Plant-based production of a protective vaccine antigen against the bovine parasitic nematode Ostertagia ostertagi

Zwanenburg, Laurens; Borloo, Jimmy; Decorte, Bregt; Bunte, Myrna J. M.; Mokhtari, Sanaz; Serna, Sonia; Reichardt, Niels-C.; Seys, Leen J. M.; van Diepen, Angela; Schots, Arjen; Wilbers, Ruud H. P.; Hokke, Cornelis H.; Claerebout, Edwin; Geldhof, Peter

doi:10.1038/s41598-023-47480-3

Download PDF

Article
Open access
Published: 22 November 2023

Plant-based production of a protective vaccine antigen against the bovine parasitic nematode Ostertagia ostertagi

Laurens Zwanenburg¹,
Jimmy Borloo¹,
Bregt Decorte¹,
Myrna J. M. Bunte²,
Sanaz Mokhtari²,
Sonia Serna^4,5,
Niels-C. Reichardt^4,5,
Leen J. M. Seys¹,
Angela van Diepen³,
Arjen Schots²,
Ruud H. P. Wilbers²,
Cornelis H. Hokke³,
Edwin Claerebout¹ &
…
Peter Geldhof¹

Scientific Reports volume 13, Article number: 20488 (2023) Cite this article

1414 Accesses
1 Citations
36 Altmetric
Metrics details

Subjects

Abstract

The development of effective recombinant vaccines against parasitic nematodes has been challenging and so far mostly unsuccessful. This has also been the case for Ostertagia ostertagi, an economically important abomasal nematode in cattle, applying recombinant versions of the protective native activation-associated secreted proteins (ASP). To gain insight in key elements required to trigger a protective immune response, the protein structure and N-glycosylation of the native ASP and a non-protective Pichia pastoris recombinant ASP were compared. Both antigens had a highly comparable protein structure, but different N-glycan composition. After mimicking the native ASP N-glycosylation via the expression in Nicotiana benthamiana plants, immunisation of calves with these plant-produced recombinants resulted in a significant reduction of 39% in parasite egg output, comparable to the protective efficacy of the native antigen. This study provides a valuable workflow for the development of recombinant vaccines against other parasitic nematodes.

A Plant-Produced in vivo deglycosylated full-length Pfs48/45 as a Transmission-Blocking Vaccine Candidate against malaria

Article Open access 08 July 2019

Immunoinformatics approaches in developing a novel multi-epitope chimeric vaccine protective against Saprolegnia parasitica

Article Open access 27 January 2024

A novel Schmallenberg virus subunit vaccine candidate protects IFNAR-/- mice against virulent SBV challenge

Article Open access 23 November 2020

Introduction

Gastrointestinal nematode infections pose a major health concern for both humans and animals. Over one billion people are affected by gastrointestinal nematodes, mostly children living in developing countries^1,2. In the veterinary field, basically every animal is either infected or at risk of being infected, compromising animal health, welfare and, in the case of farm animals, productivity^3,4. Controlling these nematode infections primarily entails periodic mass anthelmintic drug administration. In the long term, a control strategy solely reliant on anthelmintics is not viable due to the growing global trend of anthelmintic resistance^5,6. With limited new drug compounds in the pipeline, there is strong interest for alternative and sustainable control measures. Immunological control of nematode infections through vaccination is considered promising with regards to sustainability and cost-effectiveness^7,8. Unfortunately, progress in vaccine development has been limited, with only two commercial vaccines available on the market for animals. These are vaccines against the bovine lungworm Dictyocaulus viviparus (Bovilis Huskvac™) and against the sheep gastrointestinal nematode Haemonchus contortus (Barbervax™/Wirevax™), utilizing irradiated larvae and crude antigen mixtures, respectively. This approach is considered impractical for many nematode species due to the difficulty of obtaining sufficient quantities of larvae, worms or purified worm material^9,10. For this reason, a large number of recombinant produced subunit vaccines have been evaluated against a range of gastrointestinal nematodes. Unfortunately, very few of these vaccines induced a sufficient level of protection to consider further commercial development, often attributed to inappropriate recombinant expression¹⁰.

The development of an experimental vaccine against the bovine abomasal nematode Ostertagia ostertagi has faced similar problems. This vaccine is based on activation-associated secreted protein, Oo-ASP-1, purified from the excretory-secretory (ES) material of adult O. ostertagi worms¹¹. Immunisation of calves with this antigen resulted in a significant reduction in faecal egg output ranging from 56–74% in several studies^11,12,13. In contrast, recombinant versions of the native Oo-ASP-1 have been unsuccessful in eliciting a protective immune response. Previous studies have demonstrated that recombinants produced in Escherichia coli and insect cells induce minimal cross-reactive antibody responses to the native antigens¹⁴. More recently, a recombinant Oo-ASP-1 produced in Pichia pastoris was able to trigger a cross-reactive antibody response but failed to provide protection against a controlled O. ostertagi challenge infection. Notably, the capacity of the P. pastoris-expressed Oo-ASP-1 to trigger a local humoral and cellular response was significantly lower than that of the native antigen¹³.

The overall objective of the current study was to identify the structural features of the native Oo-ASP-1 that are necessary for the induction of a protective immune response and use the information to steer recombinant expression. The first aim was to analyse and compare protein folding and N-glycosylation of the native and recombinant Oo-ASP-1 versions and evaluate the impact of potential differences on antibody recognition. The second aim was to incorporate the missing key elements via an appropriate expression system and produce new recombinant versions of Oo-ASP-1. These were subsequently evaluated for their immunostimulatory and protective capacity as a vaccine antigen.

Results

Allelic variation of native Oo-ASP-1 does not influence secondary protein structure and has no implication on antibody recognition

The native antigen is purified from the excretory/secretory (ES) material secreted by thousands of O. ostertagi worms, with the result that allelic variants of Oo-ASP-1 are potentially present in the native antigen preparation. Such variation is not present in the P. pastoris produced ASP as it is based on a single Oo-ASP-1 coding sequence. To investigate this, Oo-ASP-1 RNA was extracted from a pool of North-American and European O. ostertagi worms, converted into cDNA and bidirectionally sequenced. The analysis revealed nine amino acid residues highly susceptible to polymorphisms, which were all conserved in both isolates (Fig. 1a).

As this allelic variation may influence secondary structural features, circular dichroism (CD) experiments were subsequently conducted on both native and P. pastoris recombinant Oo-ASP-1. The CD spectra for both molecules were almost identical with a major peak at 208 nm, and an additional shoulder at 221 nm (Fig. 1b), indicating a high α-helical content in both samples, indicative of a comparable secondary protein structure. High α-helical content is a characteristic feature of the superfamily of cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins (CAP) to which the ASPs belong^15,16,17. To further evaluate the impact of allelic variation on antibody recognition, two recombinant versions that carried all amino-acid substitutions were produced in P. pastoris and tested in a competition ELISA. In this assay, serum from calves immunised with native Oo-ASP-1 was pre-incubated with different concentrations of either native Oo-ASP-1 or one of the P. pastoris recombinants. The formed antibody-antigen complexes were transferred onto native Oo-ASP-1 coated ELISA plates allowing the antibodies to either maintain their binding to the pre-incubation antigen or dissociate and bind to the antigen coated on the plate. Antibody binding to the coated antigen was measured and expressed in optical density (OD) values. As displayed in Fig. 1c, native Oo-ASP-1 was capable of quasi completely disrupting the initially formed complexes between antibodies and both P. pastoris recombinant versions, demonstrated by the higher OD values compared to native Oo-ASP-1. This is an indicator that the introduction of the allelic variants in the recombinants had no significant impact on antibody recognition.

Comparable protein folding and oligomerisation between native and P. pastoris Oo-ASP-1

ASPs are known to bear multiple signature disulphide bonds^18,19, dictating the characteristic folding of these proteins. The cysteine-containing tryptic peptides on the native Oo-ASP-1 sequence that were anticipated to be involved in disulphide bonding are depicted in Fig. 1d. A liquid chromatography-mass spectrometry (LC–MS) approach was employed to elucidate the disulphide bonding patterns of native and P. pastoris Oo-ASP-1. The native antigen was found to have intramolecular disulphide bonds 3, 4 and 5, but no thiol-carrying peptides corresponding to bonds 1, 2 and 6 were detected (Supplementary Table 1). The presence of all CAP protein-hallmark intramolecular disulphide bonds was confirmed for the P. pastoris recombinant (Supplementary Table 1), consistent with previous observations from the 3D-structure (Fig. 1e)¹⁷. It was postulated that the inconsistency for native Oo-ASP-1 compared to the prediction data may be largely due to the purification method of this antigen, as it involved the reduction and reoxidation of disulphide bonds induced by dithiothreitol (DTT), followed by thiol-Sepharose affinity and ion exchange chromatography.

Therefore, native Oo-ASP-1 was purified from O. ostertagi ES material via size-exclusion chromatography, omitting the reduction and oxidation steps, and subsequently included in the MS analyses. With this approach, all predicted intramolecular disulphide bonds were identified for the native antigen (Supplementary Table 1), indicating no differences in protein folding between the native Oo-ASP-1 and the P. pastoris recombinant. In terms of oligomerisation, it was previously reported that native Oo-ASP-1 forms a disulphide bridge-based dimer through oxidation of both monomer’s Cys195 residues¹⁷. Reducing and non-reducing gel analyses (Supplementary Figure 1) combined with mass spectrometric data confirmed that both native Oo-ASP-1 and the P. pastoris recombinant dimerize and that no aberrations in quaternary structure were further noted.

Previous immunisation studies in cattle were conducted with the thiol-Sepharose purified native Oo-ASP-1, consistently demonstrating the capacity of this antigen to provide protection against O. ostertagi infections^11,12,13. Given the difference in disulphide bonding pattern, it was imperative to investigate whether the size-exclusion purified native Oo-ASP-1 could still induce protection. To evaluate this, a bovine immunisation-infection study (n = 7) was conducted comparing a group immunised with the size-exclusion purified native Oo-ASP-1 to a QuilA, a saponin-based adjuvant, control group. Over the course of the study, faecal egg output for the group immunised with Oo-ASP-1 was found to be lower, resulting in a 40% reduction in cumulative faecal egg counts (P < 0.05) (Fig. 1f). No differences in total worm burden were observed between the Oo-ASP-1 immunised and the QuilA control groups, but the Oo-ASP-1 immunised group showed a significantly higher percentage of inhibited L4-stage worms (P < 0.01) (Supplementary Table 2). These results are similar to the outcome obtained with the thiol-Sepharose purified Oo-ASP-1 and indicate that the disulphide bond patterning has no discernible impact on the antigen’s capacity to provide protection.

Differences in N-glycosylation between native and P. pastoris Oo-ASP-1 impact glycan-directed antibody recognition.

Following the confirmation of the similar protein structure of the P. pastoris recombinant and native Oo-ASP-1, the subsequent study sought to analyse the N-glycosylation of both antigens and assess the impact of potential disparities on antibody recognition. Previous studies showed that native Oo-ASP-1 bears two FucGalGlcNAc₃Man₃ moieties per monomer at asparagine residues 9 and 37 (Asn9 and Asn37)²⁰. In contrast, the P. pastoris recombinants were expressed in a GnM5 strain²¹, which adds predominantly GalGlcNAc₃Man₅ moieties to the aforementioned Asn residues¹⁷.

To evaluate the relevance of N-glycans in antibody recognition, both versions of Oo-ASP-1 were subjected to enzymatic deglycosylation using Peptide:N-glycosidase F (PNGase F), with the aim to compare them in a competition ELISA. In agreement with previous observations²⁰, Oo-ASP-1 could not be fully deglycosylated without denaturing and thus structurally disrupting the protein, hampering further competition ELISA analyses.

As an alternative to evaluate the role of Oo-ASP-1 associated N-glycans in antibody recognition, microarrays carrying a variety of synthetic N-glycans, presented in a previous study²², were screened with pooled native Oo-ASP-1-specific antibodies, immunopurified from serum of calves immunised with either native Oo-ASP-1, P. pastoris Oo-ASP-1 or QuilA. It was demonstrated that ASP-specific antibodies were able to bind to several N-glycans in the absence of the ASP-protein, albeit only from native Oo-ASP-1 immunised calves (Fig. 2a). Antibodies from native Oo-ASP-1 immunised calves distinctly recognised N-glycans that carried core α1,3-fucose, while recognition of N-glycans that lacked core fucose or carried only core α1,6-fucose was limited. In contrast, ASP-specific antibodies from P. pastoris recombinant-immunised calves exhibited minimal recognition of N-glycans on the array. QuilA-immunised calves lacked ASP-specific antibodies and thus microarray assay signals were negative (Supplementary Figure 2).

While the array data suggests the presence of core α1,3-fucose on N-glycans of native Oo-ASP-1, this was previously not observed²⁰. This could be explained by the fact that the N-glycan release in that study was conducted with PNGase F, which is unable to remove N-glycans that contain an α1,3-fucosylated core²³. To reassess the N-glycosylation of native Oo-ASP-1, the denatured protein was treated with peptide:N-glycosidase A (PNGase A) to release all N-glycans prior to MS analysis. Released N-glycans were paucimannosidic, lacking further branching, or complex-type, where the trimannosyl core element was substituted with a GlcNAc or GalGlcNAc moiety (Fig. 2b), in each case also containing a fucose residue in the overall composition, in line with previous findings²⁰. Hydrofluoric acid (HF) treatment followed by MS subsequently confirmed the presence of both α1,3-fucose and α1,6-fucose, but never on the same glycans (Supplementary Figure 3).

Newly expressed Nicotiana benthamiana Oo-ASP-1 competes with native Oo-ASP-1 for antibody binding

Given that native Oo-ASP-1 is characterised by N-glycans carrying either core α1,3-fucose or core α1,6-fucose, two recombinant versions, each containing complex-type N-glycans with galactosylated branches and one of the fucose linkages, were synthesised in β1,2-xylosyltransferase and α1,3-fucosyltransferase down-regulated (ΔXT/FT) N. benthamiana. The plant’s leaves were infiltrated with Agrobacterium tumefaciens containing transfer DNA for the Oo-ASP-1 antigen and specific glycan-processing enzymes (Fig. 3a). The expressed antigens were secreted in the plant’s apoplast fluid and harvested six days after infiltration via vacuum infiltration of an extraction buffer, followed by centrifugation.

To compare basic protein structure of the newly generated recombinants, SDS-PAGE analysis was conducted, which revealed that both recombinant glycoforms exhibited a migration pattern of approximately 50 kDa (Fig. 3b), consistent with native Oo-ASP-1. MS analysis to evaluate the N-glycosylation showed that the N. benthamiana recombinants carried a variation of N-glycans, including the mono-antennary N-glycans present on the native antigen (Fig. 3c). Importantly, core fucose was present on almost all N-glycans. Although the enzymes used for introducing core α1,3-fucose and core α1,6-fucose are highly specific, further confirmation of the correct linkage type was conducted via lectin-assays (Fig. 3d). Terminal galactosylation was low for both recombinants but was increased after affinity purification with agarose bound Ricinus Communis Agglutinin I (Supplementary Figure 4) leading to an N-glycosylation profile that more closely resembles that of native Oo-ASP-1. Post-purification, the most abundant N-glycans found on the N. benthamiana Oo-ASP-1 include FucGlcNAc₃Man₃, FucGalGlcNAc₃Man₃, FucGlcNAc₄Man₃, FucGalGlcNAc₄Man₃, FucGal₂GlcNAc₄Man₃.

To evaluate the impact of N-glycosylation on ASP immunogenicity, it was attempted to produce N. benthamiana recombinants that completely lacked N-glycans. However, mutation of the N-glycosylation sites Asn9 and Asn37 resulted in complete elimination of ASP expression, most likely attributed to the function of N-glycosylation in protein folding and subsequent secretion in the apoplast fluid. Also, attempts to enzymatically remove N-glycans from the intact protein using PNGase F treatment led to incomplete deglycosylation, which was also observed for P. pastoris and previously for intact native Oo-ASP-1²⁰.

The presence of shared antibody binding sites between the N. benthamiana recombinants and the native antigen was confirmed via indirect ELISA (Supplementary Figure 5), demonstrating a clear recognition of both N. benthamiana recombinants by serum from native Oo-ASP-1 immunised calves. Via a competition ELISA it was revealed that both glycoforms, especially the core α1,3-fucose variant, exhibited a stronger inhibition of antibody binding to native Oo-ASP-1 compared to the P. pastoris recombinant (Fig. 3e). These findings suggest a greater degree of antibody epitope overlap between native Oo-ASP-1 and the two N. benthamiana recombinants, with a particular contribution of the core α1,3-fucose epitope in line with the glycan array data (Fig. 2a).

Immunisation with N. benthamiana Oo-ASP-1 results in a reduction in faecal egg output

With the newly obtained N. benthamiana recombinants, which better mimic the native Oo-ASP-1, a bovine immunisation and challenge study was conducted to evaluate their ability to protect calves against a controlled O. ostertagi infection. The recombinant vaccine comprised a 1:1 ratio of N. benthamiana recombinants (n = 8) with core α1,3-fucose and core α1,6-fucose, as both fucose types are also present on the native antigen, and its protective efficacy was assessed in comparison to native Oo-ASP-1 (n = 7) and a QuilA-adjuvant control group (n = 7).

After three intramuscular immunisations followed by a trickle infection, the N. benthamiana group exhibited a decline in faecal egg output over time in a similar trend to that of the native Oo-ASP-1 group (Fig. 4a). This resulted in a reduction of the cumulative faecal egg output by 57% for the native Oo-ASP-1 group and 45% for the N. benthamiana recombinant group, compared to adjuvant-controls (Fig. 4b). Despite not achieving statistical significance (P > 0.05), likely due to the high variation in the adjuvant-control group, it was the first recombinant ASP that elicited a comparable reduction in faecal egg output to that of native Oo-ASP-1^13,14. Immunisation with native Oo-ASP-1 or the N. benthamiana recombinant did not clearly impact (P > 0.05) the total worm burden (Fig. 4c) or length of male worms. Female worm length was significantly reduced in the native vaccine group (Table 1). The percentage of inhibited L4-stage worms was increased (P < 0.05) in the native Oo-ASP-1 group (Table 1).

Table 1 Overview of parasitological parameters obtained after the Nicotiana benthamiana Oo-ASP-1 immunisation-challenge study. n, number of animals; EPG, mean cumulative eggs per gram faeces; % L4, percentage of L4 worms observed in post-necropsy worm counting; Male and female worm length in µm.

Full size table

After the second immunisation, a native Oo-ASP-1-reactive systemic IgG1 (Fig. 4d) and IgG2 (Supplementary Figure 6) response was induced by the N. benthamiana recombinant, comparable to the native Oo-ASP-1 group. Also, the recombinant vaccine was able to elicit a significant (P < 0.05) increase in native Oo-ASP-1-reactive mucosal IgG1 (Fig. 4e) and IgG2 (Supplementary Figure 6) compared to the control group, which had only been observed for calves immunised with native Oo-ASP-1 in previous studies. No differences (P > 0.05) in local IgA were noted between the three groups (Supplementary Figure 6).

To increase the statistical power of these data, the immunisation-challenge study was repeated with larger group sizes (n = 12). In this study, the N. benthamiana recombinant with core α1,3/α1,6-fucose in a 1:1 ratio was compared to a QuilA-alone adjuvant group. Consistent with the initial study, immunisation with the N. benthamiana recombinant resulted in a decrease in faecal egg output over time (Fig. 5a) and a significant reduction of 39% (P < 0.01) in cumulative faecal egg excretion (Fig. 5b), validating the findings of the first study. No differences were observed between the two vaccine groups in the percentage of L4-stage worms (Table 2), total worm burden (Fig. 5c) or male and female worm length (Table 2).

Table 2 Overview of parasitological parameters obtained after the Nicotiana benthamiana Oo-ASP-1 immunisation-challenge study. n, number of animals; EPG, mean cumulative eggs per gram faeces; % L4, percentage of L4 worms observed in post-necropsy worm counting; Male and female worm length in µm.

Full size table

The humoral immune response to the N. benthamiana recombinant was in line with the previous smaller group size study, with a clear native Oo-ASP-1-reactive systemic IgG1 (Fig. 5d) and IgG2 (Supplementary Figure 7) response after the second and third immunisations, respectively. The capacity of the N. benthamiana recombinant to induce a native Oo-ASP-1-reactive mucosal IgG1 (Fig. 5e) and IgG2 (Supplementary Figure 7) response was also confirmed, whereas local IgA did not differ between the N. benthamiana recombinant and QuilA groups (Supplementary Figure 7).

Finally, to study the impact of introducing the two types of core fucoses on antibody recognition, glycan microarrays were screened with Oo-ASP-1-specific antibodies from calves immunised with native Oo-ASP-1, N. benthamiana recombinants or QuilA. Analogous to the native Oo-ASP-1 vaccine group, antibodies from N. benthamiana-immunised calves exclusively recognised N-glycans carrying core α1,3-fucose (Fig. 6), but not glycans that carry core α1,6-fucose, or lack fucose overall. Recognition was more defined for N. benthamiana-immunised calves compared to native Oo-ASP-1 vaccinated animals, potentially due to the high presence (approximately 50%) of core α1,3-fucose on the N. benthamiana recombinants.

Discussion

The outcome of this study showed that, for the first time, glyco-engineered versions of a nematode vaccine antigen produced in N. benthamiana were able to induce a protective immune response against a challenge infection, consistent with the native version of the antigen^11,12,13. The contribution of antigen glycosylation in the immune response against helminth infections has been a topic of interest for years. N-glycosylation can contribute in various ways to the increased protective immunogenicity: On a structural level, N-glycans play a crucial role in maintaining the stability of the antigen, aiding in its solubility in aqueous environments²⁴, promoting proper protein folding²⁵, and protecting against proteolytic activity²⁶. Antigen-presenting cells (APC) recognise glycans via specialised pattern-recognition receptors (PRR), such as Toll-like receptors (TLR) and C-type lectin receptors (CLR)^27,28,29. These receptors have a regulatory effect on the adaptive immunity, typically by dendritic cell maturation and triggering a Th2 response³⁰, and thus play a pivotal role in the early stage of the immune response.

In addition to stimulating innate immune responses, glycans can also be the targets of an antibody response in the infected or immunised host. Several studies have aimed to unravel the role of specific glycan residues on triggering an immune response, as exemplified in the case of H. contortus and Schistosoma mansoni. It was reported that sheep antibodies raised against core α1,3-fucosylated plant glycoproteins were capable of reacting with α1,3-fucose-carrying glycoproteins from H. contortus³¹. For S. mansoni, it was demonstrated that IgG1, IgG3, and IgG4 from infected humans displayed a distinctive level of reactivity towards N-glycans that carried core α1,3-fucose³². For O. ostertagi, glycan array results confirmed the involvement of core α1,3-fucose as part of the antibody epitope, as N-glycans bearing core α1,3-fucose were distinctly recognised by IgGs generated in native Oo-ASP-1 immunised calves. The antibodies were purified against the native antigen, which carries a small fraction of core α1,3-fucose. Therefore, recognition of the α1,3-fucosylated N-glycans is attainable solely through immunisation with α1,3-fucose carrying native Oo-ASP-1 and the N. benthamiana recombinants. Calves immunised with P. pastoris Oo-ASP-1, lacking this core fucose, induced native Oo-ASP-reactive antibodies that did not demonstrate a clear recognition of N-glycans on the glycan microarray. This observation implies the involvement of core α1,3-fucose as part of an antibody epitope. Interestingly, only core fucose carrying vaccine antigens were able to induce a mucosal IgG response, illustrated in current and previous immunisation trials^11,12,13. The exact role of these antibodies in case of O. ostertagi remains unclear, but it was demonstrated for sheep that the presence of mucosal antibodies prevented the establishment of Trichostrongylus colubriformis in the gut, although such observations were not made for the abomasal nematodes Teladorsagia circumcincta and H. contortus³³.

Core α1,6-fucose, the most dominant linkage type of fucose found on native Oo-ASP-1, is generally considered non-immunogenic since it is present on mammalian proteins³⁴. However, it is important to note that while certain N-glycan components may not be directly targeted by antibodies, they may still affect the immunogenicity of a protein. For instance, it has been suggested that oligomannosidic glycans present on helminth glycoproteins can bind to several soluble and cell-surface lectin receptors, such as mannose-binding lectin (MBL) and Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin (DC-SIGN). Through this process, glycans can facilitate antigen internalisation and modulate the adaptive immune response through lectin-mediated signalling pathways³⁵. Depending on its composition, the steric and structural configuration of the N-glycan can positively or negatively impact the accessibility of nearby epitopes, including those associated with the protein backbone²⁴.

N. benthamiana efficiently addressed the core fucose deficiency observed for P. pastoris, resulting in the production of two ASP variants containing either core α1,3-fucose or core α1,6-fucose. The synthesis of recombinant antigens was relatively fast and yielded approximately 1 mg of purified protein per plant, providing sufficient material for extensive in vitro and in vivo assessment. A previous study established that N. benthamiana is a suitable expression platform for the production of helminth-type CAP-domain proteins³⁶, such as ASPs. It was also shown that the N-glycosylation machinery of the plant is flexible, as previous studies demonstrated the successful synthesis of highly immunogenic GalNAcβ1-4(Fucα1-3)GlcNAc (LDN-F) and Galβ1-4(Fucα1-3)GlcNAc (Lewis X) glycan motifs, as well as core α1,3/α1,6-fucose moieties^37,38. LDN-F and Lewis X are found on helminths such as S. mansoni^39,40, H. contortus⁴¹, Opisthorchis viverrine⁴², Trichinella spiralis⁴³ and Trichuris suis⁴⁴. The flexible nature of this transient expression system could allow for efficient production of diverse glycoproteins with modified N-glycans, which could greatly facilitate the transition towards recombinant subunit vaccines against helminths.

Recombinant ASP-expression was conducted in ΔXT/FT N. benthamiana with down-regulated β1,2-xylosyltransferase and α1,3-fucosyltransferase. As previously described, a substantial reduction in the levels of the targeted saccharides was observed, albeit complete elimination was not achieved⁴⁵. This indicates that xylose and core α1,3-fucose were present on all the evaluated ASP-based recombinants, suggesting that the core α1,6-fucose glycovariant also contained a small fraction of α1,3-fucosylated N-glycans, but not vice versa. Consequently, the unavailability of a fucose-lacking version of the N. benthamiana recombinant precluded comparative evaluation of antibody recognition and antigen immunogenicity. The N. benthamiana recombinants manifested a fraction of glycans carrying xylose, which are not found on native Oo-ASP-1, increasing the heterogeneity of the recombinant’s glycan profile.

Despite the absence of conclusive evidence regarding the importance of terminal galactose on triggering a protective immune response, it was opted to mimic the native N-glycosylation of Oo-ASP-1 to the greatest extent possible, thus by incorporating terminal galactose. After expression in N. benthamiana, the presence of terminal galactose on both recombinants was low, attributed to the presence of endogenous beta-galactosidases⁴⁶. Similar observations were made for proteins produced in glyco-engineered Nicotiana tabacum⁴⁷, but a higher degree of terminal galactose is expected for P. pastoris antigens⁴⁸. Purification with agarose-bound Ricinus Communis Agglutinin I (RCA I) raised the ratio of N-glycans with terminal galactose, but N-glycans lacking galactose were still present. As Oo-ASP-1 contains two separate N-glycans, it is likely that lectin-based galactose enrichment occurs even if only one of the N-glycans carries a terminal galactose. Despite the heterogeneity, all dominant hybrid-type N-glycans identified on the native antigen were verified to be present on N. benthamiana.

For future studies, reducing the heterogeneity of the N-glycosylation profile and increasing the degree of galactosylation to more closely match the glycans found on the native antigen may positively impact the vaccine-efficacy of the N. benthamiana recombinant. Based on the immunogenicity of α1,3-fucose, immunisation with exclusively this glycovariant may further enhance the protective immune response. The rationale in this study for a 1:1 ratio of N. benthamiana recombinants carrying core α1,3/α1,6-fucose in both bovine immunisation-infection studies was based on two factors: (1) the documented immunogenicity of core α1,3-fucose and (2) the abundance of core α1,6-fucose on the native Oo-ASP-1 antigen. Evaluating the protective capacity of the α1,3- and α1,6-core fucosylated versions separately would be a next logical step.

To improve the vaccine’s efficacy even further, it may also be required to include recombinant versions of other O. ostertagi proteins, such as Oo-ASP-2⁴⁹, cysteine proteinases⁵⁰, gut membrane glycoproteins⁵¹, Ostertagia polyprotein allergen⁵². For T. circumcincta in sheep, immunisation with a combination of eight recombinant proteins resulted in a mean reduction in egg output by 45–70%^53,54. However, it was also stated that the complexity of expression and purification of multiple recombinants negatively impacts a vaccine’s attractiveness for commercialisation⁵⁵. Additional strategies for enhancing vaccine efficacy encompass the assessment of the method of administration, vaccination frequency, antigen dosage per immunisation, and the choice of adjuvants.

N. benthamiana proved to be an efficient platform to tailor recombinant protein glycosylation, making it ideal for delivering proof of concept on the importance of N-glycans in antigen immunogenicity. The demonstrated capacity of this system for large-scale vaccine antigen production, as evidenced in the case of COVID-19⁵⁶, holds significant promise for the prospective generation of helminth glycoproteins. To ensure its competitiveness, especially concerning the production of vaccine antigens for the cost-sensitive livestock sector, further optimisation and upscaling of the N. benthamiana expression system will be crucial. In addition, the presence of plant-specific glycans remains one of the drawbacks that may hamper industrial confidence⁵⁷.

In terms of the required vaccine efficacy to counter O. ostertagia in practice, the observed 39% reduction in cumulative faecal egg output may appear modest. However, obtaining this level of reduction with a recombinant antigen is a unique achievement⁵⁸. In prospect of commercialisation, there are no established guidelines on minimal vaccine efficacy against gastrointestinal nematodes in cattle. In temperate regions with a grazing season of approximately six months, it has been suggested that a 60% decline in the average faecal egg excretion during the first two months of grazing is sufficient to safeguard calves against O. ostertagi infections⁵⁹. Consequently, the abovementioned measures are necessary to enhance the efficacy of this recombinant vaccine. For application of the Oo-ASP-1 vaccine, other expression systems should be assessed for their ability to modify N-glycosylation and introduce core fucose, for example the glyco-engineered P. pastoris GlycoSwitch strain⁶⁰.

Beyond control of ostertagiosis, this study's findings could pave the way for developing recombinant vaccines against other nematode infections. In the veterinary field, other economically important nematode infections include Cooperia oncophora and Dictyocaulus viviparus in cattle, and T. circumcincta and H. contortus in sheep. Immunostimulatory native and recombinant proteins have been identified for these parasites^53,54,61,62, but transitioning towards a single subunit recombinant vaccine that can be produced on a large scale and provide adequate protection has been challenging.

In conclusion, the comparative analyses conducted between a protective native antigen and a non-protective P. pastoris recombinant provided important information on the key elements required to induce a protective immune response. In this study, native Oo-ASP-1 and a non-protective P. pastoris recombinant were found to be highly comparable on protein structure, but microarray analysis revealed that native Oo-ASP-1-induced IgG exhibited distinct reactivity towards glycans carrying core α1,3-fucose. This glycan motif was verified to be present on the native antigen but not on the P. pastoris recombinant. The employment of glyco-engineered N. benthamiana addressed these inconsistencies in N-glycosylation, in particular at the level of core fucosylation, and subsequent immunisation with the new recombinants significantly reduced the faecal egg output in O. ostertagi infected calves. These findings are highly promising for the field of recombinant vaccine development, as the transition from native to recombinant subunit vaccines for various parasitic nematodes has been difficult. Therefore, this workflow could be a valuable approach for recombinant vaccine development against other parasitic nematodes.

Methods

Production and purification of native and P. pastoris Oo-ASP-1

Native Oo-ASP-1 was obtained by collecting adult O. ostertagi worms, preparing the ES fraction⁶³ and purifying Oo-ASP-1 via thiol-Sepharose⁵⁰ or by applying the ES material to a HiLoad 16/70 Superdex 200 pg column (Cytiva) and performing size exclusion chromatography as described in previous studies⁶⁴. P. pastoris recombinant versions of Oo-ASP-1 were expressed and purified as previously described¹⁷.

Production and purification of N. benthamiana Oo-ASP-1

The ΔXT/FT N. benthamiana plants for recombinant expression are a laboratory accession derived from RA-4, and were provided by Dr. Richard Strasser⁴⁵. All handling and use of N. benthamiana and associated samples in this study was conducted in compliance with institutional, national, and international guidelines and legislation.

The sequence encoding the mature Oo-ASP-1 protein was codon optimised in-house (Wageningen University and Research) and synthetically constructed at GeneArt. The gene fragment was flanked with NheI/KpnI restriction site for subcloning behind the Arabidopsis thaliana chitinase gene (cSP) in the plant expression vector pHYG^37,65. To engineer α1,6-linked core fucose, the expression vector pBIN-PLUS with Drosophila melanogaster fucosyltransferase 8 (DmFUT8) was used⁶⁶. The pHYG vector with Schistosoma mansoni fucosyltransferase C (SmFucTC) was used to engineer the α1,3-linked core fucose³⁸. The terminal galactose was engineered by expression of a hybrid β1,4-galactosyltransferase (GalT) from Danio rerio with a replaced CTS domain of rat α2,6-sialyltransferase under control of the Gpa2 promotor in pHYG³⁷. To ensure optimal protein expression, the silencing suppressor P19 from tomato bushy stunt virus in pBIN61 was co-infiltrated. All constructs were transformed to Agrobacterium tumefaciens strain MOG101.

Culturing of A. tumefaciens (strain MOG101), infiltration of ΔXT/FT transgenic N. benthamiana leaves with these bacteria and extraction of the apoplast fluid was done as described previously^37,45. Apoplast fluid was desalted via Sephadex-G25 columns (Cytiva) and purified using the HS POROS® 50 strong cation exchange resin (ThermoFisher) performed on the ÄKTA Prime Liquid Chromatography System (GE Healthcare). Bound Oo-ASP-1 was eluted from the column using a gradient with cation-exchange buffer supplemented with 1 M NaCl at 2 ml/min, followed by dialysis against phosphate-buffered saline (PBS). Protein concentration was determined using a BCA assay (Pierce, ThermoFisher). Successful expression and purification were confirmed on a 12% Bis–Tris SDS-PAGE gel (ThermoFisher) stained with Coomassie Brilliant Blue.

To increase the level of terminal galactose, each glycoform of the N. benthamiana Oo-ASP-1 was subjected to affinity chromatography using agarose-bound Ricinus communis agglutinin-I (Vector Laboratories), largely according to the manufacturer’s instructions. Adaptations: Pierce Spin Columns (Thermofisher) were filled with 0.5 ml of the RCA I slurry with 5 column volumes of binding/wash buffer, each time centrifuging at 75 × g for 1 min in order to discard the flowthrough. In 0.5 ml binding/wash buffer, N. benthamiana recombinants were applied to the column at a concentration of 1 mg/ml, for an incubation time of 1 h at 4 °C while constantly mixing by inversion. Elution was done by a two-time application of 0.5 ml of Glycoprotein Eluting Solution (Vector Laboratories), followed by 1 min centrifugation at 100 × g.

Protein evaluation on sodium dodecyl sulfate polyacrylamide gel electrophoresis

All antigens were evaluated on SDS-PAGE under natural conditions, visualised via Coomassie blue staining as mentioned previously⁶⁴. Denaturing SDS-PAGE was carried out including and omitting β-mercaptoethanol in reducing and non-reducing conditions⁶⁷, respectively.

Oo-ASP-1 RNA extraction, RT-PCR, sub-cloning and sequencing

RNA was extracted from North-American (BARC.NEA, MD, USA) and European (Ghent University, Belgium) 3rd stage larvae separately as follows: after crushing the larvae, the cells were lysed immediately by addition of 1 ml of TRIzol (Gibco, Invitrogen) and incubation at room temperature (RT) for five minutes under constant vortexing. Then, 200 μl of chloroform was added, followed by vigorous shaking for 15 s and incubation on ice for five minutes. After a centrifugation step at 13,500 rpm for ten minutes at 4 °C, the aqueous phase was transferred to a fresh RNase-free tube where the RNA was precipitated by addition of 500 μl of isopropanol and incubation at RT for ten minutes. Centrifugation at 13,500 rpm for ten minutes at 4 °C yielded a pellet which was washed with 1 ml of 75% ethanol and then air-dried. The pellet was subsequently dissolved in 657 μl of diethylpyrocarbonate (DEPC) and DNase treated (addition of 9 μl RNase inhibitor and 9 μl DNase I) with incubation at 37 °C for 30 min. After addition of 750 μl of chloroform and vigorous shaking for 15 s, the sample was centrifuged at 13,500 rpm for ten minutes at 4 °C. The aqueous phase was then transferred to a fresh RNase-free tube and the chloroform-addition step was repeated. The aqueous phase was again transferred to a fresh RNase-free tube where the RNA was precipitated by adding 500 μl of isopropanol with incubation of the sample at RT for ten minutes. After centrifugation of the sample at 13,500 rpm for ten minutes at 4 °C the supernatant was removed and the pellet was washed thoroughly by adding 900 μl ethanol. A centrifugation step at 13,500 rpm for five minutes at 4 °C followed, with subsequent removal of the supernatant and air-drying of the pellet at RT for about ten minutes. The pellet was dissolved in 15 to 25 μl of DEPC water and the RNA concentration was determined. RNA was then converted into cDNA via reverse-transcriptase polymerase chain reaction (RT-PCR) according to the SuperScript™ One-Step RT-PCR with Platinum®Taq System protocol (Invitrogen). PCR mixtures were cleaned up using the GENECLEAN® kit (Q-BioGene) after which purified PCR product was ligated into the pGEM®-T Easy vector (Promega) according to the manufacturer’s instructions. PCR mixtures typically consisted of 50 ng RNA, 0.4 μM of both forward and reverse primers (ASP1-F: ATGCAGGCACTAATCGGTATTGCT and ASP1-R: ATCCGAGTCGATTTACAAGGCTGG, respectively) and one unit of RT/Platinum® Taq Mix in reaction buffer containing 0.2 mM of each dNTP and 1.2 mM MgCl₂. PCR experiments were carried out on a Mastercycler® Ep instrument (Eppendorf) with program settings as follows: after an initial 30 min at 50 °C a denaturing temperature of 94 °C is maintained for two minutes, followed by 32 cycles of denaturing (15 s at 94 °C), annealing (30 s at 60 °C) and elongation (DNA synthesis for 45 s at 72 °C). Afterwards, a final elongation step at 72 °C for ten minutes was included, after which the PCR mixtures were kept at 10 °C. Prior to ligation, a clean-up of the PCR mixtures was carried out using the GENECLEAN® kit (Q-BioGene) after which purified PCR product was ligated into the pGEM®-T Easy vector (Promega) according to the manufacturer’s instructions. Subsequently, the ligation mixtures were transformed in Escherichia coli DH5α competent cells (Invitrogen) according to the supplier’s instructions. After overnight incubation at 37 °C on X-gal plates, white colonies were picked from both the North-American and European plates. On all of the picked colonies PCR was performed using the same primers and reagent concentrations as mentioned above, and the program settings were as follows: after an initial denaturing temperature of 95 °C for two minutes, 32 cycles of denaturing (30 s at 95 °C), annealing (30 s at 60 °C) and elongation (DNA synthesis for 50 s at 72 °C) were carried out. Afterwards, a final elongation step at 72 °C for five minutes was included, after which the PCR mixtures were all bidirectionally sequenced.

Circular dichroism spectroscopy

CD data were recorded on a J-715 spectropolarimeter (JASCO) equipped with a 0.1 cm path length quartz cuvette (Hellma Analytics) and applying native Oo-ASP-1 and P. pastoris Oo-ASP-1 at 10 μM in PBS. Ellipticity was monitored from 260 to 190 nm, with 0.5 nm intervals.

Liquid chromatography coupled to mass spectrometry

Tertiary and quaternary structure insights, focussing on intra- and intermolecular disulphide bonds in the studied Oo-ASP-1 molecules, were obtained via one-dimensional and two-dimensional LC–MS (liquid chromatography coupled to mass spectrometry), thereby using an Agilent 6230B hybrid-Q-TOF mass spectrometer (Agilent Technologies) with MS and MS/MS scan ranges set to 300–3000 and 100–3000 Th, respectively, and acquisition speed at one spectrum per second. Briefly, 50 μg of the sample under investigation was supplemented with 0.1% (v/v) Rapigest (Waters) in 100 mM Tris–HCl pH 8.0, followed by treatment with 5 mM DTT (dithiotreitol) and 10 mM iodoacetamide (IAA) when reduction of dithioether bonds was required, and addition of MS-grade trypsin (Promega) to a final concentration of 0.02 μg per μg protein. For the two-dimensional approach, a reversed-phase LC (RPLC) step was performed at pH 8.0, using a C18 column (Agilent Technologies) held at 50 °C with 0.1% formic acid in water as the primary solvent and a gradient of 1.5% acetonitrile per minute as the eluting solvent (flow-rate was 200 μl/min.), with fraction collection every 30 s prior to injection in the mass spectrometer. Comparison between the one- and two-dimensional data of reduced and non-reduced samples allowed mapping of the individual cysteine (Cys) residues being part of specific intra- or intermolecular disulphide bridges.

N-glycan profiling via MS and identification of core fucose linkage

The N-glycosylation of native, P. pastoris and N. benthamiana Oo-ASP-1 was evaluated via MS after PNGase A release as described in a previous study³⁷. Specific for N. benthamiana, MS was conducted before and after RCA I affinity purification.

To confirm the presence of core α1,3-fucose on native Oo-ASP-1, treatment of the released N-glycans with hydrogen fluoride (HF) was conducted as described previously⁶⁸, only removing core α1,3-linked fucose. This was followed by MS analysis as described above. For N. benthamiana recombinants, the presence of the specific core fucose linkages was analysed via lectin assays. Biotinylated Aleuria aurantia lectin (AAL) (Vector Laboratories) was used to determine core fucosylation in general, whilst biotinylated Pholiota squarrosa lectin (PhoSL) (kindly provided by Dr. A. Varrot from Université Grenoble Alpes, Grenoble, France) was used for core α1,6-fucose specifically. Microtiter plates were coated overnight at 4 °C with purified N. benthamiana Oo-ASP-1 in PBS at a concentration of 1 or 10 µg/ml. The lectin binding assay was performed as previously described³⁸.

Glycan microarrays screening with Oo-ASP-1 specific IgG

Bovine serum samples were obtained from calves immunised with either native Oo-ASP-1 + QuilA, P. pastoris Oo-ASP + QuilA, or QuilA alone, one week after the second immunisation. ASP-specific antibodies were isolated in order to prevent false positives and a high background fluorescence due to glycan recognition by non-ASP-specific antibodies. To do this, equal volumes of pooled serum samples (n = 11) were first subjected to lipoproteins and lipids removal via the addition of dextran sulphate and calcium chloride, followed by centrifugation. Protein G HP SpinTrap columns (Cytiva) were utilised to purify immunoglobulins (Ig’s), according to the manufacturer’s protocol. The ASP-specific antibodies were subsequently purified via NHS HP SpinTrap colums (Cytiva) coupled with native Oo-ASP-1 antigens, according to the manufacturer’s protocol. After purification, all samples were dialysed repeatedly with Slide-A-Lyzer MINI dialysis devices (ThermoFischer) in order to obtain a PBS-buffered solution and evaluated for ASP-reactivity through ELISA/Western Blot.

Non-commercial synthetic microarray slides were constructed as previously described²². The binding assay with antibodies mentioned above was performed as described in a previous study⁶⁹ with the following deviations: purified antibodies were tested at 1/500 in PBS-0.01% Tween20 with 1% BSA, followed by an incubation with 1/1000 Cy3-conjugated goat anti-bovine IgG (Jackson Laboratories) in PBS-0.01% Tween20. The mean fluorescence index (MFI) was obtained via the G2565BA scanner (Agilent Technologies) and was analysed with GenePix Pro 7.0 software (Molecular Devices). The MFI for each N-glycan spot was exported to Microsoft Excel where the background MFI was subtracted for each glycan structure.

To study the reactivity of ASP-specific antibodies from N. benthamiana immunised calves towards α1,3-fucose carrying N-glycans, new arrays were generated as described previously⁶⁸. The antibody binding assay was conducted as described above.

Indirect and competition enzyme-linked immunosorbent assay

Indirect ELISAs were performed as described previously¹³. Slight modifications were made as 96-well ELISA plates (MaxiSorp, NUNC) were coated with 1 µg/ml native Oo-ASP-1 in 100 µl carbonate buffer (pH 9.6) overnight at 4 °C. Serum samples and HRP-conjugated antibodies were used at following concentrations: bovine serum at 1/200 in PBS, sheep anti-bovine IgG1-HRP (AAI21P; Bio-Rad) at 1/4000 in blocking buffer (2% bovine serum albumin in PBS-0.05% Tween20), sheep anti-bovine IgG2-HRP (AAI22P; Bio-Rad) at 1/1000 in blocking buffer, and 1/1000 anti-bovine IgA-HRP (AAI49P; Bio-Rad) at 1/1000 in blocking buffer.

For competition ELISAs, 96-well Maxisorp plates (MaxiSorp, NUNC) were coated with 1 µg/ml native Oo-ASP-1 and dilution series of test antigens ranging from 0 to 500 pmol/ml were generated as described previously¹³. A 1/4000 sheep anti-bovine IgG1-HRP (AAI21P; Bio-Rad) was used to monitor antibody binding against the IgG1 isotype. 2,2′-azino-di-(3-ethylbenzthiazoline sulfonic acid) (ABTS) (Roche) was used as substrate and the colour development, expressed as OD405-492, was quantified by using an Infinite F50 Absorbance Microplate Reader (Tecan Trading AG).

Bovine immunisation experiment

All animal experiments were conducted in accordance with the E.U. Animal Welfare Directives and VICH Guidelines for Good Clinical Practice, and ethical approval to conduct the studies were obtained from the Ethical Committee of the Faculty of Veterinary Medicine, Ghent University (EC2018/001, EC2020/089, EC 2022/005). The animal experiments were carried out in compliance with the ARRIVE guidelines.

In total, three bovine immunisation studies were conducted with various Oo-ASP-1 antigens. For the first study, aiming to confirm the protective capacity of size-exclusion purified native Oo-ASP-1, fourteen helminth naïve male Holstein calves of 4–6 months old were randomised over two groups of seven animals: native Oo-ASP-1 + QuilA or QuilA alone. The second study, evaluating N. benthamiana Oo-ASP-1, contained twenty-four male Holstein calves of 4–6 months old, randomly divided over three vaccine groups of eight animals: native Oo-ASP-1 + QuilA, N. benthamiana Oo-ASP-1 + QuilA group, or QuilA alone. For the third study, a repeated trial with N. benthamiana Oo-ASP-1, twenty-four male Holstein calves of 4–6 months old were randomly assigned to two vaccine groups of twelve animals: N. benthamiana Oo-ASP-1 + QuilA or QuilA alone. For both trials, a 1:1 mixture of core α1,3-fucose / core α1,6-fucose containing N. benthamiana Oo-ASP-1 was used.

The trials were conducted as described previously^12,13,50. In short, all animals received 30 µg of antigen and/or 750 µg of QuilA percutaneous in the neck muscle, three times with a three-week interval. Immediately after the third immunisation, all animals were challenged via a trickle infection of 25,000 O. ostertagi L3 (1000 L3 / day; 5 days/week; for 5 weeks). All calves were euthanised three weeks after the last infection with intravenous injection of pentobarbital sodium (450–900 mg/10 kg body weight). Faecal egg counts, worm counts and worm measurements were conducted as described in previous trials^12,50. For the third trial, faecal egg counts were performed with MiniFLOTAC⁷⁰, instead of McMaster. Serum samples were collected prior to immunisation and one week after each immunisation. Mucus samples were collected and processed as described in previous trials¹³.

Statistical analyses

The statistical analyses were performed in GraphPad Prism 9. For the bovine immunisation-challenge study with size-exclusion purified native Oo-ASP-1 versus QuilA controls, cumulative faecal egg output and worm counts were evaluated for statistical significance via one-tailed Mann–Whitney tests. For the bovine immunisation-challenge study with native Oo-ASP-1, N. benthamiana Oo-ASP-1 and QuilA controls, cumulative faecal egg output, worm counts and worm measurements were evaluated for statistical significance via Kruskal–Wallis test with Dunn’s test for multiple comparison. The systemic IgG1 and IgG2 response was evaluated for all timepoints via a Two-way ANOVA with Dunnet’s test for multiple comparison. The mucosal IgG1, IgG2 and IgA response was evaluated via Kruskal–Wallis tests with Dunn’s test for multiple comparison. For the bovine immunisation-challenge study with N. benthamiana Oo-ASP-1 versus QuilA controls, cumulative faecal egg output, worm counts and worm measurements were evaluated for statistical significance via one-tailed Mann–Whitney tests. The systemic IgG1 and IgG2 response was evaluated for all timepoints via a two-way ANOVA with Dunnet’s test for multiple comparison. The mucosal IgG1, IgG2 and IgA response was evaluated via one-tailed Mann–Whitney tests. Glycan microarrays with native ASP-specific antibodies from calves immunised with either native Oo-ASP-1, P. pastoris Oo-ASP-1, N. benthamiana Oo-ASP-1 or QuilA was evaluated for statistical significance via a two-way ANOVA with Dunnet’s test for multiple comparison. All data were presented as mean ± standard error of the mean (SEM). P < 0.05 was considered significant.

Informed consent

Information concerning the N. benthamiana plants that were used for the recombinant expression of vaccine antigens used in this study: The origin of the widely distributed N. benthamiana laboratory accession RA-4 has recently been described by Wylie and Li (https://doi.org/10.3390/v14040771). Leaf material and seed was obtained from one of the N. benthamiana plants John Cleland collected at The Granites on the 25 August 1936, hereafter referred to as N. benthamiana Granites. This specimen was lodged in the Australian National Herbarium in Canberra by Cleland, and its origin is recorded as The Granites, 400 miles NW of Alice Springs, coordinates − 20.5667, 103.35, Tanami Region of the Northern Territory. The catalogue number is CANB112241.1

Data availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. NCBI GenBank accession number for the sequence of Oo-ASP-1: AJ310812.2. NCBI GenBank accession numbers for the sequences of the Oo-ASP-1 allelic variants: OR750503-OR750509.

References

Pullan, R. L., Smith, J. L., Jasrasaria, R. & Brooker, S. J. Global numbers of infection and disease burden of soil transmitted helminth infections in 2010. Parasit Vectors 7, 37 (2014).
Article PubMed PubMed Central Google Scholar
Casulli, A. New global targets for NTDs in the WHO roadmap 2021–2030. PLoS Negl. Trop. Dis. 15, e0009373 (2021).
Article PubMed PubMed Central Google Scholar
Charlier, J. et al. Initial assessment of the economic burden of major parasitic helminth infections to the ruminant livestock industry in Europe. Prev. Vet. Med. 182, 105103 (2020).
Article CAS PubMed Google Scholar
Kaplan, R. M. Biology, epidemiology, diagnosis, and management of anthelmintic resistance in gastrointestinal nematodes of livestock. Vet. Clin. North Am. Food Anim. Pract. 36, 17–30 (2020).
Article CAS PubMed Google Scholar
Charlier, J. et al. Anthelmintic resistance in ruminants: Challenges and solutions. Adv. Parasitol. 115, 171–227 (2022).
Article CAS PubMed Google Scholar
Rose, V. H. et al. Increasing importance of anthelmintic resistance in European livestock: Creation and meta-analysis of an open database. Parasite 27, 69 (2020).
Article Google Scholar
Vercruysse, J., Charlier, J. & van Dijk, J. Control of helminth ruminant infections by 2030. Parasitology 45, 1655–1664 (2018).
Article Google Scholar
Maizels, R. M. Identifying novel candidates and configurations for human helminth vaccines. Expert Rev. Vaccines 20, 1389–1393 (2021).
Article CAS PubMed PubMed Central Google Scholar
Smith, W. D. & Zarlenga, D. S. Developments and hurdles in generating vaccines for controlling helminth parasites of grazing ruminants. Vet. Parasitol. 139, 347–359 (2006).
Article CAS PubMed Google Scholar
Geldhof, P., De Maere, V., Vercruysse, E. & Claerebout, E. Recombinant expression systems: The obstacle to helminth vaccines?. Trends Parasitol. 23, 527–532 (2007).
Article CAS PubMed Google Scholar
Meyvis, Y. et al. Vaccination against Ostertagia ostertagi with subfractions of the protective ES-thiol fraction. Vet. Parasitol. 149, 239–245 (2007).
Article CAS PubMed Google Scholar
Geldhof, P. et al. Validation of the protective Ostertagia ostertagi ES-thiol antigens with different adjuvantia. Parasite Immunol. 26, 37–43 (2004).
Article CAS PubMed Google Scholar
Gonzalez-Hernandez, A. et al. Host protective ASP-based vaccine against the parasitic nematode Ostertagia ostertagi triggers NK cell activation and mixed IgG1-IgG2 response. Sci. Rep. 6, 29496 (2016).
Article ADS PubMed PubMed Central Google Scholar
Geldhof, P., Meyvis, Y., Vercruysse, J. & Claerebout, E. Vaccine testing of a recombinant activation-associated secreted protein (ASP1) from Ostertagia ostertagi. Parasite Immunol. 30, 57–60 (2008).
Article CAS PubMed Google Scholar
Gibbs, G. M., Roelants, K. & O’Bryan, M. K. The CAP superfamily: cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins–roles in reproduction, cancer, and immune defense. Endocr. Rev. 29, 865–897 (2008).
Article CAS PubMed Google Scholar
Cantacessi, C. et al. A portrait of the ‘SCP/TAPS’ proteins of eukaryotes–developing a framework for fundamental research and biotechnological outcomes. Biotechnol. Adv. 27, 376–388 (2009).
Article CAS PubMed Google Scholar
Borloo, J. et al. Structure of Ostertagia ostertagi ASP-1: insights into disulfide-mediated cyclization and dimerization. Acta Crystallogr. Sect. D Biol. Crystallogr. 69, 1–11 (2013).
Article ADS Google Scholar
Osman, A. et al. Hookworm SCP/TAPS protein structure–A key to understanding host-parasite interactions and developing new interventions. Biotechnol. Adv. 30, 652–657 (2011).
Article PubMed Google Scholar
Asojo, O. A. Structure of a two-CAP-domain protein from the human hookworm parasite Necator americanus. Acta Crystallogr. D. Biol. Crystallogr. 67, 455–462 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Meyvis, Y. et al. Hybrid N-glycans on the host protective activation-associated secreted proteins of Ostertagia ostertagi and their importance in immunogenicity. Mol. Biochem. Parasitol. 161, 67–71 (2008).
Article CAS PubMed Google Scholar
Jacobs, P. P., Geysens, S., Vervecken, W., Contreras, R. & Callewaert, N. Engineering complex-type N-glycosylation in Pichia pastoris using GlycoSwitch technology. Nat. Protoc. 4, 58–70 (2009).
Article CAS PubMed Google Scholar
Brzezicka, K. et al. Synthesis and microarray-assisted binding studies of core xylose and fucose containing N-glycans. ACS Chem. Biol. 10, 1290–1302 (2015).
Article CAS PubMed Google Scholar
Tretter, V., Altmann, F. & März, L. Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase F cannot release glycans with fucose attached alpha 1–3 to the asparagine-linked N-acetylglucosamine residue. Eur. J. Biochem. 199, 647–652 (1991).
Article CAS PubMed Google Scholar
Varki, A. Biological roles of glycans. Glycobiology 27, 3–49 (2017).
Article CAS PubMed Google Scholar
Weerapana, E. & Imperiali, B. Asparagine-linked protein glycosylation: From eukaryotic to prokaryotic systems. Glycobiology 16, 91R-101R (2006).
Article CAS PubMed Google Scholar
Alemka, A., Nothaft, H., Zheng, J. & Szymanski, C. M. N-glycosylation of Campylobacter jejuni surface proteins promotes bacterial fitness. Infect. Immun. 81, 1674–1682 (2013).
Article CAS PubMed PubMed Central Google Scholar
Geijtenbeek, T. B., Van Vliet, S. J., Engering, A., T’Hart, B. A. & Van Kooyk, Y. Self- and nonself-recognition by C-type lectins on dendritic cells. Annu. Rev. Immunol. 22, 33–54 (2004).
Article CAS PubMed Google Scholar
Medzhitov, R. Toll-like receptors and innate immunity. Nat. Rev. Immunol. 1, 135–145 (2001).
Article CAS PubMed Google Scholar
Banchereau, J. & Steinman, R. M. Dendritic cells and the control of immunity. Nature 392, 245–252 (1998).
Article ADS CAS PubMed Google Scholar
Tawill, S., Le Goff, L., Ali, F., Blaxter, M. & Allen, J. E. Both free-living and parasitic nematodes induce a characteristic Th2 response that is dependent on the presence of intact glycans. Infect. Immun. 72, 398–407 (2004).
Article CAS PubMed PubMed Central Google Scholar
van Die, I. et al. Core alpha1–>3-fucose is a common modification of N-glycans in parasitic helminths and constitutes an important epitope for IgE from Haemonchus contortus infected sheep. FEBS Lett. 463, 189–193 (1999).
Article PubMed Google Scholar
Yang, Y. Y. M., van Diepen, A., Brzezicka, K., Reichardt, N. C. & Hokke, C. H. Glycan microarray-assisted identification of IgG subclass targets in schistosomiasis. Front. Immunol. 9, 2331 (2018).
Article PubMed PubMed Central Google Scholar
Harrison, G. B. L. et al. Antibodies to surface epitopes of the carbohydrate larval antigen CarLA are associated with passive protection in strongylid nematode challenge infections. Parasite Immunol. 30, 577–584 (2008).
Article CAS PubMed Google Scholar
Becker, D. J. & Lowe, J. B. Fucose: Biosynthesis and biological function in mammals. Glycobiology 13, 41R-53R (2003).
Article CAS PubMed Google Scholar
Hokke, C. H. & van Diepen, A. Helminth glycomics - glycan repertoires and host-parasite interactions. Mol. Biochem. Parasitol. 215, 47–57 (2017).
Article CAS PubMed Google Scholar
Asojo, A. et al. Heligmosomoides polygyrus venom allergen-like Protein-4 (HpVAL-4) is a sterol binding protein. Int. J. Parasitol. 48, 359–369 (2018).
Article CAS PubMed PubMed Central Google Scholar
Wilbers, R. H. P. et al. Production and glyco-engineering of immunomodulatory helminth glycoproteins in plants. Sci. Rep. 10, 45910 (2017).
Article ADS Google Scholar
van Noort, K. et al. Functional characterization of Schistosoma mansoni fucosyltransferases in Nicotiana benthamiana plants. Sci. Rep. 10, 18528 (2020).
Article ADS PubMed PubMed Central Google Scholar
Meevissen, M. H. et al. Targeted glycoproteomic analysis reveals that kappa-5 is a major, uniquely glycosylated component of Schistosoma mansoni egg antigens. Mol. Cell Proteomics 10, 005710 (2011).
Article Google Scholar
Smit, C. H. et al. Glycomic analysis of life stages of the human parasite Schistosoma mansoni reveals developmental expression profiles of functional and antigenic glycan motifs. Mol. Cell Proteomics 14, 1750–1769 (2015).
Article CAS PubMed PubMed Central Google Scholar
Geldhof, P. et al. Presence of the LDNF glycan on the host-protective H-gal-GP fraction from Haemonchus contortus. Parasite Immunol. 27, 55–60 (2005).
Article CAS PubMed Google Scholar
Talabnin, K. et al. Stage-specific expression and antigenicity of glycoprotein glycans isolated from the human liver fluke Opisthorchis viverrine. Int. J. Parastiol. 43, 37–50 (2013).
Article CAS Google Scholar
Morelle, W. et al. Phosphorylcholine-containing N-glycans of Trichinella spiralis: Identification of multiantennary lacdiNAc structures. Glycobiology 10, 941–950 (2000).
Article CAS PubMed Google Scholar
Wilson, I. B. H. & Paschinger, K. Sweet secrets of a therapeutic worm: Mass-spectrometric N-glycomic analysis of Trichuris suis. Anal. Bioanal. Chem. 408, 461–471 (2016).
Article CAS PubMed Google Scholar
Strasser, R. et al. Generation of glyco-engineered Nicotiana benthamiana for the production of monoclonal antibodies with a homogeneous human-like N-glycan structure. Plant Biotechnol. J. 6, 392–402 (2008).
Article CAS PubMed Google Scholar
Kriechbaum, R. et al. BGAL1 depletion boosts the level of β-galactosylation of N- and O-glycans in N. benthamiana. Plant Biotechnol. J. 18, 1537–1549 (2020).
Article CAS PubMed PubMed Central Google Scholar
Bakker, H. et al. Galactose-extended glycans of antibodies produced by transgenic plants. Proc. Natl. Acad. Sci. U. S. A. 98, 2899–2904 (2001).
Article ADS CAS PubMed PubMed Central Google Scholar
Laukens, B., De Wachter, C. & Callewaert, N. Engineering the pichia pastoris n-glycosylation pathway using the glycoswitch technology. In Glyco-Engineering Methods in Molecular Biology (ed. Castilho, A.) 1321 (Humana Press, 2015).
Google Scholar
Geldhof, P. et al. Activation-associated secreted proteins are the most abundant antigens in a host protective fraction from Ostertagia ostertagi. Mol. Biochem. Parasitol. 128, 111–114 (2003).
Article CAS PubMed Google Scholar
Geldhof, P. et al. Vaccination of calves against Ostertagia ostertagi with cysteine proteinase enriched protein fractions. Parasite Immunol. 24, 263–270 (2002).
Article CAS PubMed Google Scholar
Smith, W. D., Smith, S. K. & Pettit, D. Evaluation of immunization with gut membrane glycoproteins of Ostertagia ostertagi against homologous challenge in calves and against Haemonchus contortus in sheep. Parasite Immunol. 22, 239–247 (2000).
Article CAS PubMed Google Scholar
Vercauteren, I. et al. Vaccination with an Ostertagia ostertagi polyprotein allergen protects calves against homologous challenge Infection. Infect. Immun. 75, 2995–3001 (2004).
Article Google Scholar
Nisbet, A. J. et al. Successful immunization against a parasitic nematode by vaccination with recombinant proteins. Vaccine 31, 4017–4023 (2013).
Article CAS PubMed Google Scholar
Nisbet, A. J. et al. Protection of ewes against Teladorsagia circumcincta infection in the periparturient period by vaccination with recombinant antigens. Vet. Parasitol. 228, 130–136 (2016).
Article CAS PubMed Google Scholar
Nisbet, A. J. et al. The rational simplification of a recombinant cocktail vaccine to control the parasitic nematode Teladorsagia circumcincta. Int. J. Parasitol. 49, 257–265 (2019).
Article CAS PubMed PubMed Central Google Scholar
Ward, B. J. et al. Phase 1 randomized trial of a plant-derived virus-like particle vaccine for COVID-19. Nat. Med. 27, 1071–1078 (2021).
Article CAS PubMed PubMed Central Google Scholar
Gómez, M. L. et al. Contributions of the international plant science community to the fight against human infectious diseases—part 1: Epidemic and pandemic diseases. Plant Biotechnol. J. 19, 1901–1920 (2021).
Article Google Scholar
Claerebout, E. & Geldhof, P. Helminth vaccines in ruminants: From development to application. Vet. Clin. North Am. Food Anim. Pract. 36, 159–171 (2020).
Article PubMed PubMed Central Google Scholar
Vercruysse, J. & Claerebout, E. Assessment of the efficacy of helminth vaccines. J. Parasitol. 89, S202–S209 (2003).
Google Scholar
Jacobs, P. P., Geysens, S., Vervecken, W., Contreras, R. & Callewaert, N. Engineering complex-type N-glycosylation in Pichia pastoris using GlycoSwitch technology. Nat. Protoc. 4, 58–70 (2009).
Article CAS PubMed Google Scholar
Vlaminck, J., Borloo, J., Vercruysse, J., Geldhof, P. & Claerebout, E. Vaccination of calves against Cooperia oncophora with a double-domain activation-associated secreted protein reduces parasite egg output and pasture contamination. Int. J. Parasitol. 45, 209–213 (2015).
Article CAS PubMed Google Scholar
Strube, C. et al. Vaccination with recombinant paramyosin against the bovine lungworm Dictyocaulus viviparus considerably reduces worm burden and larvae shedding. Parasit. Vectors 8, 119 (2015).
Article PubMed PubMed Central Google Scholar
Geldhof, P., Claerebout, E., Knox, D. P., Agneessens, J. & Vercruysse, J. Proteinases released in vitro by the parasitic stages of the bovine abomasal nematode Ostertagia ostertagi. Parasitology 121, 639–647 (2000).
Article CAS PubMed Google Scholar
Borloo, J. et al. In-depth proteomic and glycomic analysis of the adult-stage Cooperia oncophora excretome/secretome. J. Proteome Res. 12, 3900–3911 (2013).
Article CAS PubMed Google Scholar
Westerhof, L. B. et al. 3D domain swapping causes extensive multimerisation of human interleukin-10 when expressed in planta. PLoS One 7, e46460 (2012).
Article ADS CAS PubMed PubMed Central Google Scholar
Wilbers, R. H. P. et al. The N-glycan on Asn54 affects the atypical N-glycan composition of plant-produced interleukin-22, but does not influence its activity. Plant Biotechnol. J. 14, 670–681 (2016).
Article CAS PubMed Google Scholar
Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685 (1970).
Article ADS CAS PubMed Google Scholar
Petralia, L. M. C. et al. Mass spectrometric and glycan microarray-based characterization of the filarial nematode Brugia malayi glycome reveals anionic and Zwitterionic glycan antigens. Mol. Cell Proteomics 21, 100201 (2022).
Article CAS PubMed PubMed Central Google Scholar
van Diepen, A. et al. Differential anti-glycan antibody responses in Schistosoma mansoni-infected children and adults studied by shotgun glycan microarray. PLoS Negl. Trop. Dis. 6, e1922 (2012).
Article PubMed PubMed Central Google Scholar
Cringoli, G. et al. The Mini-FLOTAC technique for the diagnosis of helminth and protozoan infections in humans and animals. Nat. Protoc. 12, 1723–1732 (2017).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This study was financially supported by several sources including the 2020 EU Framework Program (PARAGONE project), the 2021 International Coordination of Research on Infectious Animal Diseases (ICRAD; Plant4Nemavax project), an FWO PhD-fellowship to LZ. Furthermore, RHPW. acknowledges the TTW Veni Grant 16740 from Netherlands Organization for Scientific Research. NCR and SS acknowledge the Ministry of Science and Education (MINECO) Grant Nos. CTQ 2017-90039-R and RTC-2017-6126-1, the Agencia Estatal de Investigación – AEI Grant No PID2020-117552RB-I00, the Maria de Maeztu Units of Excellence Program from the Spanish State Research Agency – Grant No. MDM-2017-0720 and the Basque Government, Elkartek grant bmg21. The authors would like to thank Koen Sandra (Research Institute for Chromatography; Kortrijk, Belgium) for the disulphide-bond related mass spectrometric analyses, Dante Zarlenga (Beltsville Agricultural Research Center, Beltsville, Maryland, USA) for supplying North American O. ostertagi L3, Dr. A. Varrot (Université Grenoble Alpes, Grenoble, France) for sharing the PhoSL lectin, and Stijn Casaert, Nathalie De Wilde, Iris Peelaers and D. Linh Nguyen for their technical support.

Author information

Authors and Affiliations

Laboratory of Parasitology, Department of Translational Physiology, Infectiology and Public Health, Faculty of Veterinary Medicine, Ghent University, Salisburylaan 133, B-9820, Merelbeke, Belgium
Laurens Zwanenburg, Jimmy Borloo, Bregt Decorte, Leen J. M. Seys, Edwin Claerebout & Peter Geldhof
Laboratory of Nematology, Department of Plant Sciences, Wageningen University & Research, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands
Myrna J. M. Bunte, Sanaz Mokhtari, Arjen Schots & Ruud H. P. Wilbers
Department of Parasitology, Leiden University Medical Center, Albinusdreef 2, 2333 ZA, Leiden, The Netherlands
Angela van Diepen & Cornelis H. Hokke
Glycotechnology Laboratory, Center for Cooperative Research in Biomaterials (CIC biomaGUNE), Basque Research and Technology Alliance (BRTA), Paseo de Miramon 194, 20014, Donostia San Sebastián, Spain
Sonia Serna & Niels-C. Reichardt
CIBER-BBN, Paseo Miramón 194, 20014, San Sebastian, Spain
Sonia Serna & Niels-C. Reichardt

Authors

Laurens Zwanenburg
View author publications
You can also search for this author in PubMed Google Scholar
Jimmy Borloo
View author publications
You can also search for this author in PubMed Google Scholar
Bregt Decorte
View author publications
You can also search for this author in PubMed Google Scholar
Myrna J. M. Bunte
View author publications
You can also search for this author in PubMed Google Scholar
Sanaz Mokhtari
View author publications
You can also search for this author in PubMed Google Scholar
Sonia Serna
View author publications
You can also search for this author in PubMed Google Scholar
Niels-C. Reichardt
View author publications
You can also search for this author in PubMed Google Scholar
Leen J. M. Seys
View author publications
You can also search for this author in PubMed Google Scholar
Angela van Diepen
View author publications
You can also search for this author in PubMed Google Scholar
Arjen Schots
View author publications
You can also search for this author in PubMed Google Scholar
Ruud H. P. Wilbers
View author publications
You can also search for this author in PubMed Google Scholar
Cornelis H. Hokke
View author publications
You can also search for this author in PubMed Google Scholar
Edwin Claerebout
View author publications
You can also search for this author in PubMed Google Scholar
Peter Geldhof
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

L.Z., J.B., E.C. & P.G. conceived and designed the studies. L.Z., J.B., A.vD. & R.H.P.W. performed the experiments with contributions of B.D., M.B. and A.S.

N.C.R. & S.S. provided the glycan microarrays and synthetic ligands for printing custom arrays. L.Z., J.B., A.vD., R.H.P.W., C.H.H. & P.G. analysed the data. L.Z., L.S. & P.G. wrote the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Peter Geldhof.

Ethics declarations

Competing interests

L.Z.’s work was partially funded by Zoetis Inc., specifically related to the bovine immunisation-infection studies to evaluate the protective capacity of the N. benthamiana recombinants. This funding was solely required to cover the cost for animal purchase, housing and technical assays related to these studies. Furthermore, Ghent University possesses the intellectual property rights of the native and N. benthamiana recombinant vaccine. J.B., B.D., M.B., S.M., S.S., N.C.R., L.S., A.vD., A.S., R.H.P.W., C.H.H., E.C. and P.G. declare no potential conflict of interest.

Additional information

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary Information.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Zwanenburg, L., Borloo, J., Decorte, B. et al. Plant-based production of a protective vaccine antigen against the bovine parasitic nematode Ostertagia ostertagi. Sci Rep 13, 20488 (2023). https://doi.org/10.1038/s41598-023-47480-3

Download citation

Received: 13 July 2023
Accepted: 14 November 2023
Published: 22 November 2023
DOI: https://doi.org/10.1038/s41598-023-47480-3

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.