Abstract
In this study, a accurate, rapid quantitative PCR method for the simultaneous detection of 4 kinds of pathogenic bacteria in water was established, and the distribution of pathogenic bacteria in surface waters with different levels of pollution (Yulin region, China) was detected. The results showed that the detection accuracy was 94%; the detection limit was 2.7 in bacterial cells. Salmonella enterica subsp. enterica serovar typhimurium and Salmonella dysenteria were always present in water when the universal primer for pathogenic bacteria abundance detection was greater than 104 copies 100 mL−1. When the detection value is lower than 104 copy 100 mL−1, the bacteria in the water are rarely pathogenic bacteria, so the detection value of 104 copy 100 mL−1 can be used as a new indicator of waterborne pathogen pollution.
Similar content being viewed by others
Introduction
With the rapid development of urbanization, water pollution has become increasingly serious, leading to a rise in many diseases and the death rate of human beings, and these problems are particularly prominent in developing countries. In particular, some waterborne diseases, such as dysentery and enteritis, are caused by pathogenic bacteria1. Therefore, routine surveillance of pathogens in water is essential for public health. However, the current detection methods are slow and lack accuracy, which makes it difficult to prevent and control water-borne diseases.
During the past 40 years, three kinds of intestinal infectious diseases have occurred in China2. The first category is infectious diseases caused by bacteria, cholera, typhoid fever and bacterial dysentery. The second category is infectious diseases caused by pathogens and viruses, amoebic dysentery and hepatitis E (HEV). The third is infectious diseases caused by causes other than cholera, dysentery, typhoid and paratyphoid fever3,4. The annual average incidence of these diseases was 97.33 per 100,000 people2. In China, intestinal infectious diseases are mainly caused by Escherichia coli (E. coli), Shigella dysenteriae (S. dysenteriae), Vibrio cholerae (V. cholerae) and Salmonella enterica subsp. enterica serovar typhimurium (S. typhimurium), accounting for over 50% of officially reported intestinal infectious diseases such as hepatitis A and typhoid fever5,6. In recent years, other kinds of infectious diarrhoea diseases have tended to rise in China. So, the detection of pathogenic bacteria in water bodies was imminent, but the risk of pathogenic bacteria causing diseases was not related to the index of assessment of routine regular water quality7.
At present, the detection of pathogenic bacteria in water is mainly based on selective culture and standard biochemical methods. However, this method has many defects. Firstly, the absence of colonies may occur during selective culture, but it does not mean that there are no viable cells, and there may be cells that have into the viable but non-cultureable (VBNC) state. Secondary, the species of the cells detected cannot be precisely located, and additional steps are required. Thirdly, very time-consuming8,9,10. Compared with traditional culture and biochemical methods, qPCR has the advantages of fast detection speed and low detection limit11.As a result, an increasing number of researchers have begun to solve this problem by molecular biological methods to shorten the time of monitoring and reporting12,13,14. One of these molecular biological methods is quantitative PCR, and this technique, together with probes and primers has been used widely for the monitoring of different faecal bioindicators and waterborne pathogenic bacteria15,16,17. At the same time, more studies have found correlation between bacterial culture and qPCR results on contaminated agar-like agar plates, which means that qPCR can be used as a superior alternative to culture in most detection scenarios18,19,20.
In this study, universal primers for 4 kinds of typical enteric pathogens including E. coli, S. dysenteriae, V. cholerae and S. typhrmurium were designed and the E. coli 16S rRNA gene was used as the target sequence. Specific primers for each of these four pathogenic bacteria have also been designed. The distribution of 4 kinds of pathogenic bacteria in the different surface waters located in Yulin city, northern Shaanxi Province, China, was monitored using qPCR with universal primers and specific primers. The sensitivity, accuracy and availability of this method in the range of the concentration of the whole environment were explored. The research results provided a feasible method to comprehensively evaluate the risk of surface water pathogenic pollution, which has important practical significance.
Materials and methods
Design and specificity of the primers
Primer design
Universal primers for E. coli, S. dysenteriae, V. cholerae and S. typhimurium were designed, and the E. coli 16S rRNA gene was used as the target sequence. Based on the high conservation of 16S rRNA genes of the above four pathogens, universal primers were designed. The sequences of the universal primers were as follows: 5′-aaggcgacgatccctagctggtctgagaggatga/c-3′ (246–280 bp, E. coli. 16S rRNA); 5'-gcttgccagtatcagatg cagttcccaggttgagc-3′ (521–556 bp, E. coli. 16S rRNA). The sequences of the specific primers for each of the 4 pathogenic bacteria are presented in Table 1. The synthesis of primers was completed by the Shanghai Bioscience & Technology Company, China.
Test of the primer specificity
The specificity test of the universal primers and the specific primers were completed by PCR and sequencing of the PCR products. DNA extracted from 14 reference species (Table 2) was used as the PCR template. The PCR amplification reaction system was composed of Taq DNA polymerase 1.0 U, dNTP 0.2 mmol L−1, 1 × PCR Buffer, 0.1 mmol L−1 upstream and downstream primer, 2.0 mmol L−1 MgCl2 and DNA template 2 μL, respectively, totaling 25 μL. PCR amplification conditions were as follows: denaturation at 94 ℃ for 5 min, 94 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 30 s, 35 cycles, and extension at 72 ℃ for 5 min. The DNA template was replaced with sterile ddH2O as the control group. PCR products were analysed by 2% agar sugar gelatine electrophoresis, which included 0.5 mg mL−1 bromize pyrimidine. A gelatine imaging system 1000 (Bio-Rad, USA) was used for imaging. The final PCR product was recovered and purified with a DNA Recovery Kit (Shanghai Bioengineering Company, China). Finally, the DNA fragment was sequenced (Shanghai Bioengineering Company, China), and then the homology of the sequence was analysed by DNA Star Software (Perkin Elmer, Norwalk, Connecticut, USA).
qPCR detection method
Bacterial cultivation
The reference and standard species used in this study (Table 2) were obtained from the American Type Culture Collection (ATCC) and Institute of Microorganism in Shaanxi Province (SXW). LB medium include peptone 10 g L−1 (Thermo Fisher Scientific Company, China), NaCl 5 g L−1, yeast extract 5 g L−1 (Shanghai Yuanye Biotechnology Company, China) contained in each litre of water was chosen as the culture medium. The bacteria were incubated at 37 ℃ for 24 h, and then centrifuged at 10,744 ×g (Hunan Xiangyi Laboratory Instrument Development Company, xiangyi H1850R, China). After that, cells were collected as described by the American Public Health Association25.
qPCR standard curve
The four kinds of pathogenic bacteria cultures with clear cell density were diluted 10 times with sterile distilled water, and then the diluted bacterial cultures were centrifuged at 10,744 ×g for 10 min. After bacterial cells were reclaimed and washed with sterile distilled water 3 times, total DNA was extracted by the phenol–chloroform method. The total DNA was taken as the template for the preparation of the qPCR standard curve. Three concentrated groups were analysed, and the bacterial cell density of each diluted bacterial culture was determined by counting the average of 3 qPCR detection results26.
qPCR analysis system
The qPCR system was formed after adding the fluorescence reagent SYBR Green I (Tiangen Biological and Chemical Company, China) based on of the above PCR system. Then the PCR process was detected in real time by detecting the fluorescence signal. The qPCR reaction system was composed of 2 μL DNA template, 1 × real MastrMix/1 × SYBR solution, and 0.1 mmol L−1 upstream and downstream primers, with a volume of 25 μL. The qPCR mixing reaction liquid was placed into an 8-position tube (MJ Research TLS-0251), sealed with a super clean lid, and then placed into a qPCR instrument (American Bio-Rad MJ). The amplification conditions of qPCR were predenaturation at 94 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 30 s, and 85 ℃ for 2 s, for 35 cycles. After manually adjusting the threshold fluorescence value to 8 units, the instrument automatically measured the cycle threshold (CT)21.
Detection of pathogenic bacteria in surface waters
Sampling point and sampling time
Clean waters (source water), slightly polluted waters (once polluted river was treated; natural lake) and seriously polluted waters (water body that accepts contaminant; effluent from wastewater treatment plant) were chosen as research objects. The water quality of the surface waters mentioned above id presented in Table 3.
Except for some bad weather, samples were collected in the following five places: wastewater treatment plant A, river B, river C, river E and lake D. Samples were collected 4 times each month for one year (from March 2015 to March 2016). Water samples (500 mL) were collected at half the depth of each water body in the morning (from 8:00 to 12:00) and other auxiliary materials including pH, temperature, turbidity, tourist density and something about boats (type, quantity, et al.) were collected as described by the American Public Health Association25.
Total DNA extraction
A 100 mL surface water sample was centrifuged at 10,744 ×g for 10 min, and then the supernatants was removed. Next, 567 μL of broken buffer, which was composed with of 40 mmol L−1 Tris–HCl (Shanghai Yuanye Biotechnology Company, China), pH 8.0, 20 mmol L−1 CH3COONa, 1 mmol L−1 EDTA (Shandong Yinuo Chelating Chemical Company, China), and 1% SDS (Hangzhou Lianke Meixun Biomedical Technology Company, China), was added to the centrifuged sediment to resuspend the sediment. Then, 66 μL of 5 mol L−1 NaCl was added, adequately mixed at 65 ℃ for 20 min, and centrifuged (10,744 ×g) for 10 min. The supernatant after centrifugation was transferred to a new tube, and an equal volume mixture was added for extraction, which consisted of isochoric phenol (Shaanxi Jintai Chlor-alkali Chemical Company, China), chloroform (Shaanxi Sinopharm Medical Diagnostic Reagent Company, China), and isoamyl alcohol (Nanjing Oriental Pearl Industry and Trade Company, China)at a ratio of 25:24:1. The mixture in the previous step was centrifuged (10,744 ×g) for 5 min, the supernatants were taken and 0.6 times the volume of isoamyl alcohol was added to obtain DNA sediment. The obtained DNA precipitate was washed with 1 mL of 70% ethanol 3 times, and the ethanol was removed after centrifugation. Finally, the DNA was shunted with ddH2O and stored for PCR amplification27.
qPCR analysis of the surface water samples
At least three replicate pathogenic bacterial DNA extracts in environmental water should be ready, and the cell copies determined by qPCR in diluted water samples multiplied by the dilution coefficient were taken as the cell density, with a range of 101–107. The scatter plot and regression analysis of log10 cell copies of bacteria on qPCR-measured cycle threshold (CT) values for serially diluted DNA extracts of bacteria were used to evaluate the sensitivity and precision of the qPCR method28. The cell density of pathogenic bacteria in environmental water samples was calculated according to the known standard curve established by cell density and qPCR. The calculated value is a relative quantity.
Results and discussion
Design of the PCR universal primers for typical bacterial pathogens in water
The 16S rRNA gene sequences of E. coli, S. dysenteriae, V. cholerae and S. typhimurium were searched in GenBank. By analysis of homology using DNA-STAR software (version 3.2), the universal primers were designed as 5′-aaggcgac gatccctagctggtctgagaggatga/c-3′ (nt 246–280 dp, E. coli 16S rRNA numbering), and 5′-gcttgccagtatcagatgcagttcccaggttgagc-3′ (nt 521–556 dp, E. coli 16S rRNA numbering). The universal primer and the specific primers for the 4 kinds of pathogenic bacteria mentioned above were tested by PCR. As shown in Fig. 1 (original blots/gels are presented in Supplementary Fig. S1), a limpid specific strap could be seen at 320 bp for the 4 strains on the electropherograms, while no amplification products were identified for the 10 reference strains. The analysis results verified that the universal primers showed specificity only for their corresponding target genes. After purification, the amplified products of the nucleotide sequence were detected. Compared with the 4 kinds of pathogens in the GenBank of the 16S rRNA gene sequence, the similarity of sequencing results was more than 99%. This proved that the universal primer designed in this study was suitable for the specific detection of most general species of the four target strains.
PCR amplification results of the 4 target strains and 10 reference strains. M: DNA Marker; 2: S. dysenteriae; 6: V. cholerae; 8: S. typhimurium; 12: E. coli; 1, 3–5, 7, 8–11, 13–14: reference strains.
The nucleotide sequence results for the amplified products also showed that the 4 pairs of specific primers used in the research had very high specificity to the target strains (Fig. 2, original blots/gels are presented in Supplementary Fig. S2).
PCR amplification results of the 4 target strains with specific primers. M: DNA Marker, 1: S. dysenteriae, 2: V. cholerae, 3: S. typhimurium, 4: E. coli, 5: Negative control.
Establishment of the qPCR method for the detection of bacterial pathogens in water
The relationship of the bacterial pathogens in water between the qPCR-measured cycle threshold (CT) values and log10 cell copies from three concentrate parallel samples as shown in Fig. 3. By obtaining the CT value of the water sample, the original bacterial pathogens cell density of the water sample can be calculated according to the standard curve of qPCR. The slope of the equation could be used to examine the efficiency of PCR, the slope of E. coil, S. dysenteriae, V. cholerae, and S. typhimurium were − 3.75, − 3.55, − 3.79 and − 3.52, respectively. A perfect qPCR standard curve was based on the PCR efficiency reaching 90–100% (100% PCR efficiency means that the quantity of DNA template will be doubled after each cycle). Only when the linear regression analyses of the standard curve had a high correlation coefficient (R2 ≥ 0.99), would the process and data of the qPCR experiment be believable26,29,30.
Scatter plot and regression analysis results of log10 cell copies of E. coli (A), S. dysenteriae (B), S. typhimurium (C) and V. cholerae (D) on qPCR-measured cycle threshold (CT) values for serially diluted DNA extracts from them. Negative control: contains everything except pathogen DNA target (including primers).
The original DNA template copies of E. coli examined in this experiment ranged from 6.8 × 101 to 6.8 × 105 cfu mL−1, and the log10 cell copies of E. coli DNA template were positively proportional to its corresponding CT value (Fig. 3A). The regression coefficient was 0.9903, and it showed a strong linear relation, the slope was − 3.75 and the PCR efficiency was 99%. The standard deviation of the CT value between replicated DNA extracts of every diluted grade was less than 0.3. Cell copies of S. dysenteriae, V. cholerae, and S. typhimurium (whose cells densities were known) were examined by qPCR with universal primers. The scatter plot and regression analysis results indicated that the slope was not changed or interrupted (Fig. 3B–D) and the reliability of the examination result by the qPCR method was 94%.
Strain E. coli was taken as a representative strain, and the sensitivity of the qPCR method with universal primers was examined. The results showed that the minimum detection limit of the qPCR method (including the process of bacterial cell reclamation, DNA extraction method and qPCR method) was 2.7 bacterial DNA extracts (Fig. 4, original blots/gels are presented in Supplementary Fig. S3). It shows that the detection limit of the universal primers is low, which can meet the detection needs under low concentrations of pathogenic bacteria.
Sensibility of the qPCR detection by using the universal primer: qPCR amplification results of the E. coli cultures serially tenfold diluted with sterile distilled water. M: Marker, 1: 2.7 × 105 cfu 100 mL−1; 2: 2.7 × 104 cfu 100 mL−1; 3: 2.7 × 103 cfu 100 mL−1; 4: 2.7 × 102 cfu 100 mL−1; 5: 2.7 × 101 cfu 100 mL−1; 6: 2.7 × 100 cfu 100 mL−1; 7: 2.7 × 10–1 cfu 100 mL−1; 8: Negative control.
Distribution of pathogenic bacteria in the surface waters
Universal primers for bacterial pathogens and specific primers for 4 kinds of typical pathogenic bacteria were used to detect pathogenic bacteria by qPCR in five surface water samples, clean water, lightly polluted water and seriously polluted water. Detection was continued for one year, and 4 samples, were collected each month. The detection results of pathogenic flora, S. dysenteriae, V. cholerae, S. typhimurium and E. coli in different surface waters are shown in Table 4. The number of samples for each water body was 48 (n = 48).
V. cholerae was not found in any of the detected waters. V. cholerae was not present in the surface waters of the Yulin area under normal conditions. In clean water (E), the average values of enteric pathogenic flora were 850 copies 100 mL−1, and the average values of E. coli, S. dysenteriae and S. typhimurium were 2.7 copies 100 mL−1, 4.0 copies 100 mL−1 and 0.7 copies 100 mL−1, respectively. Water body E was the source water of Yulin city, so it was well protected, and was not polluted by pathogens.
In the lightly polluted water (C, D), the average values of pathogenic flora were (3.1–3.3) × 103 copies 100 mL−1, and the average values of E. coli, S. dysenteriae and S. typhimurium were 7.2–67 copies 100 mL−1, 2.5–15 copies 100 mL−1 and 5–6 copies 100 mL−1, respectively. The total number of 4 kinds of typical pathogenic bacteria detected by specific primers was far less than the number of pathogenic flora detected by universal primers. In the seriously polluted water (A, B), the average values of pathogenic flora were (1.1–3.0) × 105 copies 100 mL−1, concentrations of E. coli were very high, and the average value was 5–9.1 × 104 copies 100 mL−1. The average values of S. dysenteriae and S. typhimurium were 33–46 copies 100 mL−1 and copies 100 mL−1, respectively. The total cell intensity of 4 kinds of pathogenic bacteria detected by specific primers is close to the pathogenic flora detected by universal primers. It shows that the universal primers designed in this study are similar in accuracy to the specific primers of the four pathogenic bacteria.
Positive rate of pathogenic bacteria in surface waters
Among the 240 samples from the five surface waters, the detection frequency of V. cholerae was 0, which is the universal detection frequency of pathogenic flora (100%) (Table 5). In the different surface waters, the detection frequencies of E. coli, S. dysenteriae and S. typhimurium were different. The positive rate of E. coli and S. typhimurium was 100% in the seriously polluted waters (A, B) and lightly contaminated waters (C, D). However, in the clean water (E), the positive rates of E. coli and S. typhimurium were 72.2% and 27.3%, respectively.
In the seriously polluted water, the detection frequency of S. dysenteriae was up to 90%, but in the lightly contaminated water and clean water, the detection frequency of S. dysenteriae was only 18.2%. When the waters were slightly polluted, E. coli could be detected out continuously, when the waters were polluted seriously, S. typhimurium and S. dysenteriae could be detected continuously, indicating that the pollution degree of pathogens was closely related to the degree of water pollution31,32,33.
Contamination risk analysis of pathogenic bacteria in surface waters
Figure 5 shows the distribution of the positive rate of pathogenic flora detected by universal primers and 4 kinds of pathogenic bacteria detected by specific primers in different surface waters. In seriously polluted water (Fig. 5A,B), the cell density of pathogenic flora detected by universal primers was 104–105 copies 100 mL−1, and the positive rate at this concentration was over 50%. S. typhimurium and S. dysenteriae could also be detected continuously, and the cell densities were 101–102 copies 100 mL−1. For seriously polluted water, when the detection value of universal primers was greater than 104 copies 100 mL−1, although the main pathogenic flora in water was E. coli, there must be the presence of S. typhimurium and S. dysenteriae in water, and the risk of pathogen contamination increased greatly.
Distribution of the positive rate of pathogenic bacteria in the different surface waters. (A) Secondary effluent of the wastewater treatment plant (without disinfection), (B) a river that received sewage (seriously polluted), (C) a river that was treated in recent years (slightly polluted), (D) natural desert lake (slightly polluted), (E) drinking water source (clean).
In lightly polluted water (Fig. 5C,D) or clean water (Fig. 5E), the cell density of pathogenic flora detected by universal primers was 102–103 copies 100 mL−1, the cell density of all 4 kinds of typical pathogenic bacteria together was approximately 10 copies 100 mL−1, and these pathogenic bacteria could not be detected in succession. The positive rates of 4 kinds of typical pathogenic bacteria were far lower than the positive rates of pathogenic flora detected by universal primers, indicating that when the cell density of pathogenic flora was lower than 104 copies 100 mL−1 in water, the pathogenic bacteria that were detected by universal primers were mainly bacteria other than E. coli, S. typhimurium, S. dysenteriae and V. cholera. The results showed that the generic primers in this study can be better used as detection tools than specific primers, and when the cell density detected by the universal primers was higher than 104 copies of 100 mL−1, the risk of bacterial pathogen contamination in surface water was significantly increased, and 104 copies of 100 mL−1 was recommended as a new indicator of water-induced contamination.
Correlation analysis of the pathogenic bacteria detected by using universal primers and specific primers
The scatter plot and regression analysis of pathogenic flora detected by universal primers and 4 kinds of typical pathogenic bacteria detected by specific primers in the surface water are shown in Fig. 634.
Scatter plot and regression analysis of pathogenic flora detected by using universal primers and specific primers.
It was concluded that the coefficient between pathogenic flora and E. coli, S. typhimurium and S. dysenteriae were r = 0.77, r = 0.66 and r = 0.58, respectively. The high correlation indicates that the accuracy of detection between generic and specific primers in this study is similar. There was a strong correlation between pathogenic flora and E. coli, indicating that the main enteric pathogenic flora was E. coli in the surface water of Yulin city. There results are consistent with the pollution situation of water pathogens tested by traditional methods of coliform indicators.
The qPCR method based on universal primers of enteric pathogenic flora could detect not only E. coli in water, but also S. dysenteriae, S. typhimurium, and V. cholera. Compared with the traditional methods, the qPCR method could better reflect the true situation of water pathogen pollution. In addition, it has many advantages, such as high sensitivity and short test time (less than 5 h). In the routine detection of pathogens in surface water, although the qPCR method cannot completely replace the traditional method of detection of E. coli at present because the two methods do not fully correspond35,36,37, the detection results by the qPCR method in this study could be used as an important reference index for the risk assessment of pathogenic contamination in surface water.
Conclusions and recommendations
In this study, a qPCR method with high sensitivity, short detection time and high accuracy was established, which could simultaneously detect four pathogenic bacteria (E. coli, S. dysenteriae, V. cholerae and S. typhimurium) in five typical water samples. Compared to traditional specific primers, the qPCR method could be finished within 5 h, the detection accuracy was 94%, and the detection limit was the amount of DNA extracted from 2.7 cells. The results showed that V. cholera did not exist in the Yulin region in general. The positive rate of E. coli was the highest in all kinds of waters, and it could be detected continuously when the water was slightly polluted. For seriously polluted water, E. coli was the main pathogenic bacteria. When the cell density of pathogenic flora detected by using universal primers exceeded 104 copies 100 mL−1, S. typhimurium and S. dysenteriae could be detected continuously. When the cell density of pathogenic flora was less than 104 copies 100 mL−1, the bacteria detected in the water were bacteria other than 4 kinds of typical pathogens, which meant that 104 copies 100 mL−1 could be considered one of the important signs of water pathogenic pollution. Among the five typical water samples in this study, it has good universality. However, the universality of qPCR method in water samples with more serious pollution and more complex forms of pollution needs further study.
Data availability
The data presented in this study are available in the article.
References
Shokri, A., Sabzevari, S. & Hashemi, S. A. Impacts of flood on health of Iranian population: Infectious diseases with an emphasis on parasitic infections. Parasite Epidemiol. Control 9, 1–11 (2020).
Wu, J. & An, Q. Y. Analysis on epidemiological characteristics of intestinal infectious disease in Dalian city 1981–2010. Prev. Med. Trib. 12, 1151–1154 (2011).
Dong, G. H., Zhang, Z., Zhu, L. J. & Sun, Y. C. Epidemiological characteristics of intestinal infectious diseases in Shenyang from 2014–2019. Career Health 37(03), 355–358 (2021).
Shi, Y. P. et al. Epidemiological characteristics of intestinal infectious diseases reported in Beijing 2010–2019. Cap. J. Public Health 15(04), 192–196 (2021).
You, J. H., Wei, P. M. & Dong, D. G. Epidemiological characteristics of class A and B intestinal infectious diseases in Xinghua City 1990–2019. Chin. J. Dis. Control Prev. 21(11), 1348–1351 (2020).
Jia, R. C. Analysis of the epidemic of intestinal infectious diseases in army units in 2017–2018. J. Prev. Med. Chin. People’s Lib. Army 38(06), 41–42 (2020).
Lund, V. Evaluation of Eschericia coli as an indicator for the presence of Campylobacter jejuni and Yersinia enterocolitica in chlorinated and untreated oligotrophic lake water. Water Res. 30(6), 1528–1534 (1996).
Tang, M. L. Y. & Lau, S. C. K. Strategy to evaluate changes in bacterial community profiles and bacterial pathogen load reduction after sewage disinfection. Front. Microbiol. 13, 919207. https://doi.org/10.3389/FMICB.2022.919207 (2020).
Condon, K. et al. Using bacterial whole genome sequencing to identify toxin genes associated with disease outbreaks in black tiger shrimp (Penaeus monodon) aquaculture production. Aquaculture 546, 737255. https://doi.org/10.1016/J.AQUACULTURE.2021.737255 (2022).
Wolf-Baca, M. & Siedlecka, A. Detection of pathogenic bacteria in hot tap water using the qPCR method: Preliminary research. SN Appl. Sci. 1, 840. https://doi.org/10.1007/s42452-019-0533-1 (2019).
Botes, M., de Kwaadsteniet, M. & Cloete, T. E. Application of quantitative PCR for the detection of microorganisms in water. Anal. Bioanal. Chem. 405, 91–108. https://doi.org/10.1007/s00216-012-6399-3 (2013).
Yasar, S. A. et al. Quantitative detection of human- and canine-associated Bacteroides genetic markers from an urban coastal lagoon. Water Sci. Technol. J. Int. Assoc. Water Pollut. Res. 84(7), 1732–1744 (2021).
Wasiewska, L. A. et al. Amplification-free, highly sensitive electrochemical DNA-based sensor for simultaneous detection of stx1 and stx2 genes of Shiga toxin-producing E. coli (STEC). Electrochim. Acta 441, 141814. https://doi.org/10.1016/J.ELECTACTA.2023.141814 (2023).
Nadia, R. et al. Morphological and molecular responses of the sea urchin Paracentrotus lividus to highly contaminated marine sediments: The case study of Bagnoli-Coroglio brownfield (Mediterranean Sea). Mar. Environ. Res. 154(C), 104865. https://doi.org/10.1016/j.marenvres.2019.104865 (2020).
Boukerb, A. M. et al. Comparative analysis of fecal microbiomes from wild waterbirds to poultry, cattle, pigs, and wastewater treatment plants for a microbial source tracking approach. Front. Microbiol. 12, 697553. https://doi.org/10.3389/FMICB.2021.697553 (2021).
Brumfield, K. D. et al. Metagenomic sequencing and quantitative real-time PCR for fecal pollution assessment in a urban watershed. Front. Water 3, 626849. https://doi.org/10.3389/FRWA.2021.626849 (2021).
Fan, L. H. et al. Verification of bacteroidales 16S rRNA markers as a complementary tool for detecting swine fecal pollution in the Yangtze Delta. J. Environ. Sci. 90(C), 59–66 (2020).
Laura, K. M. et al. Comparison of qPCR versus culture for the detection and quantification of Clostridium difficile environmental contamination. PLoS ONE 13(8), e0201569. https://doi.org/10.1371/journal.pone.0201569 (2018).
Samuel, D. et al. Monitoring urban beaches with qPCR vs. culture measures of fecal indicator bacteria: Implications for public notification. Environ. Health 16, 45. https://doi.org/10.1186/s12940-017-0256-y (2017).
Silvia, N. M., Adriana, M. R. & Ricardo, J. S. Evaluation of Legiolert™ for the detection of Legionella pneumophila and comparison with spread-plate culture and qPCR methods. Curr. Microbiol. 78, 1792–1797. https://doi.org/10.1007/s00284-021-02436-6 (2021).
Islam, M. S. et al. Use of the polymerase chain reaction and fluorescent-antibody methods for detecting viable and nonculturable Shigella dysenteriae type 1 in laboratory microcosms. Appl. Environ. Microbiol. 59, 536–540 (1993).
Song, J. H. et al. Detection of Salmonella typhi in the blood of patients with typhoid fever by polymerase chain reaction. J. Clin. Microbiol. 31, 1439–1443 (1993).
Zhang, C. M., Wang, X. C., Zhou, J. H. & Ji, Z. Study on the relationship between intestinal pathogenic microorganisms and fecal pollution indicator bacteria in urban surface water. J. Environ. Sci. 32(11), 2789–2794 (2012).
Nandi, B. et al. Rapid method for species-specific identification of Vibrio cholerae using primers targeted to the gene of outer membrane protein OmpW. J. Clin. Microbiol. 38, 4145–4151 (2000).
American Public Health Association. American Water Works Association and Water Environment Federation of Standard Methods for the Examination of Water and Wastewater 20th edn. (American Public Health Association, 1998).
Zeki, S., Aslan, A., Burak, S. & Rose, J. B. Occurrence of a human-associated microbial source tracking marker and its relationship with faecal indicator bacteria in an urban estuary. Lett. Appl. Microbiol. 72(2), 167–177 (2021).
Yoon, T., Kim, S., Kim, J. H. & Park, K. S. A syringe-based and centrifugation-free DNA extraction procedure for the rapid detection of bacteria. Chemosensors 9(7), 167 (2021).
Haugland, R. A., Vesper, S. J. & Wymer, L. J. Quantitative measurement of Stachybotrys chartarum conidia using real time detection of PCR products with the TaqManTM fluorogenic probe system. Mol. Cell. Probes 13, 329–340 (1999).
Linke, R. B. et al. Identifying inorganic turbidity in water samples as potential loss factor during nucleic acid extraction: Implications for molecular fecal pollution diagnostics and source tracking. Front. Microbiol. 12, 660566. https://doi.org/10.3389/fmicb.2021.660566 (2021).
Zimmer, F. A. G. et al. Combined digital PCR and next generation DNA-sequencing based approach for tracking nearshore pollutant dynamics along the southwest United States/Mexico border. Front. Microbiol. 12, 674214. https://doi.org/10.3389/FMICB.2021.674214 (2021).
Soulieman, N., Al Mariri, A. & Al, A. F. Detection of Shigella in raw bovine milk by polymerase chain reaction. Iraqi J. Vet. Sci. 34(1), 9–16 (2020).
Tesfa, W. M., Junye, W. & Nigus, D. M. A modified hydrological model for assessing effect of pH on fate and transport of Escherichia coli in the Athabasca River basin. J. Hydrol. 582(C), 124513. https://doi.org/10.1016/j.jhydrol.2019.124513 (2020).
McCurdy, P., Luffman, I., Joyner, T. A. & Maier, K. Storm sampling to assess inclement weather impacts on water quality in a karst watershed: Sinking Creek, Watauga watershed, East Tennessee. J. Environ. Qual. 50(2), 429–440 (2021).
Strube, M. L. et al. A detailed investigation of the porcine skin and nose microbiome using universal and Staphylococcus specific primers. Sci. Rep. 8(1), 1–9 (2018).
Saleem, F., Edge, T. A. & Schellhorn, H. E. Validation of qPCR method for enterococci quantification at Toronto beaches: Application for rapid recreational water monitoring. J. Gt. Lakes Res. 48(3), 707–716 (2022).
Kumar, H. et al. Whole metagenome sequencing of cecum microbiomes in Ethiopian indigenous chickens from two different altitudes reveals antibiotic resistance genes. Genomics 112(2), 1988–1999 (2020).
Kincaid, J. C., Owen, M. R., Pavlowsky, R. T. & Mirza, B. S. Microbiome of bacterially impaired watersheds: Distribution of potential bacterial pathogens. Diversity 14(2), 96 (2022).
Acknowledgements
The authors gratefully acknowledge financial support from the National Natural Science Foundation of China (52100198), Shaanxi Province Young Talents Sponsorship Project (20230450), the Youth Innovation Team of Shaanxi Universities in 2022(PI: Wu Zhansheng) and the Shaanxi Provincial Department of Education Fund (21JK0663).
Author information
Authors and Affiliations
Contributions
M.G. did writing—original draft preparation and supervision, F.T., Y.S. and Y.P. did writing—review; editing, data curation and revised the manuscript, All authors reviewed the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Gao, M., Tan, F., Shen, Y. et al. Rapid detection method of bacterial pathogens in surface waters and a new risk indicator for water pathogenic pollution. Sci Rep 14, 1614 (2024). https://doi.org/10.1038/s41598-023-49774-y
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-023-49774-y
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
