Introduction

Thalassemia is an inherited hemolytic anemia caused by the reduced or absent synthesis of one or more globin chains in hemoglobin due to globin gene deletion or mutation, it is commonly categorized into two groups: α-thalassemia and β-thalassemia1,2,3. Among them, β-thalassemia is mainly caused by point mutations in the β-globin gene, while deletional variants are rare4,5. Chinese Gγ+(Aγδβ)0-thalassemia and SEA-HPFH are the most common δβ-thalassemia in Chinese populations caused by partial HBB and HBD deletion6. The Hb Lepore are a group of structural defects, which are composed of two normal α chains and two δβ fusion chains, causing by recombination events between the δ- and β-globin genes, resulting in δ and β fusion gene and δβ-thalassemia. Hb Lepore occurs worldwide, the Boston-Washington, Baltimore, Hollandia and Leidan have been described in the database and literature7,8,9,10,11.

Common α- and β-thalassemia gene variants in China are typically diagnosed by PCR-reverse dot blot hybridization (PCR-RDB) and gap-PCR12. However, traditional diagnostic tools may lead to misdiagnosis of rare thalassemia genotypes. At present, the third-generation sequencing (TGS) technology has been gradually used for thalassemia molecular diagnosis, with an obvious advantage in revealing globin genes single-nucleotide variants, short insertions/deletions and structural variants13,14. Increasing rare and novel globin gene variants have been identified using long-read sequencing13,14,15,16.

In this study, four families with abnormal hematological screening results indicating of rare thalassemia carriers underwent further investigation using third-generation sequencing. All of the proband’s in these families harbored Hb Leprore variants, which were resulted from partial coverage of the HBB and HBD globin genes, leading to the formation of a delta-beta fusion gene. Moreover, our findings could provide valuable reference in conducting TGS for rare and novel thalassemia diagnosis.

Materials and methods

Subjects

Four unrelated families from the Quanzhou region in Southeast China, with abnormal routine blood analysis and Hb capillary electrophoresis screening results, were enrolled in this study. All the probands had similar abnormal Hb Lepore bands located in Hb zone 6, manifested decreased levels of MCV and MCH, and suspected as thalassemia carriers. All the enrolled members in the four families denied recent blood transfusions. After written informed consents were signed, peripheral blood samples were collected for further molecular diagnosis in the enrolled subjects. This study was approved by the ethics committee of The Women’s and Children’s Hospital of Quanzhou (2021No.61).

Hematological screening

Routine blood analysis for mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH) levels detection was conducted using an automated cell counter (Sysmex XS-1000i; Sysmex Co., Ltd., Kobe, Japan). Hb capillary electrophoresis (Sebia, Evry Cedex, France) was performed to detect the levels of Hb A, Hb A2 and Hb F and other abnormal hemoglobin bands. Positive hematological screening results included at least one of the following criteria: MCV < 82 fL, MCH < 27 pg, Hb A2 > 3.4%, Hb A2 < 2.6%, Hb F > 2.0% and abnormal Hb bands.

Traditional thalassemia gene testing

All of the members in the four families did further thalassemia gene testing. Genomic DNA of the members in the enrolled families were extracted using an automatic nucleic acid extractor (Ruibao Biological Co., Ltd). Twenty-three types of common α-thalassemia and β-thalassemia variants in the Chinese populations were detected through PCR-RDB according to the manufacturer’s protocol (Yaneng Biological technology Co., Ltd., Shenzhen)17.

Third-generation sequencing

The third-generation sequencing based on PacBio Sequel II platform for globin genes variants detection was conducted as the description of our previous study16. Genomics DNA were extracted and then sent to Berry Genomics laboratory for third-generation sequencing. Briefly, the purified DNA samples were quantified using the Qubit dsDNA BR assay kit (ThermoFisher Scientific). Then, optimized primers were used to generate specific amplicons that encapsulated known structural variation regions, as well as single nucleotide variations in the HBA1/2 and HBB globin genes, based on databases such as HbVar, Ithanet, LOVD, and LOVD-China. After purification and end repair, double barcode adaptors were ligated to the 5’ and 3’ ends and Sequel Binding and Internal Ctrl Kit 3.0 (PacBio) was used to prepare SMRT bell libraries. Finally, third-generation sequencing was performed on the PacBio Sequel II System after primed DNA-polymerase complexes were loaded onto the SMRT cells16.

Following alignment of the subreads, the consensus circular sequence was mapped to the GRCh38 reference and variants were called (FreeBayes software, version 1.2.0). Cis- and trans-configuration between two variants in the long reads was analyzed using WhatsHap (version 0.18) software. The alignments of variant and wild-type molecules were visualized using the Integrative Genomics Viewer16.

Specific gap-PCR amplification and Sanger sequencing

Specific gap-PCR or Sanger sequencing were used to confirm the rare or novel globin gene variants detected by third-generation sequencing. Gap-PCR was used to identify the deletion breakpoints. We designed specific primers according to the known DNA sequences around the breakpoints or the globin gene sequence variants. The primers sequences were as followed, P1: AGAGATGCGGTGGGGAGATA and P2: AACGATCCTGAGACTTCCACA. All primers were synthesized at Sangon Biotech (Shanghai). Gap-PCR reaction system: 5 × buffer 5 μL, 25 mmol dNTPs 0.2 μL, 25 mmol MgCl2 1.5 μL, Taq enzyme 2.5U, 10 μmol primers 1 μL each, template 2 μL, and plus ultra-pure water to 25 μL. The amplification conditions were 95 °C for 10 min, then 35 cycles of 94 °C for 1 min, 62 °C for 30 s, 72 °C for 1 min, and finally 72 °C for 5 min. Electrophoresis analysis was performed and then the purified electrophoresis products were sent for Sanger sequencing. In addition, Sanger sequencing was also performed for globin gene variants. The sequenced data were analyzed with GenBank NG_000007.3 as their reference sequences.

Ethics approval and consent to participate

This study was approved by the ethics committee of The Women’s and Children’s Hospital of Quanzhou (2021No.61). We received informed consent from the study participants and their parents, and they agreed to the publication of a report on the study. All procedures performed involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

Results

Hematological screening results

The hematological screening results of the enrolled four families were described in Table 1. All of the members in four families had decreased levels of MCV and MCH detected by routine blood analysis. As elicited in Table 1 and Fig. 1, subsequent Hb capillary electrophoresis results demonstrated similar four Hb bands in the four probands of the families as well as the proband’s daughter in family 1, including Hb A, Hb A2, Hb F, and Hb zone 6 bands. Among these five subjects, the abnormal Hb zone 6 (Hb Lepore) levels was obvious range from 7.3 to 10.5%, and Hb F levels range from 0.7 to 14.1%. In addition, both of the proband’s wife in family 2 and family 3 only had a decreased level of Hb A2, who were suspected as α-thalassemia carriers.

Table 1 The hematological and molecular analysis of the enrolled families.
Full size table
Figure 1
figure 1

Hemoglobin capillary electrophoresis results of the enrolled families. (A,B,D) All of the probands in family 1, 2, and 4, elicited abnormal Hb bands in zone 6, which indicated existence of Hb variants. (C) Hemoglobin capillary electrophoresis results revealed a decreased level of Hb A2 in proband’s wife of family 2.

Full size image

Traditional thalassemia gene testing results

Firstly, 23 common α-thalassemia and β-thalassemia variants in Chinese populations were investigated using PCR-RDB technique in the four families. As delineated in Table 1, no common α-thalassemia and β-thalassemia variants was detected. Given that the positive hematological screening results in the enrolled subjects, rare or novel globin genes variants were suspected and all of them were subject to further genetic diagnosis.

Third-generation sequencing results

In order to further investigate the thalassemia genotype of the suspected families, TGS based on single-molecule real time sequencing was performed for globin genes detection including single nucleotide variation and structure variants. As depicted in Table 2 and Fig. 2, TGS detection revealed large deletions that partially encompassed the HBB and HBD globin genes in four probands from the families, which located in the region of Hb Lepore-Boston-Washington. In family 1, the proband’s daughter who exhibit similar hematological screening results also had the same deletion. In addition, a rare variant of Hb Nanchang (GGT > AGT) (HBA2:c.46G > A) at codon 15 in α2 (Fig. 2) was identified in the proband’s wife of family 2 with decreased level of Hb A2 and slightly low level of MCH. However, no relative globin genes variants was observed in the proband’s wife of family 3 who also had decreased level of Hb A2.

Table 2 HBB and HBD deletions detected by third-generation sequencing (TGS) and verified by Sanger sequencing.
Full size table
Figure 2
figure 2

Third-generation sequencing (TGS) results of the enrolled families. (A) In the probands of family 1, a 7.414 kb deletion (NG_000007.3:g.63633_71046del) that partially covering HBB and HBD globin genes was identified. (B) In the proband of family 2, a 7.415 kb deletion (NG_000007.3:g.63632_71046del) in HBB and HBD globin genes was detected using TGS. (C) A variant of Hb Nanchang (GGT > AGT) (HBA2:c.46G > A) was identified in the proband’s wife of family 2. (D) A 7.414 kb deletion (NG_000007.3:g.63633_71046del) that partially covering HBB and HBD globin genes was identified in family 3. (E) A 7.415 kb deletion (NG_000007.3:g.63626_71040del) was identified in the proband of family 4.

Full size image

Specific gap-PCR amplification verification results

In order to confirm the deletions in the enrolled families, the specific gap-PCR amplification was further conducted. Subsequently, two specific primers were designed to amplify the breakpoints using gap-PCR technique. The gap-PCR detection results demonstrated a large deletion covering the HBB and HBD globin gene cluster in all the proband’s of the four families. Subsequently, the electrophoretic results delineated a 800 bp PCR product in the four families, which amplified by the primers P1 and P2 (Fig. 3).

Figure 3
figure 3

Specific gap-PCR amplification and Sanger sequencing results in the four enrolled families. (A) 1: family 1. 2: family 2. 3: family 3. 4: family 4. N: Normal control. (B) Sanger sequencing results showed that the deletion fragments of fracture in the four families was range from 63,633–71,046 bp, which was similar to Hb Lepore-Boston-Washington. (C) The Hb Nanchang (GGT > AGT) (HBA2:c.46G > A) variant in the proband’s wife of family 2 was verified by Sanger sequencing.

Full size image

Sanger sequencing results

To further verify the specific location of the breakpoints in the four enrolled families, Sanger sequencing was conducted using the specific products that amplified by gap-PCR. As shown in Table 2 and Fig. 3, after alignment between sequencing results and NG_000007.3 sequence through BLAST analysis, all the patients in the four families had a partial HBB and HBD deletion fragment range from 63,633–71,046 bp, with a fragment length of 7.414-kb (NG_000007.3:g.63633_71046 del), which was almost the same with Hb Lepore-Boston-Washington (NG_000007.3:g.63632_71046 del). In addition, the Hb Nanchang (GGT > AGT) (HBA2:c.46G > A) identified in proband’s wife in family 2 was further confirmed by Sanger sequencing (Fig. 3).

Discussion

Thalassemia is a hereditary blood disorder caused by globin gene synthesis disorders4, which included α, β, γ, δβ-thalassemias. Thalassemia is highly prevalent in South China, especially in Guangdong, Guangxi, and Hainan provinces18,19,20. Quanzhou region of Fujian province, located in Southeast China, displays a high prevalence of thalassemia, with a diversity and complexity of thalassemia21,22,23. Common α- and β-thalassemia gene variants in China are typically diagnosed by PCR-RDB and gap-PCR12, but they have limitations in the diagnosis of rare thalassemia variants. Third-generation sequencing technology has significant advantages in the diagnosis of thalassemia, and can detect almost all known globin gene variants13,14. In our study, third generation sequencing was performed to investigate globin gene variants in four Chinese families with abnormal Hb variants, all of the suspected members harbored a large 7.414-kb deletion that partially affected the HBB and HBD globin genes (NG_000007.3:g.63633_71046 del), which closely resembled the Hb Lepore-Boston-Washington variant (NG_000007.3:g.63632_71046 del).

δβ-thalassemia is a rare condition, which is caused by partial deletions in HBB and HBD globin genes. In China, the Gγ+(Aγδβ)0 and SEA-HPFH genotypes were the two most common δβ-thalassemia variants6. In addition, our previous study indicated a higher prevalence of SEA-HPFH of δβ-thalassemia in Quanzhou region, while, Hb Lepore had not been identified22,23. The Lepore hemoglobins are a group of δβ-thalassemia, which is more frequently identified in Southern Europeans11, Caucasians in Central Portugal and in the Spanish Alta Extremadura24. The Hb Lepore Boston-Washington, Baltimore, Hollandia and Leidan are commonly described in the database and literature, with different recombination crossover breakpoints7,8,9,10. Moreover, several novel Hb Lepore variants have been identified, including Hb Lepore-Hongkong and Hb Lepore-ARUP25,26.

Hb Lepore has been rarely reported in Chinese populations, while, the Hb Lepore-Boston-Washington seem more prevalent in China27. Hb Lepore cannot be diagnosed through routine thalassemia gene testing based on PCR-RDB technology, but it can be well indicated through hemoglobin electrophoresis or high performance liquid chromatography (HPLC) technology. Heterozygotes of Hb Lepore commonly exhibit a mild hypochromic microcytic anaemia with 10–15% Hb Lepore and a slightly increased level of Hb F7. However, a novel Hb Lepore-Hong Kong was identified with increased level of Hb A2 and Hb F, but without a Hb Lepore band, which may due to the delta-beta fusion gene of Hb Lepore-Hong Kong that sharing the same coding sequences as HBB25. In the present study, five members in four Chinese families had decreased levels of MCV and MCH, with an abnormal Hb band in zone 6 (7.3–10.5%), and various Hb F levels (0–5.1%), which was consistent with the previous reports. Finally, all of the suspected members were identified carrying a same 7.414-kb deletion (NG_000007.3:g.63633_71046 del) in HBB and HBD globin genes, which manifest one bp difference with Hb Lepore-Boston-Washington, and we proposed to classify them as Hb Lepore-Boston-Washington heterozygosity carriers.

Hb Lepore is associated with a β-thalassemia phenotype, thus, individuals with homozygous or compound heterozygosity of Hb Lepore(s) would lead to β-thalassemia intermedia or major28. In this study of family 2 and family 3, the probands’ wife were also subject to TGS detection, while, no mutations in β-globin gene was observed. Interestingly, a rare Hb Nanchang (GGT > AGT) (HBA2:c.46G > A) variant at codon 15 in HBA2 globin gene was identified in the proband’s wife of family 2. The HBA2:c.46G > A variant, which involved a GGT → AGT change and resulting in a Gly → Ser replacement at CD15 was first identified in a girl with normal hematological parameters and classified as silent α-thalassemia29. Subsequently, the variant of Hb Nanchang (HBA2:c.46G > A) was reported by Xu et al.30 in a Chinese population with normal hematological parameters. Notably, in our present study, the patient who harbored Hb Nanchang (GGT > AGT) (HBA2:c.46G > A) variant exhibited a slightly low level of MCH (26.8 pg), which may causing α+-thalassemia (silent α-thalassemia). In addition, as elicited in the IthaGenes database (https://www.ithanet.eu/), HBA2:c.46G > A was indicated to result in α+-thalassemia.

To summarize, our study first described the similar Hb Lepore (NG_000007.3:g.63633_71046del) in Chinese population. In addition, Hb Nanchang variants was identified in Fujian province for the first time. Our findings suggest that combining the use of Hb capillary electrophoresis and third-generation sequencing would effectively screen and diagnose Hb Lepore.