in the presence of polybrene (1 μg/ml), 1.5 ml of fresh culture medium was added to the cells. Two to three days after infection, the cells were sorted for GFP-positive population.

Pharmacological treatment of Hoxb8 neutrophils

Carbamazepine (10 μM), LY294002 (500 nM), PD169316 (1 μM), PD98059 (1 μM), rapamycin (100 nM), SH-6 (5 μM), TGX-221 (50 nM), trifluoperazine (500 nM), and wortmannin (30 nM) were added to the differentiation medium at the beginning of Hoxb8 neutrophil differentiation. At the indicated concentrations, none of the drugs induced cell death.

Histology

Spleens were harvested from WT and Atg5^NΔ mice, perfused with PBS, fixed in 4% paraformaldehyde for 24 h, and embedded in paraffin blocks. Histological transverse 4-μm sections of the spleen were deparaffinized, rehydrated, and stained with Naphtol AS-D Chloroacetate solution according to the instructions of the manufacturer (Naphtol AS-D Chloroacetate (Specific Esterase) Kit; Sigma-Aldrich).

G-CSF and GM-CSF immunoassays

The serum from WT and Atg5^NΔ mice was diluted 1 : 2 with Sample diluent (Bio-Rad) and pipetted into a 96-well plate. The magnetic bead-based immunoassay was carried out according to the instructions of the manufacturer (Bio-Plex Pro Mouse Cytokine Assay; Bio-Rad) and the read-out was performed on the Bio-Plex MAGPIX Multiplex Reader (Bio-Rad).

Degranulation assays

Primary bone marrow-derived neutrophils from WT and Atg5^NΔ mice were resuspended in RPMI-1640 at 10 × 10⁶ cells/ml and left to settle for 20 min. They were then pretreated with cytochalasin B (Sigma-Aldrich; 5 μg/ml; 5 min) and stimulated with Formyl-Methionyl-Leucyl-Phenylalanine (Sigma-Aldrich; 1 μM; 1 h). The supernatants were acquired following the centrifugation step (20 min, 2000 r.p.m., 4°C), aliquoted into three parts, and stored at −80°C until analysis. The granule content was determined by enzyme-linked immunosorbent assays (ELISAs) according to the instructions of the manufacturer. Cathepsin G ELISA Kit was from Qayee Biotechnology (Shanghai, China), lactoferrin ELISA Kit was from Blue Gene (Shanghai, China) and MMP-9 ELISA Kit was from USCN Life Science Inc. (Wuhan, China).

Cell death assays

Whole blood from WT and Atg5^NΔ mice was acquired into the heparin-coated blood collecting system (Sartedt, Nümbrecht, Germany) and incubated at 37°C, gently shaking, for 48 h. In all, 30 μl of blood was collected at different time points and erythrocytes were lysed by adding nine parts of lysis buffer (0.16 M NH₄Cl, 0.01 M KHCO₃, 0.12 mM EDTA). Following two washing steps (1% FCS in PBS), the cells were stained with anti-Ly6G antibody. Immediately before measurement, propidium iodide (Sigma-Aldrich) was added to stained blood samples at 10 μg/ml and viability was measured by flow cytometry.

Primary bone marrow-derived neutrophils from WT and Atg5^NΔ mice were cultured at 1 × 10⁶ cells/ml for the indicated times in the absence or presence of a broad spectrum caspase inhibitor Q-VD-OPh (10 μM), G-CSF (25 ng/ml; Peprotech, London, UK), GM-CSF (10 ng/ml; R&D Systems, Abingdon, UK), IL-3 (1 μg/ml; BD Biosciences), IL-5 (25 ng/ml; R&D Systems), anti-CD95 antibody (1 μg/ml; MBL International Corp., Woburn, MA, USA), TNF-α (10 ng/ml; R&D Systems), LPS (100 ng/ml; Sigma-Aldrich) and C5a (10 ng/ml; Hycult Biotech, Uden, The Netherlands) in complete culture medium (RPMI-1640, supplemented with 10% FCS, 100 U/ml penicillin/100 μg/ml streptomycin). Immediately before measurement, propidium iodide was added to cell suspension at 10 μg/ml and viability was measured by flow cytometry (BD FACSCalibur).

In vivo neutrophil recruitment

In all, 350 ng IL-8 (R&D Systems) in 1 ml PBS was injected in the peritoneal cavity of anesthetized mice. Some mice were treated with PBS alone and used as negative controls. After 4 h, the peritoneal cavity was washed twice with 5 ml of PBS, and both fractions pooled together. Total cell counts in peritoneal exudate were counted by hemocytometer, using the Türk’s staining solution. The percentage of neutrophils in the peritoneal exudate cells was determined by flow cytometry, whereby gating was done on the CD45⁺CD11b⁺Ly6G⁺ population (Supplementary Figure S2). The percentages were confirmed by a second method, staining with the Hematocolor Set and light microscopic analysis.

Phagocytosis assay

Fluoresbrite Polychromatic Red Microspheres (Polysciences, Inc., Warrington, PA, USA) were diluted with RPMI-1640 to attain the working concentration (2.5 × 10⁸ particles/ml). In all, 140 μl of working suspension was opsonized with 35 μl of mouse serum for 30 min (180 r.p.m., 37°C). Hoxb8 neutrophils and primary bone marrow-derived neutrophils (0.1 × 10⁶) were resuspended in 100 μl of RPMI-1640 medium, supplemented with 10% FCS and 25 μl of opsonized beads was then added to the cells. Simultaneously, 25 μl of non-opsonized beads was added to the second sample of cells and served as a negative control. The cells were incubated with the beads for 1 h (130 r.p.m., 37°C). Phagocytosis was stopped by adding 200 μl of ice-cold PBS with 0.02% EDTA to the cells. After one washing step with 400 μl of ice-cold PBS, the cells were analyzed by flow cytometry (BD FACSCalibur).

ROS production assay

In total, 0.25 × 10⁶ Hoxb8 neutrophils and primary bone marrow-derived neutrophils were resuspended in 200 μl of X-Vivo serum-free medium (Lonza, Verviers, Belgium). Cells were left untreated (negative control) or primed with GM-CSF (50 ng/ml; 20 min) and then stimulated with C5a (100 nM; 15 min). Simultaneously with C5a, dihydrorhodamine (Sigma-Aldrich) at the final concentration of 1 μM was added to the cells. ROS production was stopped by adding 200 μl of ice-cold PBS. Dihydrorhodamine oxidation was measured by flow cytometry (BD FACSCalibur).

Bacterial killing assay

Single colonies of Escherichia (E.) coli GFP M 91655 were cultured in Luria broth base (LB) medium (Sigma) at 37°C, shaking at 220 r.p.m. overnight. Bacterial cultures were diluted 1 : 100 in LB medium, then grown to mid-logarithmic growth phase (OD₆₀₀=0.7) and centrifuged at 1000x g for 5 min. Bacterial pellets were washed twice in 1 x Hank’s Balanced Salt Solution (HBSS; LuBioScience GmbH) and gently spun at 100 xg for 5 min to remove any clumped bacteria. Bacteria were opsonized with 10% mouse sera (heat-inactivated) in 1 x HBSS, rotating end-over-end (6 r.p.m.) for 20 min at 37°C, and then used immediately. The bacterial killing assay was performed as previously described.⁶⁸ Briefly, primary bone marrow-derived neutrophils from WT and Atg5^NΔ mice (1 × 10⁷/ml) were resuspended in 200 μl of RPMI-1640 medium, supplemented with 2% FCS. In all, 20 μl of normal mouse sera was added to the neutrophils, followed by the addition of 220 μl of the opsonized bacteria. Neutrophils were then co-cultured with opsonized bacteria in a total volume of 440 μl (1 : 1 ratio), rotating end-over-end (6 r.p.m.) for 45 min at 37°C. At the end of the incubation period, 440 μl ice-cold 1 x HBSS was added to each tube to stop the reaction, and the tubes were centrifuged gently using a swing-out rotor (5 min, 100 xg, 4°C). Supernatants were collected, diluted 1 : 200, plated on agar, and grown overnight before counting the colonies. Tubes containing bacteria alone were treated the same way and used as controls.

Statistical analysis

Analysis of all data was performed by the Prism software (GraphPad Software Inc., San Diego, CA, USA). All data were expressed as mean±S.E.M. Results were analyzed using unpaired Student's t-test or two-way ANOVA with Bonferroni’s post-hoc test, with P<0.05 considered as statistically significant.

Abbreviations

ATG5:: autophagy-related protein 5
Atg5NΔ mouse:: Atg5flox/flox-Lyz2Cre/Cre mouse
EdU:: ethynyl deoxyuridine
Lyz2:: lysozyme 2
4-OHT:: 4-hydroxytamoxifen
Hoxb8:: homeobox b8
MMP:: matrix metalloproteinase
mTORC:: mammalian target of rapamycin complex
ROS:: reactive oxygen species
SCF:: stem cell factor
WT:: wild type

References

Boya P, Reggiori F, Codogno P . Emerging regulation and functions of autophagy. Nat Cell Biol 2013; 15: 713–720.
Article CAS Google Scholar
Mizushima N, Noda T, Ohsumi Y . Apg16p is required for the function of the Apg12p-Apg5p conjugate in the yeast autophagy pathway. EMBO J 1999; 18: 3888–3896.
Article CAS Google Scholar
Mizushima N, Yamamoto A, Hatano M, Kobayashi Y, Kabeya Y, Suzuki K et al. Dissection of autophagosome formation using Apg5-deficient mouse embryonic stem cells. J Cell Biol 2001; 152: 657–668.
Article CAS Google Scholar
Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T et al. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 2000; 19: 5720–5728.
Article CAS Google Scholar
Bjørkøy G, Lamark T, Brech A, Outzen H, Perander M, Overvatn A et al. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J Cell Biol 2005; 171: 603–614.
Article Google Scholar
Stephenson LM, Miller BC, Ng A, Eisenberg J, Zhao Z, Cadwell K et al. Identification of Atg5-dependent transcriptional changes and increases in mitochondrial mass in Atg5-deficient T lymphocytes. Autophagy 2009; 5: 625–635.
Article CAS Google Scholar
Pua HH, Dzhagalov I, Chuck M, Mizushima N, He YW . A critical role for the autophagy gene Atg5 in T cell survival and proliferation. J Exp Med 2007; 204: 25–31.
Article CAS Google Scholar
Miller BC, Zhao Z, Stephenson LM, Cadwell K, Pua HH, Lee HK et al. The autophagy gene Atg5 plays an essential role in B lymphocyte development. Autophagy 2008; 4: 309–314.
Article CAS Google Scholar
Zhang Y, Morgan MJ, Chen K, Choksi S, Liu ZG . Induction of autophagy is essential for monocytes-macrophage differentiation. Blood 2012; 119: 2895–2905.
Article CAS Google Scholar
Lee HK, Mattei LM, Steinberg BE, Alberts P, Lee YH, Chervonsky A et al. In vivo requirement for Atg5 in antigen presentation by dendritic cells. Immunity 2010; 32: 227–239.
Article CAS Google Scholar
Kundu M, Lindsten T, Yang CY, Wu J, Zhao F, Zhang J et al. Ulk1 plays a critical role in the autophagic clearance of mitochondria and ribosomes during reticulocyte maturation. Blood 2008; 112: 1493–1502.
Article CAS Google Scholar
Mortensen M, Ferguson DJ, Edelmann M, Kessler B, Morten KJ, Komatsu M et al. Loss of autophagy in erythroid cells leads to defective removal of mitochondria and severe anemia in vivo. Proc Natl Acad Sci USA 2010; 107: 832–837.
Article CAS Google Scholar
Kuma A, Hatano M, Matsui M, Yamamoto A, Nakaya H, Yoshimori T et al. The role of autophagy during the early neonatal starvation period. Nature 2004; 432: 1032–1036.
Article CAS Google Scholar
Hara T, Nakamura K, Matsui M, Yamamoto A, Nakahara Y, Suzuki-Migishima R et al. Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 2006; 441: 885–889.
Article CAS Google Scholar
Clausen BE, Burkhardt C, Reith W, Renkawitz R, Forster I . Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res 1999; 8: 265–277.
Article CAS Google Scholar
Zhao Z, Fux B, Goodwin M, Dunay IR, Strong D, Miller BC et al. Autophagosome-independent essential function for the autophagy protein Atg5 in cellular immunity to intracellular pathogens. Cell Host Microbe 2008; 4: 458–469.
Article CAS Google Scholar
Demetri GD, Griffin JD . Granulocyte colony-stimulating factor and its receptor. Blood 1991; 78: 2791–2808.
CAS PubMed Google Scholar
Richards MK, Liu F, Iwasaki H, Akashi K, Link DC . Pivotal role of granulocyte colony-stimulating factor in the development of progenitors in the common myeloid pathway. Blood 2003; 102: 3562–3568.
Article CAS Google Scholar
Metcalf D, Begley CG, Williamson DJ, Nice EC, De Lamarter J, Mermod JJ et al. Hemopoietic responses in mice injected with purified recombinant murine GM-CSF. Exp Hematol 1987; 15: 1–9.
CAS PubMed Google Scholar
Gerdes J, Lemke H, Baisch H, Wacker HH, Schwab U, Stein H . Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J Immunol 1984; 133: 1710–1715.
CAS PubMed Google Scholar
Bainton DF, Ullyot JL, Farquhar MG . The development of neutrophilic polymorphonuclear leukocytes in human bone marrow. J Exp Med 1971; 134: 907–934.
Article CAS Google Scholar
Klausen P, Bjerregaard MD, Borregaard N, Cowland JB . End-stage differentiation of neutrophil granulocytes in vivo is accompanied by up-regulation of p27kip1 and down-regulation of CDK2, CDK4, and CDK6. J Leukoc Biol 2004; 75: 569–578.
Article CAS Google Scholar
Salic A, Mitchison TJ . A chemical method for fast and sensitive detection of DNA synthesis in vivo. Proc Natl Acad Sci USA 2008; 105: 2415–2420.
Article CAS Google Scholar
Wang GG, Calvo KR, Pasillas MP, Sykes DB, Häcker H, Kamps MP . Quantitative production of macrophages or neutrophils ex vivo using conditional Hoxb8. Nat Methods 2006; 3: 287–293.
Article CAS Google Scholar
Gurzeler U, Rabachini T, Dahinden CA, Salmanidis M, Brumatti G, Ekert PG et al. In vitro differentiation of near-unlimited numbers of functional mouse basophils using conditional Hoxb8. Allergy 2013; 68: 604–613.
Article CAS Google Scholar
Borregaard N, Cowland JB . Granules of the human neutrophilic polymorphonuclear leukocyte. Blood 1997; 89: 3503–3521.
CAS PubMed Google Scholar
Noda T, Ohsumi Y . Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. J Biol Chem 1998; 273: 3963–3966.
Article CAS Google Scholar
Jung CH, Ro SH, Cao J, Otto NM, Kim DH . mTOR regulation of autophagy. FEBS Lett 2010; 584: 1287–1295.
Article CAS Google Scholar
Blommaart EFC, Luiken JJFP, Blommaart PJE, van Woerkom GM, Meijer AJ . Phosphorylation of ribosomal protein S6 is inhibitory for autophagy in isolated rat hepatocytes. J Biol Chem 1995; 270: 2320–2326.
Article CAS Google Scholar
Klionsky DJ, Emr SD . Autophagy as a regulated pathway of cellular degradation. Science 2000; 290: 1717–1721.
Article CAS Google Scholar
Sarkar S, Floto RA, Berger Z, Imarisio S, Cordenier A, Pasco M et al. Lithium induces autophagy by inhibiting inositol monophosphatase. J Cell Biol 2005; 170: 1101–1111.
Article CAS Google Scholar
Zhang L, Yu J, Pan H, Hu P, Hao Y, Cai W et al. Small molecule regulators of autophagy identified by an image-based high-throughput screen. Proc Natl Acad Sci USA 2007; 104: 19023–19028.
Article CAS Google Scholar
Renna M, Jimenez-Sanchez M, Sarkar S, Rubinsztein DC . Chemical inducers of autophagy that enhance the clearance of mutant proteins in neurodegenerative diseases. J Biol Chem 2010; 285: 11061–11067.
Article CAS Google Scholar
Inoki K, Li Y, Zhu T, Wu J, Guan KL . TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 2002; 4: 648–657.
Article CAS Google Scholar
Yang Z, Klionsky DJ . Mammalian autophagy: core molecular machinery and signaling regulation. Curr Opin Cell Biol 2010; 22: 124–131.
Article CAS Google Scholar
Li Y, Inoki K, Vacratsis P, Guan KL . The p38 and MK2 kinase cascade phosphorylates tuberin, the tuberous sclerosis 2 gene product, and enhances its interaction with 14-3-3. J Biol Chem 2003; 278: 13663–13671.
Article CAS Google Scholar
Yousefi S, Simon HU . Autophagy in cells of the blood. Biochim Biophys Acta 2009; 1793: 1461–1464.
Article CAS Google Scholar
Betin VM, Singleton BK, Parsons SF, Anstee DJ, Lane JD . Autophagy facilitates organelle clearance during differentiation of human erythroblasts: evidence for a role for ATG4 paralogs during autophagosome maturation. Autophagy 2013; 9: 881–893.
Article CAS Google Scholar
Conway KL, Kuballa P, Khor B, Zhang M, Shi HN, Virgin HW et al. ATG5 regulates plasma cell differentiation. Autophagy 2013; 9: 528–537.
Article CAS Google Scholar
Jacquel A, Obba S, Boyer L, Dufies M, Robert G, Gounon P et al. Autophagy is required for CSF-1-induced macrophagic differentiation and acquisition of phagocytic functions. Blood 2012; 119: 4527–4531.
Article CAS Google Scholar
Colosetti P, Puissant A, Robert G, Luciano F, Jacquel A, Gounon P et al. Autophagy is an important event for megakaryocytic differentiation of the chronic myelogenous leukemia K562 cell line. Autophagy 2009; 5: 1092–1098.
Article CAS Google Scholar
Liu F, Lee JY, Wei H, Tanabe O, Engel JD, Morrison SJ et al. FIP200 is required for the cell-autonomous maintenance of fetal hematopoietic stem cells. Blood 2010; 116: 4806–4814.
Article CAS Google Scholar
Mortensen M, Soilleux EJ, Djordjevic G, Tripp R, Lutteropp M, Sadighi-Akha E et al. The autophagy protein Atg7 is essential for hematopoietic stem cell maintenance. J Exp Med 2011; 208: 455–467.
Article CAS Google Scholar
Salemi S, Yousefi S, Constantinescu MA, Fey MF, Simon HU . Autophagy is required for self-renewal and differentiation of adult human stem cells. Cell Res 2012; 22: 432–435.
Article CAS Google Scholar
Singh R, Xiang Y, Wang Y, Baikati K, Cuervo AM, Luu YK et al. Autophagy regulates adipose mass and differentiation in mice. J Clin Invest 2009; 119: 3329–3339.
Article CAS Google Scholar
Zhang Y, Goldman S, Baerga R, Zhao Y, Komatsu M, Jin S . Adipose-specific deletion of autophagy-related gene 7 (atg7) in mice reveals a role in adipogenesis. Proc Natl Acad Sci USA 2009; 106: 19860–19865.
Article CAS Google Scholar
Baerga R, Zhang Y, Chen PH, Goldman S, Jin S . Targeted deletion of autophagy-related 5 (atg5) impairs adipogenesis in a cellular model and in mice. Autophagy 2009; 5: 1118–1130.
Article CAS Google Scholar
Liu F, Fang F, Yuan H, Yang D, Chen Y, Williams L et al. Suppression of autophagy by FIP200 deletion leads to osteopenia in mice through the inhibition of osteoblast terminal differentiation. J Bone Miner Res 2013; 28: 2414–2430.
Article CAS Google Scholar
Komatsu M, Waguri S, Chiba T, Murata S, Iwata J, Tanida I et al. Loss of autophagy in the central nervous system causes neurodegeneration in mice. Nature 2006; 441: 880–884.
Article CAS Google Scholar
Humbert M, Mueller C, Fey MF, Tschan MP . Inhibition of damage-regulated autophagy modulator-1 (DRAM-1) impairs neutrophil differentiation of NB4 APL cells. Leuk Res 2012; 36: 1552–1556.
Article CAS Google Scholar
Xie N, Zhong L, Liu L, Fang Y, Qi X, Cao J et al. Autophagy contributes to dasatinib-induced myeloid differentiation of human acute myeloid leukemia cells. Biochem Pharmacol 2014; 89: 74–85.
Article CAS Google Scholar
Wang Z, Cao L, Kang R, Yang M, Liu L, Zhao Y et al. Autophagy regulates myeloid cell differentiation by p62/SQSTM1-mediated degradation of PML-RARα oncoprotein. Autophagy 2011; 7: 401–411.
Article CAS Google Scholar
Yan ZW, Hou JK, He W, Fan L, Huang Y . Chloroquine enhances cobalt chloride-induced leukemic cell differentiation via the suppression of autophagy at the late phase. Biochem Biophys Res Commun 2013; 430: 926–932.
Article CAS Google Scholar
Liu G, Hu X, Sun B, Yang T, Shi J, Zhang L et al. Phosphatase Wip1 negatively regulates neutrophil development through p38 MAPK-STAT1. Blood 2013; 121: 519–529.
Article CAS Google Scholar
Funakoshi T, Latif A, Galsky MD . Risk of hematologic toxicities in patients with solid tumors treated with everolimus: a systematic review and meta-analysis. Crit Rev Oncol Hematol 2013; 88: 30–41.
Article Google Scholar
Liu H, He Z, von Rütte T, Yousefi S, Hunger RE, Simon HU . Down-regulation of autophagy-related protein 5 (ATG5) contributes to the pathogenesis of early-stage cutaneous melanoma. Sci Transl Med 2013; 5: 202ra123.
Article Google Scholar
Gurpinar E, Grizzle WE, Shacka JJ, Mader BJ, Li N, Piazza NA et al. A novel sulindac derivative inhibits lung adenocarcinoma cell growth through suppression of Akt/mTOR signaling and induction of autophagy. Mol Cancer Ther 2013; 12: 663–674.
Article CAS Google Scholar
Chen K, Shou LM, Lin F, Duan WM, Wu MY, Xie X et al. Artesunate induces G2/M cell cycle arrest through autophagy induction in breast cancer cells. Anticancer Drugs 2014; 25: 652–662.
PubMed Google Scholar
Narita M, Young AR, Narita M . Autophagy facilitates oncogene-induced senescence. Autophagy 2009; 5: 1046–1047.
Article CAS Google Scholar
Xu Y, Li N, Xiang R, Sun P . Emerging roles of the p38 MAPK and PI3K/AKT/mTOR pathways in oncogene-induced senescence. Trends Biochem Sci 2014; 39: 268–276.
Article CAS Google Scholar
Lee IH, Kawai Y, Fergusson MM, Rovira II, Bishop AJ, Motoyama N et al. Atg7 modulates p53 activity to regulate cell cycle and survival during metabolic stress. Science 2012; 336: 225–228.
Article CAS Google Scholar
Courtois-Cox S, Genther Williams SM, Reczek EE, Johnson BW, McGillicuddy LT, Johannessen CM et al. A negative feedback signaling network underlies oncogene-induced senescence. Cancer Cell 2006; 10: 459–472.
Article CAS Google Scholar
Belaid A, Cerezo M, Chargui A, Corcelle-Termeau E, Pedeutour F, Giuliano S et al. Autophagy plays a critical role in the degradation of active RHOA, the control of cell cytokinesis, and genomic stability. Cancer Res 2013; 73: 4311–4322.
Article CAS Google Scholar
Maskey D, Yousefi S, Schmid I, Zlobec I, Perren A, Friis R et al. ATG5 is induced by DNA-damaging agents and promotes mitotic catastrophe independent of autophagy. Nat Commun 2013; 4: 2130.
Article Google Scholar
Simon HU, Yousefi S, Schmid I, Friis R . ATG5 can regulate p53 expression and activation. Cell Death Dis 2014; 5: e1339.
Article CAS Google Scholar
Yang A, Walker N, Bronson R, Kaghad M, Oosterwegel M, Bonnin J et al. p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature 2000; 404: 99–103.
Article CAS Google Scholar
He Z, Liu H, Agostini M, Yousefi S, Perren A, Tschan MP et al. p73 regulates autophagy and hepatocellular lipid metabolism through a transcriptional activation of the ATG5 gene. Cell Death Differ 2013; 20: 1415–1424.
Article CAS Google Scholar
Morshed M, Yousefi S, Stöckle C, Simon HU, Simon D . Thymic stromal lymphopoietin stimulates the formation of eosinophil extracellular traps. Allergy 2012; 67: 1127–1137.
Article CAS Google Scholar

Download references

Acknowledgements

This study was funded by the Swiss National Science Foundation (Grant number 310030_146181 to HUS). CB is funded by the Swiss National Science Foundation (Grant number 310030_149790). We thank Dr M Baumann for technical support during the flow-cytometric analyses of blood and bone marrow cells from Atg5^NΔ mice and Dr Elena Federzoni for the generation of ATG5-overexpressing Hoxb8 neutrophils.

Author information

Authors and Affiliations

Institute of Pharmacology, University of Bern, Bern, CH-3010, Switzerland
S Rožman, S Yousefi, K Oberson, T Kaufmann & H U Simon
Theodor Kocher Institute, University of Bern, Bern, CH-3012
C Benarafa
Switzerland,
C Benarafa

Authors

S Rožman
View author publications
You can also search for this author in PubMed Google Scholar
S Yousefi
View author publications
You can also search for this author in PubMed Google Scholar
K Oberson
View author publications
You can also search for this author in PubMed Google Scholar
T Kaufmann
View author publications
You can also search for this author in PubMed Google Scholar
C Benarafa
View author publications
You can also search for this author in PubMed Google Scholar
H U Simon
View author publications
You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to H U Simon.

Ethics declarations

Competing interests

The authors declare no conflict of interest.

Additional information

Edited by G Kroemer

Supplementary Information accompanies this paper on Cell Death and Differentiation website

Supplementary information

Supplementary Figures (PDF 861 kb)

Rights and permissions

Reprints and permissions

About this article

Cite this article

Rožman, S., Yousefi, S., Oberson, K. et al. The generation of neutrophils in the bone marrow is controlled by autophagy. Cell Death Differ 22, 445–456 (2015). https://doi.org/10.1038/cdd.2014.169

Download citation

Received: 11 July 2014
Revised: 04 September 2014
Accepted: 09 September 2014
Published: 17 October 2014
Issue Date: March 2015
DOI: https://doi.org/10.1038/cdd.2014.169

This article is cited by

Role of macrophage autophagy in postoperative pain and inflammation in mice
- Kazuha Mitsui
- Sohei Hishiyama
- Masakazu Kotoda
Journal of Neuroinflammation (2023)
Molecular mechanisms of aberrant neutrophil differentiation in glycogen storage disease type Ib
- Sang Wan Sim
- Yuyeon Jang
- Hyun Sik Jun
Cellular and Molecular Life Sciences (2022)
Eosinophil extracellular traps drive asthma progression through neuro-immune signals
- Yiwen Lu
- Yijiao Huang
- Shicheng Su
Nature Cell Biology (2021)
Inhibition of p38 Mitogen–Activated Protein Kinase Ameliorates HAP40 Depletion–Induced Toxicity and Proteasomal Defect in Huntington’s Disease Model
- Zih-Ning Huang
- Jie-Mao Chen
- Lu-Shiun Her
Molecular Neurobiology (2021)
Regulation of eosinophil functions by autophagy
- Nina Germic
- Aref Hosseini
- Hans-Uwe Simon
Seminars in Immunopathology (2021)