Abstract
There are an estimated 6–10 million smokeless tobacco (Toombak) users in Sudan, the majority being males. Toombak is known to be a carcinogenic product that is likely to modify the oral microbiome spatiality into a high-risk potential for the development and progression of oral cancer, but previous studies are lacking in this field. Here, we endeavour for the first time the exploration of the oral microbiome in key mucosal areas of the oral cavity and assess the microbiome variations in premalignant and oral squamous cell carcinoma (OSCC) samples from both users and non-users of Toombak. 16S rRNA sequencing was performed on DNA obtained from pooled saliva, oral mucosa and supragingival plaque from 78 Sudanese users and non-users of Toombak, aged between 20 and 70 years. In 32 of the pooled saliva samples, the mycobiome (fungal) environment was analysed through ITS sequencing. Then, 46 formalin-fixed paraffin-embedded samples of premalignant and OSCC samples were collected, and their associated microbiomes sequenced. The oral Sudanese microbiome was found to be enriched in Streptococcaceae, but Staphylococcaceae were significantly more abundant amongst Toombak users. Genera enriched in the oral cavity of Toombak users included Corynebacterium_1 and Cardiobacterium while in non-users, Prevotella, Lactobacillus and Bifidobacterium were prominent. Aspergillus was the most abundant fungus in the mouths of Toombak users with a marked loss of Candida. The genus Corynebacterium_1 was abundant in the buccal, floor of the mouth and saliva microbiomes as well as in oral cancer samples from Toombak users indicating a possible role for this genus in the early stages of oral cancer development. An oral cancer microbiome that favours poor survival and metastasis in those who use Toombak also emerged that includes the genera Stenotrophomonas and Schlegelella. Those utilising Toombak carry an altered oral microbiome that may be an additional risk factor for this products carcinogenicity to the oral structures. These significant microbiome modulations are a newly emerging key driving factor in oral cancer development and progression in Toombak users while it is also shown that Toombak users carry an oral cancer microbiome that may increase the potential for a poorer prognosis.
Similar content being viewed by others
Introduction
Smokeless tobaccos harbour bacterial and fungal entities that allow for microorganisms to reside in the oral cavity and their mucosal surfaces which are not normal of the typical oral microbiota. These oral mucosal surfaces are further impacted by salivary pH, flow of saliva and oral hygiene and along with smokeless tobacco use can have a varying impact on the localised keratinised and non-keratinised tissue.
An example of a smokeless tobacco is ‘Toombak’, used predominantly by Sudanese males that is produced from the plant, the Nicotiana Rustica. Leaves are harvested, subjected to fermentation and sodium bicarbonate is added to improve the taste and bioavailability of nicotine in the final product. Through these processes, Toombak has been found to carry potently elevated quantities of carcinogenic compounds that include but are not limited to tobacco-specific nitrosamines, formaldehyde, and acetaldehyde1,2. Iron is also found to be abundant in Toombak and may be involved in tumour development including oral squamous cell carcinoma (OSCC)3,4.
Indeed, OSCC is a disease that in Sudan has been primarily attributed to Toombak use5. The oral microbiome of smokeless tobacco users has been shown to be modelled into a dysbiotic state as early as 4 weeks from tobacco initiation6,7. Smokeless tobacco use can lead to histological changes in the oral epithelium within just 2 days of its use, causing inflammation and ulceration8,9. The roughened texture of smokeless tobacco products, including Toombak is also a supporting factor in the survival of many of the microorganisms found in these products.
Furthermore, smokeless tobacco use has been shown to modify the immune response through the elevation of interleukins 1 and 2 and the reduction of macrophages, interferon γ, and interleukin 10 in local smokeless tobacco placement sites8. Smokeless tobacco may further activate the oncogenic RAS gene and help in the upregulation of the oxidative stress pathways; ASK1, JNK 1 and 2 and p389. Toombak users who develop OSCC were found to have increased p53 mutations, novel mutations in exons 5,6 and 710 and an increased expression in keratins 13,14 and 19, that relate to abnormal proliferation and maturation of keratinocytes11.
The relationship between the oral microbiome and cancer development has in the last decade been continuously interrogated, albeit with a narrower or absent insight from developing countries12. Culture studies from Sudan have highlighted enriched Bacillus growth from the buccal mucosa of Toombak users6. On the other hand, Mohamed et al. (2021) identified Malassezia as a favourable predictor of survival amongst Sudanese OSCC patients13.
This study serves to analyse the oral cavity microbial spatiality of the Sudanese, including smokeless tobacco users (a high risk cohort for oral cancer development) through metagenomics sequencing approaches while also helping to understand the implications that Toombak use brings post-OSCC development.
Material and methods
Sample collection
Ethical approval was first sought and obtained from the Sudanese ethics committee at National Ribat University Sudan and the Cork Ethics Committee, Cork, Ireland. All experiments were performed in accordance with relevant names guidelines and regulations. Informed consent was obtained from all participants.
Inclusion criteria included those participants with good oral care, inactive periodontal disease, a controlled caries mouth and absence of any other dental infection. Following consent, participants did not eat or drink for at least 1 h before sample collection. In the smokeless tobacco group, oral swab samples were obtained at least 1 h after disregarding the most recent Toombak dip. Exclusion criteria included local conditions such as those with active periodontal disease, caries and periapical infection and systemic factors such as recent antibiotic use (< 3 months) and unstabilised conditions.
We achieved the collection of 72 pooled saliva, 71 supragingival plaque and 272 oral mucosal swab samples from 78 Sudanese participants. These were further categorised into 47 Toombak smokeless tobacco users and 31 non-users aged 20–70 years of age. While all Toombak users were male, in the non-user group, 18 participants were female. Pooled saliva was collected by asking the patient to remain seated, holding a sterile disposable polypropylene Falcon® (110 ml) container and up to 5 ml of saliva was pooled. Oral mucosal swab samples were collected by applying Puritan® Diagnostic Swabs to the required mucosal location with gentle rubbing for 10 s.
Supragingival plaque samples were obtained using a sterile probe which was stored in Puritan® Diagnostic Swabs for upstream analysis. The mucosal swabs were collected from two keratinised (dorsum tongue and hard palate) and two non-keratinised locations (floor of the mouth and buccal mucosa). Seventy-one buccal swabs (from 26 non-users and 45 Toombak users), 67 floors of the mouth swabs (from 22 non-users and 45 Toombak users), 61 hard palate swabs (from 23 non-users and 38 Toombak users), and 73 dorsum tongue swabs (from 26 non-users and 47 Toombak users) were obtained. Figure 1a summarises the metagenomic oral sample collection in this study.
(a) 78 Sudanese participants – Metagenomic oral samples flow diagram. Participant samples were categorised into saliva, supragingival plaque and oral mucosa swabs. (b) Premalignant and oral squamous cell carcinoma Metagenomic flow diagram. Samples were achieved from formalin fixed paraffin embedded tissues of premalignant, oral cancer and non – cancerous (control) sample.
Storage and transfer
Samples were stored in an iced cooler transport box and transferred to a—80 °C freezer in the laboratory at National Ribat University, Sudan. Finally, samples were shipped to Cork, Ireland on dry ice.
Collection of formalin-fixed paraffin-embedded oral cancer and premalignant tissue samples
Forty-six formalin-fixed paraffin-embedded samples were collected (from 43 OSCC, two premalignant lesions (Leukoplakia) and one non- premalignant condition). The OSCC samples were further delineated as eight moderately differentiated and 35 well differentiated OSCC samples. Samples were sourced from 29 males and 17 females, aged between 20 and 70 years of age. Twenty-six samples were from non-Toombak users and 19 were from Toombak users. Figure 1b summarises the metagenomic premalignant and OSCC samples collection flow obtained in this study. To yield optimum DNA from paraffin-embedded samples, we used 10 μm thickness to slice sections with the first 2–3 sections being discarded. Eight sections were used for each sample. All formalin fixed paraffin embedded tissue samples were no longer than 3 months old from fresh sample preparation and samples were collected pre-cancer treatment. This time length was kept consistent to exclude any bias that could be introduced by time variations. Sections were immediately placed in sterile 2 ml Eppendorf tubes.
DNA extraction of pooled saliva, mucosal swab, and plaque samples
DNA extraction of samples was achieved by the DNeasy Powersoil Pro Kit (QIAGEN®, Hilden, Germany). Eluted DNA was transferred to sterile Eppendorf tubes and frozen at − 80 °C for further analysis. The mucosal swabs and plaque were first cut using a sterile scissor which allowed placement and dissolvement of samples in DNA extraction tubes. Swabs were removed after vortexing during the first stage of DNA extraction.
DNA extraction of formalin-fixed paraffin-embedded oral cancer and premalignant tissue samples
Here, QIAamp® DNA formalin fixed paraffin embedded (FFPE) tissue kit instructions were followed. Briefly, in a microcentrifuge tube, xylene was placed with each sample to remove the paraffin and centrifuged at full speed for two min, after which 1 ml of ethanol was added to remove the xylene. Samples were vortexed and centrifuged to remove residual ethanol, maintaining the pellet. Tubes were incubated at 37 °C, resuspended in 180μl tissue lysis buffer and 20 μl proteinase K was added to overcome the inhibitory effects caused by formalin crosslinking of nucleic acids. All buffers were prepared according to the manufacturer’s instructions and equilibrated to room temperature before protocol initiation. Samples were incubated at 56 °C for 1 h and 90 °C for another hour. The incubation in the latter temperature reverses the modification of nucleic acids by formaldehyde. DNA extraction was continued by adding 200 μl lysis buffer and vortexing until reaching a homogenous lysate. QIAamp® MinElute columns were used to allow for the purification of high-quality DNA from the lysate and centrifuged at 6000× g (8000 rpm) for 1 min. This step was repeated until all lysates had passed through the columns, and the QIAamp® MinElute columns were empty. 500 μl of wash buffer was added and samples were centrifuged for 1 min at 6000× g (8000 rpm). Columns were placed in a clean 2 ml collection tube, the flow-through discarded and centrifuged at high speed; 20,000× g (14,000 rpm) for 3 min to ensure all ethanol was removed. Finally, columns were placed in clean 1.5 ml microcentrifuge tubes, incubated at room temperature for 5 min in 50 μl buffer and then centrifuged for 1 min to yield the final product at 20,000× g (14,000 rpm). Samples were stored at − 80 °C for upstream analysis.
Amplicon sequencing
The Illumina Metagenomic Sequencing Library Preparation protocol for 16S rRNA gene library preparation was followed. Briefly, PCR was performed on DNA extracted samples using AMPure XP beads (Beckman Coulter), universal forward primers and reverse primers with overhang adapters, following standard IUPAC nucleotide nomenclature, to target the 16S V3–V4 hypervariable regions. PCR was then performed in a 50 μL reaction mixture containing 10 ng of template DNA and 2 × KAPA HiFi HotStart Ready Mix. The following thermal cycling conditions were used: 3 min of initial denaturation at 95 °C; 30 cycles each of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 30 s and the last step at 72 °C for 5 min.
PCR clean-up was achieved with AMPure XP beads (Beckman Coulter) to purify the 16S V3 and V4 amplicon from free primers and primer dimer species. Electrophoresis was performed on the PCR-amplified products using 1.5% agarose gel with Invitrogen DNA loading dye (ThermoFisher Scientific) to verify the expected size at 550 base pairs. The gel was then visualised under 300 nm ultraviolet light. Index PCR was then continued by attaching dual indices, and Illumina sequencing adapters using Nextera XT index kits, and the following PCR thermal cycling conditions were used: 3 min of initial denaturation at 95 °C; 8 cycles each of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 30 s; the last step at 72 °C for 5 min. AMPure XP beads (Beckman Coulter) were utilised for final clean-up, and the final library was quantified using the Qubit® 2.0 Fluorometer and the Qubit dsDNA HS Assay kit (ThermoFisher Scientific). Samples were then normalised, with the final library run on an Agilent high sensitivity chip and quantified by qPCR using the KAPA Illumina Library quantification kit.
In addition, the saliva samples of 13 non-users and 19 Toombak users were processed for ITS gene sequencing. This was prepared with a similar method to the 16S rRNA gene protocol and followed the methods described by Walsh et al. 14. The primers were specific to the ITS1-ITS2 regions of the ITS gene and included the Illuminas overhang adaptors (ITSF1 primer 5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTTGGTCATTTAGAGGAAGTAA 3′ and ITS2 primer 5′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTGCGTTCTTCATCGATGC 3′).
For bacterial analysis, PCR products were sequenced using the V3-V4 regions of the 16S rRNA gene on an Illumina MiSeq device two × 300 platforms (Illumina, Inc. San Diego) according to the manufacturer's instructions. The 300 base pair paired-ends FastQ product generated from 16S sequencing was merged using FLASH (fast length adjustment of short reads) using default parameters15. QIIME’s split_libraries_fastq.py script was used for demultiplexing and filtering the fastq sequence data. Further quality filtering was performed using the USEARCH analysis tool. Single unique reads were removed followed by denoising and chimera removal. Grouping into operational taxonomic units (OTUs) at 97% similarity was performed using USEARCH v7 64bit16. OTUs were aligned using Pynast (PyNAST: python nearest alignment space termination; a flexible tool for aligning sequences to a template alignment17. Further taxonomic ranks were set using the Basic Local Alignment Search Tool (BLAST) against the SILVA SSURef database release 13218. Data were processed using Microbiome Analyst CA and Calypso version 8.84 with data filtering (removal of low abundance features less than 10%). Data were normalised utilising total sum scaling (TSS). The U.S National Library of Medicine, national centre for biotechnology information, was then accessed to assign species identity to those FASTA sequences with > 98% percentage homogeneity by using the BLAST® tool for bacterial 16S rRNA sequencing database19.
For fungal analysis, the resulting sequencing reads were variable in length and were processed using DADA2 (v1.18.0) in R, following DADA2 pipeline workflow for ITS sequences20,21. The reads were filtered to remove sequences with ambiguous ‘N’ bases. This was followed by primer removal from the reads using Cutadapt (v3.5) to remove primers as described in the DADA2 ITS pipeline workflow22. The quality of the reads was inspected, and the reads were further filtered and trimmed to retain reads that were a minimum of 50 base pair long with default parameters. Dereplicating and merging of paired-end reads was done following the workflow, following which chimeras were removed and taxonomy was assigned to the resulting ASVs (Amplicon Sequence Variants) using the UNITE ITS database. The resulting ASV table was used for further analysis with Microbiome Analyst.
Data were not rarefied but normalised utilising total sum scaling (TSS). Calypso version 8.84 and Microbiome analyst CA23 were used for the statistical and interpretational metagenomic data.
Results and discussion
For the plaque and oral mucosal samples, a total of 1344 observations were encountered with a minimum read of 8.0 (controls) and a maximum read of 2,008,537.0.
Alpha and beta diversity
Samples were grouped by mucosal location (buccal cheek, floor of the mouth, hard palate and dorsum tongue) and status of Toombak use (healthy = non-user, user = Toombak user). We found that mucosal location in the oral cavity and keratinisation status is a stronger predictor of microbiome variation compared to Toombak use. Non-keratinised mucosal locations (buccal and floor of the mouth) had similar patterns in microbiome diversity while keratinised locations also harboured close resemblances (palate and tongue). However, utilising Toombak alters the oral microbiome regardless of optimum oral health.
Four alpha diversity measures, Chao1, Shannon and Simpson index, and richness were assessed (Fig. 2). Alpha diversity was found to be significantly varied between groups. Chao 1, a measure of variation between the rare or unobserved species, showed that the tongue mucosa had the lowest Chao 1 diversity in both users and non-users of Toombak. In the palatal mucosa, those who used Toombak, however, had lower Chao 1 indices compared to non-users. Shannon indices were more distinct by location rather than Toombak use (p = 0.00076). Simpson index showed a higher but narrower tongue and palatal microbiome compared to the remaining groups (Simpson’s index community diversity closest to 1). Richness (p = 3.6849e−34) was highest on the floor of the mouth mucosa but lowest on the tongue mucosa. The median richness of the buccal mucosa microbiome was markedly lower for non-users compared to users of smokeless tobacco.
α diversity variation between four oral mucosal locations (buccal, floor of mouth (FOM), palate and tongue) in users and non-users of Toombak. 2. Shannon index (p = 0.00076), Richness or Observed (p = 3.6849e−34) and Simpson’s index (p = 3.3603e−08) were all significant between groups. Richness was found to be lowest for tongue microbiome but similar in the remaining locations. The tongue and palatal mucosa (Simpson’s index community diversity closest to 1) show the closest clustering.
Beta diversity (Fig. 3a) between the oral mucosal regions was significantly distinct (p < 0.001 R2 = 0.22), particularly between the dorsum tongue and the buccal/floor of the mouth, which were found to cluster together. The palatal microbiome was ‘sandwiched’ between the microbiome of the other mucosal environments. Such diversity could be due to the genera and species composition found in the various mucosal habitats. The tongue microbiome harboured an abundance of Actinomyces, Prevotella_6, Prevotella_7, Veillonella, Oribacterium, Erysipelotrichaceae_UCG007, Lachnoanaerobaculum, Stomatobaculum and Atopobium (Fig. 3b). The floor of the mouth mucosa harboured increases in the genera Actinobacillus and Bergeyella, while the palatal mucosa was increased in Kingella, after which the buccal cheek mucosa was found to be significantly increased in the genus Shigella (Fig. 3C).
(a) β diversity between the oral mucosal regions. Significant β diversity between the oral mucosal regions (p-value < 0.001). R2 = 0.22. The tongue microbiome (purple) is most distinct. Non-keratinised buccal and floor of the mouth mucosa are the most clustered together while the palatal microbiome is centrally bridged. (b) Tongue microbiome abundances amongst the oral Sudanese microbiomes. Red = buccal cheek, blue = floor of the mouth, grey = hard palate and gold = dorsum tongue. Actinomyces, Prevotella, Veillonella are amongst the most significantly abundant genera of tongue microbiome. (c) Abundant genera in the other mucosal locations. Red = buccal, blue = floor of the mouth, grey = palate, and gold = dorsum tongue. Actinobacillus and Bergeyella are most abundant in the floor of the mouth, Kingella in the palate and Shigella in the buccal mucosa. (d) Canonical correspondence analysis (CCA) plot of users (blue) and non-users (red) of Toombak. Oral health was utilised as the known gradient in minimising matrix errors in OTU–oral health relationships. Accounting for oral health, Toombak harboured oral microbiome differences that could be appreciated compared to non-users.
We further used canonical correspondence analysis (CCA) as a multivariate error-reducing technique analysing the abundance of the oral microbiome within users and non-users of Toombak on the known gradient oral health minimising matrix errors in OTU-oral health environmental relationships24. CCA plotting (Fig. 3d) showed that after accounting for oral health, Toombak users and non-users of Toombak still harboured distinct oral microbiome variations.
Pro-carcinogenic phyla and premalignant associated classes of bacteria are abundant in the saliva of Toombak users
The most relatively abundant phyla in pooled saliva were found to be Firmicutes (66%), Actinobacteria (13%), Bacteroidetes (9%), Proteobacteria (8%) and Fusobacteria (3%) (Fig. 4a). We further utilised correlation plotting to visualise the top ten phyla varied in abundance between the saliva of users and non-users of Toombak. Here, the phyla Fusobacteria and Patescibacteria (also known as Candidate Phyla Radiation) were the most correlated for Toombak use while Cyanobacteria were associated with non-users of Toombak (Fig. 4b). Both Fusobacteria and Patescibacteria have been shown to be significantly enriched in various forms of gastric cancer while Fusobacteria in particular have been shown to promote cancer progression and the invasion of cancer into surrounding tissue25. They are said to be late colonisers in healthy individuals and their abundance amongst Toombak users could have a role to play in the early developmental changes of OSCC26. This is likely due to Fusobacteria possessing FadA proteins that are associated with the attachment, invasion, and adherence of cancer cells27. Gracilibacteria were also found to be abundant amongst Toombak users. These are part of the Patescibacteria group that contain unique antimicrobial peptides and heavy metal (nickel) resistance pathways which may make them more tolerant to the heavy metal content of Toombak28,29. Classes of bacteria associated with premalignancy were found to be increased in Toombak users. Negativicutes amongst Toombak users may predispose them to the development of oral leukoplakia, a premalignant condition30,31. Deltaproteobacteria, a class of diverse sulphate-reducing bacteria can be pathogenic and cancer-promoting due to their ability to produce hydrogen sulphide32,33 (Fig. 4c) and were found to be high in Toombak users.
(a) Pie chart percentage composition of phyla from pooled saliva of both users and non-users of Toombak. Firmicutes (66%), Actinobacteria (13%), Bacteroidetes (9%), Proteobacteria (8%) and Fusobacteria (3%) are the most relatively abundant phyla. (b) Correlation plot of ten most abundant phyla in the Sudanese oral cavity of users and non-users of Toombak. Fusobacteria are the most correlated with Toombak use compared to Cyanobacteria in non-users. (c) Log-bar values of class composition of pooled saliva of both users and non-users of Toombak. Increased abundances in the classes Deltaproteobacteria and a slight increase in Negativicutes were found among Toombak users. (d) Pie chart percentage composition of families from pooled saliva of both users and non-users of Toombak. Streptococcaceae (47%), Veillonellaceae (9%) and Micrococcaceae (8%) were the most relatively abundant while Staphylococcaceae were the most significantly differentiating family between users and non-users of Toombak with a p-adjusted value of 0.037.
Microbial family and genera discrepancies between saliva and plaque of users and non-users of Toombak
Staphylococcaceae significantly differentiated between users and non-users of Toombak (q = 0.037). At family level, the saliva of users and non-users of Toombak indicated similar relative profiles of Streptococcaceae (47%), Veillonellaceae (9%) and Micrococcaceae (8%) (Fig. 4d). Sixty-five core microbiome genera were identified in the saliva of users and non-users of Toombak. Three genera, however, Streptobacillus, Shuttleworthia and Eubacterium yuri group, were unique to non-users of smokeless tobacco. In comparison, four genera, Fretibacterium, Filifactor, Corynebacterium_1 and Alysiella, were unique to Toombak users.
The most significantly abundant microbial genera amongst Toombak users are highlighted in Fig. 5a which include Actinomyces (p = 0.0045), Corynebacterium_1 (p = 0.0054), Lachnoanerobaculum (p = 0.0079), Lautropia (p = 0.0018), Atopobium (p = 0.035), Gemella (p = 0.037), Johnsonella (p = 0.011), Leptotrichia (p = 0.00038), Candidatus_Saccharimonas (p = 0.0037), Peptococcus (p = 0.013), Ruminococcaceae_UCG014 (p = 0.0052), Oribacterium (p = 0.023) and unclassified and uncultured bacterium.
(a) The most abundant genera with p-value significance amongst Toombak users (blue) and non-users (red). One way Anova variations between significant genera in Toombak use and non-Toombak use. Actinomyces (p = 0.0045), Corynebacterium_1 (p = 0.0054), Lachnoanerobaculum (p = 0.0079), Lautropia (p = 0.0018), Atopobium (p = 0.035), Gemella (p = 0.037), Johnsonella (p = 0.011), Leptotrichia (p = 0.00038), Candidatus_Saccharimonas (p = 0.0037), Peptococcus (p = 0.013), Ruminococcaceae_UCG014 (p = 0.0052) as well as Oribacterium (p = 0.023) and uncultured bacterium (p = 0.025) were more abundant in Toombak users. (b) LEfSe plotting on pooled saliva dataset. LEfSe plotting on pooled saliva dataset indicated that Corynebacterium_1 and unclassified bacterium were discriminant for Toombak use while Prevotella, Selenomonas, Erysipelotrichaceae and Butyrivibrio_2 were discriminant for non-users. (c) Supragingival microbiome in the Sudanese population and the relative abundances of significant genera in plaque. LEfSe plotting showed that Peptostreptococcus was the most distinct genus amongst Toombak users while Corynebacterium, Prevotella and Catonella were the most distinguishing genera in non-users plaque samples. Abiotrophia (p = 0.038) and Brooklawnia (p = 0.075) were on the other hand significantly abundant in the plaque of Toombak users.
In a study assessing the tongue microbiome of smokeless tobacco users in Saudi Arabia, species of Actinomyces and Oribacterium were also found to be significantly abundant in smokeless tobacco users34 and in smokeless tobacco users from Guam35. Elevated levels of Atopobium has been found in OSCC biopsies, and Leptotrichia, Gemella and Oribacterium in the saliva of OSCC patients36. Jonhsonella, found to be abundant in Toombak users, has been highly associated with oral tumour sites indicating specific microbiome dispositional trends in those that utilise Toombak towards oral cancer development37.
In a culture-based study from Sudan by Ali et.al. (2014), oral swab samples from long-term smokers showed abundances in Peptococcus, a genus also found to be significantly increased in those who develop oral cancer38. Lachnoanaerobaculum was relatively abundant in the saliva of Toombak users, similar to the findings from other studies39. Lachnoanaerobaculum was also abundant in smokeless tobacco users as well as oral cancer patients in studies from India40,41. This genus has further been found to be significantly increased in a group of pipe or ‘medwakh’ smokers from the United Arab Emirates42. Another elevated genus found in Toombak users in this study was Leptotrichia, associated with more severe levels of oral epithelial dysplasia43 including in those who developed pancreatic cancer44. Leptotrichia abundance in the oral cavity has been implicated in head and neck cancer45 and it was significantly increased in a cohort of heavy smokers in one study from the United Arab Emirates46.
Utilising Mann Whitney Kruskal Wallis with p adjusted values (q value); two genera were significantly increased in Toombak users; Corynebacterium_1 (q = 0.0286) and Staphylococcus (q = 0.0286) while Scardovia was significantly abundant in non-users of Toombak (q = 1.9435e−4). Both Coryenbacterium_1 and Staphylococcus, found to be abundant in the saliva of Toombak users have also been found to be abundant in the Toombak microbiome composition1. Corynebacterium has been found to be significantly increased in the saliva of smokeless tobacco users from other studies47,48. LEfSe plotting on the pooled saliva dataset further indicated Corynebacterium_1 and unclassified bacterium to be discriminant for Toombak use while Prevotella, Selenomonas, Erysipelotrichaceae and Butyrivibrio _2 are discriminant for the saliva of non-users of Toombak (Fig. 5b).
In supragingival plaque, LEfSe plotting showed that Peptostreptococcus was the distinct genus amongst Toombak users while the genera Corynebacterium, Prevotella and Catonella were the most distinguishing genera in plaque of non-users (Fig. 5c). Fifty eight genera were shared between users and non-users of Toombak. Comamonas was only found in the plaque of Toombak users while Abiotrophia (p = 0.038) and Brooklawnia (p = 0.075) were significantly abundant in Toombak users (Fig. 5c). Non-users of Toombak harboured Scardovia, Peptococcus, Lactobacillus, Fretibacterium, Catonella and Bifidobacterium in the plaque microbiome composition.
Aspergillus abundance amongst Toombak users likely exposes users to carcinogenic aflatoxin compounds
In this study, we found more than a three-fold enrichment of Aspergillus in the oral cavity of Toombak users (78.93%) compared to non-users (21.07%). Aflatoxins produced by Aspergillus species can have long-term adverse effects in the causation of cancer49. The abundance of Aspergillus in the oral cavity is now strongly associated with premalignant conditions such as Lichen planus and thus could predispose Toombak users to developing conditions that favour OSCC development50. Aspergillus abundance has further been associated with lymph node involvement in OSCC patients from Sudan13.
In Toombak users, the mycobiome was found to be abundant in Blumeria (61.7%), Issatchenkia (61.52%) and Saccharomyces (62.11%) compared to non-users (Fig. 6). Metschnikowia (36.22%) and Cladosporium (65.07%) were lower in abundance amongst Toombak users compared to non-users. Malassezia was found to be positively correlated with Toombak use while Candida was associated with non-users (Fig. 6). Indeed, there was a marked loss of Candida in the oral cavity in those utilising smokeless tobacco (4.33%) compared to non-users (95.67%) (q = 4.758e−4). Interestingly, in a recent study of salivary mycobiome of Sudanese OSCC patients, Candida was also found to be reduced in abundance amongst Toombak users13. One reason for this could be the inhibitory effects that high nicotine levels (found in Toombak) have on the growth of Candida 51.
Fungal entities in pooled saliva amongst Sudanese users and non-users of Toombak and correlation differentiators of fungal inhabitance in the oral cavity between Toombak users and non-users. Bar graph abundance (right) highlights marked loss of Candida presence in the oral cavity of Toombak users and an increase in Saccharomyces and Aspergillus. Unassigned species were also abundant amongst Toombak users. Correlation plotting (left) configures abundances in Malassezia, Saccharomyces and Aspergillus that were correlated positively with Toombak use while Candida was the genus most correlated with non-users of Toombak.
Fungal species are more virulent with Toombak smokeless tobacco use
Candida albicans was found to be the most dominant species amongst non-users, while Candida tropicalis was the most abundant species amongst Toombak users. Candida tropicalis is one of the most virulent Candida species and is known to be resistant to many antifungal medications52,53. This species has also been previously isolated from OSCC samples54. Malassezia restricta was found to be more abundant amongst Toombak users (63.02%) compared to non-users (36.98%) where q = 0.046. An abundance of Malassezia may be linked to better survival rates amongst OSCC patients13.
Toombak use allows for significant microbiome variations throughout the four oral mucosal locations
In four mucosal locations, low abundance features were removed based on 10% prevalence and low variance features were further removed based on 5% standard deviation. For data OTU analysis in both users and non-users of Toombak, 274 OTUs were assessed from the buccal cheek mucosa, 208 OTUs from the dorsum tongue mucosa, 254 OTUs from the floor of the mouth and 271 OTUs were assessed from the hard palatal mucosa. We further evaluated the core microbiome of each of the mucosal locations between users and non-users of Toombak. The buccal cheek mucosa had the highest similarity of core microbiome between users and non-users of Toombak; 126 core genera while the dorsum tongue had the least similarity in core microbiome between users and non-users of Toombak; 42 core genera. 53 core microbiome genera were present on the floor of the mouth and 55 core microbial genera on the hard palate between users and non-users of Toombak.
The buccal mucosa (inner cheek lining)
The relative abundance of Actinobacteria and Fusobacteria were increased in the buccal cheek mucosa of Toombak users compared to non-users of Toombak. Moraxellaceae (q = 0.037), Leptotrichiaceae (q = 0.019), and Staphylococcaceae (q = 0.037) were the most significantly relatively abundant families amongst the buccal microbiome of Toombak users. Staphylococcaceae exhibited the highest fold change increase amongst Toombak users (4.259), while Enterobacteriaceae (0.037) using Deseq2 coverage were found to be increased amongst non-users of Toombak with a fold change increase of 7.691. Leptotrichia (q = 0.029), Staphylococcus (q = 0.04) and Cutibacterium (q = 0.04) were the most significantly abundant genera amongst the buccal mucosa of Toombak users while LEfSe highlighted Staphylococcus, Cutibacterium and Corynebacterium_1 (LDA > 2) as the most discriminant genera of the buccal microbiome amongst this group. In the non-users of Toombak, Shigella (q = 0.03) and Prevotella_6 (q = 0.04) were significantly abundant while Scardovia and Prevotella_6 could distinguish the buccal microbiome of non-users (Fig. 7a).
LEfSe plotting of the four oral mucosal locations. (a) Buccal cheek microbiome. Staphylococcus, Corynebacterium_1 and Cutibacterium were the most discriminant genera in Toombak users while Prevotella and Scardovia were found in non-users. (b) Dorsum tongue microbiome. Haemophilus, Actinobacillus, and Scardovia were discriminant in the dorsum tongue of non-users of Toombak. (c). The floor of the mouth microbiome. uncultured bacterium (LDA = 3.1) and Porphyromonas gingivalis (LDA = 3.09) are the most distinct microbiome components in the floor of the mouth of Toombak users. (d) Hard palate microbiome. Uncultured bacterium from the phyla Fusobacteria and Proteobacteria, and the species, Faucicola mancuniensis are observed in Toombak users while uncultured bacterium from the phyla Bacteroidetes are discriminant of non-users.
Genera found in abundance in the buccal microbiome of Toombak users may be related to the increased risk of oral tumour development47. Fusobacteria and the genera Staphylococcus and Corynebacterium_1 are able to reduce nitrate and nitrite to produce carcinogenic tobacco-specific nitrosamine compounds29. Studies from Indian smokeless tobacco users have also highlighted an abundance of Staphylococcus amongst OSCC smokeless tobacco users55. Cutibacterium are likely introduced by using fingers in the oral cavity during Toombak placement1. Biofilm formation is enhanced with smokeless tobacco use which can improve epithelial adherence of Staphylococcus46. In addition, oral Staphylococcus abundance amongst Toombak users may be linked to an increased fungal load in the oral cavity56 likely through chemical interplay involving metabolites, quorum sensing effectors and stable biofilm development57. Oral Staphylococcus abundance found in Toombak users may be a reservoir for the development of systemic infection, is a source of methicillin-resistant strains and could pose an increased susceptibility to blood-related infections58,59. Staphylococcus further plays a sinister role in the acidic hypoxic environments of oral cancer47 and has been isolated from OSCC sites60.
Species found in abundance in the buccal microbiome of Toombak users included Gemella morbillorum (98.28% ident), Prevotella nigrescens (99.35% ident), Staphylococcus caprae (100% ident) and Lachnoanaerobaculum gingivalis (99.32% ident). Gemella morbillorum has been significantly associated with inflammatory gingival responses and has been detected with high abundance on the surfaces of some oral cancer tissue60 61. It is also known to contribute to the acidic and hypoxic environments of oral cancer, promoting cancer growth62,63. Gemella morbillorum has also been the cause of infective endocarditis amongst a smokeless tobacco user from Somalia64. The ability of Staphylococcus caprae to produce B haemolysins and enterotoxins can lead to significant cell damage amongst oral cells65. On the other hand, species distinguishing the buccal mucosa of non-users of Toombak included Rothia mucilaginosa (98.88% ident), Veillonella atypica (98.28% ident), Streptococcus sobrinus (99.35% ident), Prevotella salivae (99.35% ident), Prevotella pallens (99.35% ident) and Bifidobacterium dentium (99.33% ident).
The dorsum tongue mucosa
Actinomyces (p = 0.013) and uncultured bacterium (p = 0.031) were found to be enriched in the tongue of Toombak users. Tannerella (q = 0.0085) and Cardiobacterium (q = 0.0097) in Toombak users, were relatively abundant in this mucosal location with a mean change of 5 and 13 respectively compared to non-users. A Fusobacteria unidentified species (OTU_1157) was also associated with Toombak use (LDA = 2.69). In non-users, Bifidobacterium (q = 0.0049) was significantly increased by a mean change of 1.15 while five unique genera in the non-users of smokeless tobacco were identified; Olsenella (p = 0.04), Lactobacillus, F0058, Aggregatibacter (p = 0.02), and Actinobacillus (p = 0.01). Pattern search of the top 25 genera revealed that Bergeyella (p = 0.02), uncultured bacteria and Leptotrichia (p = 0.007) were the most positively correlated genera associated with Toombak use, while Scardovia (p = 0.002) and Lactobacillus were positively correlated with non-users. LEfSe plotting further highlighted that Haemophilus (p = 0.004, LDA = 3.7), Actinobacillus (0.003, LDA = 3.8), and Scardovia were discriminant genera for the dorsum tongue of non-users (Fig. 7b) while Actinomyces distinguished the dorsum tongue of Toombak users (LDA = 3.9).
The species Leptotrichia wadei (q = 0.023, 99.55% ident), Schaalia odontolytica (p = 0.0028) and Streptococcus equinus (p = 0.043, 99.78% ident) were abundant in the microbiome of the dorsum tongue of Toombak users while Haemophilus haemolyticus (q = 0.001, 99.78% ident) and Streptococcus sobrinus (q = 0.023, 99.35% ident) were enriched amongst non-users of Toombak. Corynebacterium argentoratense (LDA = 3.7) and Actinobacillus pleuropneumoniae (LDA = 2.64) were also associated with the tongue of non-users.
The floor of the mouth mucosa
Significant enrichment of the genera Corynebacterium_1 (p = 0.0028), Staphylococcus (q = 0.01) and Candidatus_Saccharimonas (p = 0.026) was found in the floor of the mouth in those utilising Toombak while Scardovia (q = 0.04) was found to be high in non-users. LEfSe plotting distinguished uncultured bacterium (LDA = 3.1) and Porphyromonas gingivalis (LDA = 3.09) as the most distinctive microbiome components in the floor of the mouth of Toombak users (Fig. 7c). Five unique genera were present in Toombak users: Selenomonas_4, Filifactor, Eubacterium_nodatum group, Candidatus_Saccharimonas, Anaeroglobus while one genus was unique to non-users; Catonella. Pattern search further revealed that Corynebacterium_1, Candidatus Saccharimonas, Stomatobaculum, Parvimonas, and Oribacterium were positively correlated with Toombak use while Prevotella_2, Lactobacillus, Scardovia, Actinobacillus, Comamonas, and Aggregatibacter were the positively correlated genera with non-users of Toombak.
Species inhabiting the floor of the mouth of Toombak users included Stomatobaculum longum, Eubacterium infirmum, Prevotella denticola, and Bifidobacterium dentium, while Corynebacterium argentoratense was evident in the floor of the mouth of non-users.
The hard palatal mucosa
In the palatal mucosa, positive microbiome correlations with Toombak use included Candidatus Saccharimonus (p = 0.086), Lautropia (q = 0.002, LDA = 3.3), Johnsenella (q = 0.001), Actinomyces, Capnocytophaga, Leptotrichia, Faucicola (q = 0.001), and Peptococcus while non-users of Toombak had positive correlations with Prevotella and Prevotella_6, Selenomonas, Anaeroglobus, Lactobacillus, Moraxella, Shigella, Scardovia (q = 0.012) and Simonsiella (q = 0.04). An unclassified Gracilibacteria oral taxon 873 (p = 0.031) was found to be unique to the palatal microbiome of Toombak users. Several OTUs from the Patescibacteria phylum were significantly abundant amongst Toombak users and included OTU_112 (p = 0.032), OTU_144 (p = 0.023), OTU_24 (p = 0.039), OTU_113 (p = 0.031) and OTU_114 (p = 0.043).
The species, Leptotrichia hofstadii was highly correlated with the hard palatal mucosa of Toombak users (99.32% ident) and Streptococcus salivarius was abundant. Actinomyces israelii, Actinomyces cardiffensis and Faucicola mancuniensis, were detected only in the palate of Toombak users. LEfSe plotting of species discriminant of Toombak users highlighted Faucicola mancuniensis, a Bacteroidetes oral taxon 274 strain F008 and uncultured bacterium from the phyla Fusobacteria and Proteobacteria (Fig. 7d).
In comparison, Bifidobacterium longum (99.33% ident), Veillonella atypica (98.28% ident) and Alloscardovia omnicolens (99.33% ident) were positively correlated with the palatal mucosal microbiome of non-users while Haemophilus paraurethrae, Haemophilus quentini, and Prevotella denticola were found in non-users and Actinomyces graevenitzii in both groups. Actinomyces cardiffensis and Actinomyces israelii were only found on the palatal microbiome of Toombak users. Deseq 2 highlighted four OTUs abundant amongst Toombak users with q values < 0.05 that included OTU 113 (weak similarity with Terrisporobacter), OTU 427 (high similarity with Neisseria species), Lautropia mirabilis (BLASTn 99.35% ident) and Leptotrichia. Poryphromonas cataniae (98% ident) was significantly abundant in Toombak users.
Actinomyces abundance in the saliva, tongue, buccal cheek, and hard palate of Toombak users
We found an abundance of Actinomyces in the saliva (q = 0.0045), dorsum tongue (p = 0.013), and hard palate (p = 0.001) of Toombak users. Reports on the effects of smokeless tobacco on Actinomyces growth has been contradictory. Smokeless tobacco use has been found to both reduce66,67 and enrich Actinomyces growth68. Actinomyces has also been found in abundance in moist Indian smokeless tobacco products69. Actinomyces massiliensis (p = 0.016) was abundant in the buccal microbiome of Toombak users while Actinomyces graevenitzii was found to be enriched in the tongue in both users and non-users of Toombak. Actinomyces is associated with the discolouration of teeth70 while Actinomyces graevenitzii has been associated with halitosis71. Actinomyces graevenitzii and Staphylococcus in co-culture were also found to significantly reduce neutrophil recruitment a factor that could participate in immune dysregulation amongst Toombak users72. Furthermore, many Actinomyces species are potent nitrate-reducing bacteria and thus may contribute to increasing tobacco-specific nitrosamine production in Toombak73. In other studies, Actinomyces meyeri was found to be abundant amongst smokeless tobacco users from Saudi Arabia34. Actinomyces israelii and Actinomyces cardiffensis were found to be unique to the palatal microbiome of Toombak users.
Lautropia abundance in the saliva, buccal cheek and palate microbiomes of Toombak users could relate to compromised local immunity
In this study, Lautropia was abundant in the saliva, buccal cheek, and palate microbiomes of Toombak users with Lautropia mirabilis the species identified. Lautropia has been associated with benign lesions in the oral cavity such as fibroepithelial polyp74 as well as malignant diseases including non-small cell lung cancer, oral and oesophageal cancers75,76. In a study assessing Srilankan betel quid users, Lautropia was not abundant amongst smokeless tobacco users but rather in healthy controls77. In another study, Lautropia has been detected as part of the core oral microbiome amongst healthy Nigerians78, however, Lautropia mirabilis abundance may also be associated with compromised local immunity that could be caused by Toombak use. The Lautropia genus was also found to be abundant in the oral microbiome of a series of HIV-infected children79.
Prevotella abundance amongst non-users of Toombak
Although Prevotella was present in both users and non-users, they were significantly more abundant in non-users of Toombak (p < 0.05) and were found in the saliva, tongue, buccal cheek and palatal microbiomes. Alloprevotella amongst non-users was also higher compared to Toombak users. Prevotella is often a commensal oral microorganism and in the oral cavity has been found to be more abundant amongst those with African and Indian heritage80,81,82. Prevotella abundance in the oral cavity has been associated with the development of other diseases that includes rheumatoid arthritis, metabolic syndrome, inflammatory bowel and cardiovascular disease but in other studies its abundance is associated with the reduction of hypersensitivity reactions83,84.
Species modifications may harbour distinct susceptibilities in the oral cavity of Toombak users
The most common bacteria in the oral cavity were found to vary in species due to Toombak smokeless tobacco use. This may allow for a complex integration of bacteria with a more sinister ability to transfer and integrate features such as antibiotic-resistance genes eliciting distinct susceptibilities in the oral microbiome of Toombak users. Common to both users and non-users of Toombak were the species Prevotella salivae and Prevotella pallens which were found to be abundant in the tongue and palate of both groups and the buccal microbiome of non-users. They are common to the oral microbiome of adults85. Prevotella scopos and Prevotella veroralis were also evident in the tongue and palate microbiomes in both groups. In one study Prevotella salivae was increased in the buccal mucosa of smokers86. Although Prevotella pallens is commonly associated with oral health87, in some studies, it has been associated with development of halitosis (oral malodour) as well as OSCC88,89.
Prevotella nigrescens however was abundant only in Toombak users. Intra-orally, this species has been associated with inflammatory changes to the mucosa90 and alveolar bone loss83, while extra-orally, it has been detected in samples of occluded arteries (vascular disease)91. Prevotella nigrescens abundance did not differ in a study of betel nut users and non-users in Thailand92. Prevotella nigrescens and Prevotella pallens have also been associated with penicillin resistance93.
In the tongue, Streptococcus sobrinus was abundant in non-users, while Streptococcus equinus was abundant in Toombak users. Streptococcus salivarius was abundant in the hard palate of Toombak users90. Species from the Streptococcus bovis/Streptococcus equinus complex are some of the most antibiotic-resistant Streptococcus species found in the oral cavity94. It is interesting that on the dorsum tongue in Toombak users, Streptococcus sobrinus (a caries-associated bacterium but with no known antibiotic resistance) is replaced with Streptococcus equinus. Streptococcus salivarius found in abundance in the hard palate of Toombak users has been shown to elicit the release of the pro-inflammatory interleukin 895 and is known to be a potent acetaldehyde producer34. Non-sucrose-containing smokeless tobacco forms, such as Toombak have also been shown to be a possible source of growth substrate for various Streptococcus species including Streptococcus salivarius96. Therefore, it is probable that the use of smokeless tobacco, Toombak contributes to a modified Streptococcus inhabitance in the oral cavity that leads to specific alterations in the various oral mucosal locations. Streptococcus species associated with antibiotic resistance increase in those who use Toombak compared to non-users which could be explained by the increased microbiome entry from the Toombak itself into the oral cavity as well as alterations from mechanical, chemical, and pH changes that arise from its use. Streptococcus mitis was the most abundant species in all sites of the oral cavity, while Streptococcus porcorum was abundant in the palate and tongue in both users and non-users. Streptococcus mitis species are regarded as commensals in the oral cavity but some strains harbour unusually high levels of resistance to β lactam antibiotics97. In one study, Streptococcus mitis was found to be abundant in those with OSCC98 while in another study, Streptococcus mitis was shown to have therapeutic potential in the treatment of oral cancer99.
The family, Veillonellaceae were found to be in similar abundance in both groups. The genus Veillonella is generally associated with good oral health100 and were relatively abundant in the tongue of both users and non-users. Veillonella rogosae was found on all mucosal surfaces. Veillonella atypica was abundant in the palate and tongue of Toombak users and non-users and the buccal cheek of non-users. In Toombak users, Veillonella atypica may have a role to play in nitrate/nitrite reduction from smokeless tobacco into the carcinogenic tobacco-specific nitrosamines101.
Non-users of smokeless tobacco harbour genera with pro-mucosal integrity potential that include Scardovia, Bifidobacterium and Lactobacillus
Associated with healthy mucosal integrity are the genera Scardovia102, and Lactobacillus56 while Bifidobacterium help in the maintenance of epithelial integrity and promotion of healthy gingival barriers103. Interestingly, Scardovia is found to be depleted in oral cancer104 and in this study was enriched in the supragingival plaque of non-users and could distinguish the buccal mucosal microbiome of the same group. Therefore, the absence of this genus amongst Toombak users may highlight a lack of mucosal protection against oral cancer. Lactobacillus was enriched in the plaque of non-users of Toombak and was part of the core genera of the tongue microbiome in non-users. Lactobacillus was also abundant in the paraffin-embedded tissue OSCC samples taken from non-users of Toombak. Bifidobacterium was enriched in the plaque of non-users, Bifidobacterium dentium in the tongue and buccal cheek microbiome and Bifidobacterium longum on the hard palate of non-users.
Lactobacillus and Bifidobacterium could have many beneficial activities in the oral cavity that may be lost with Toombak use. They can produce antimicrobial compounds and have a key role in supporting the oral immune defence mechanisms. IgA levels in saliva have been shown to increase in those with Lactobacillus and Bifidobacterium abundances105. Bifidobacterium dentium is ‘mucin’ friendly preventing the disruption of the mucous barrier106. Bifidobacterium is reported to reduce DNA damage and may delay or even prevent the onset of cancers107. Both Bifidobacterium and Lactobacillus can help prevent the colonisation of pathogenic bacteria in the oral cavity108. We found Prevotella nigrescens for example to be abundant in Toombak users compared to non-users. Lactobacillus has been shown to have eliminating action against Prevotella nigrescens and thus its reduced presence amongst Toombak users could explain why this species was more abundant in Sudanese smokeless tobacco users100.
Toombak-associated OSCC significantly carries a more aggressive microbiome
Clustering of the premalignant samples together could be appreciated (Fig. 8a) but β-diversity was non-significant between groups; moderate (n = 8), well-differentiated (n = 35), premalignant samples (n = 2) and the control (n = 1). It is likely, that the microbiome of moderate and well-differentiated OSCC samples is similar in microbial habitat. Shannon index between groups was statistically significant (p = 0.03), where the control or non-cancerous sample had the highest median alpha diversity compared to the remaining groups of oral cancer and premalignant conditions (Fig. 8b).
Premalignant and oral squamous cell carcinoma metagenomic profiles. (a) β-diversity of oral squamous cell carcinoma cancer samples from Sudanese participants utilising paraffin embedded blocks. Differentiation between premalignant and malignant samples may be observed. Malignant samples are further classified into moderate (n = 8) and well-differentiated OSCC (n = 35). (b) Shannon diversity (p = 0.03). The non-premalignant sample had the highest Shannon diversity and the premalignant samples had the lowest alpha diversity. (c) Redundancy analysis of oral cancer samples. Toombak use highlights microbiome variation between cancer samples compared to non-users. Oral cancer samples from non-users of Toombak had increased abundances of Lactobacillus (p = 0.024), Collinsella (p = 0.014), and Flavobacterium (p = 0.0087) while oral cancers from Toombak users had abundances in Corynebacterium_1 (p = 0.044), Mogibacterium (p = 0.0013), Enterococcus (p = 0.012), Empedobacter (p = 0.03), Stenotrophomonas (p = 0.043) and Schlegelella (p = 0.048).
Redundancy analysis indicated that the oral cancer microbiome composition was influenced by Toombak use (Fig. 8c). We further applied DeSeq2 to compare mean and subsequent fold changes of the most important genera amongst Toombak and non-users of Toombak OSCC samples. OSCC from non-users of Toombak had increased abundances of Lactobacillus (p = 0.024), Collinsella (p = 0.014), and Flavobacterium (p = 0.0087) while OSCC samples from Toombak users had abundances in Corynebacterium_1 (p = 0.044), Mogibacterium (p = 0.0013), Enterococcus (p = 0.012), Empedobacter (p = 0.03), Stenotrophomonas (p = 0.043) and Schlegelella (p = 0.048). Corynebacterium_1 was significantly increased amongst those cancer samples from Toombak users (p = 0.044) with a reduced fold change of -1.446 amongst non–users cancer samples. Interestingly, Corynebacterium_1 has been found to be the most abundant genus in Toombak1 and in this study, was found to be significantly increased in the saliva, buccal cheek and floor of the mouth microbiomes of Toombak users. Coprococcus_2 (p = 0.05), Rothia (p = 1.5e−10), Eubacterium_nodatum (p = 0.0015), Peptostreptococcus (p = 6.5e−07), Ruminiclostridium (p = 0.0042) and Stomatobaculum (p = 0.013) were the most abundant genera amongst premalignant samples compared to oral cancer samples.
Conclusion
In this study we showed that the microbiome and mycobiome of the oral cavity is significantly altered with Sudanese Toombak smokeless tobacco use. In Toombak users, non-normally residing genera become abundant throughout the hard and soft oral tissue mucosal locations that include the genus Staphylococcus while in non-users of Toombak, Prevotella, Lactobacillus and Bifidobacterium are found to be more prevalent. Toombak use was also found to significantly alter species determinants in genera such as Prevotella, Streptococcus, Actinomyces and Veillonella.
The mycobiome is further seen to lose counterbalance with Toombak use, with a significant enhancement of Aspergillus and loss of Candida. Such findings can pave the way for the development of ‘oral fungal and bacterial response panels’ to track OSCC progression in those with Toombak use. Further whole genomic sequencing approaches can answer how such modified communities challenge the specific functionality of the microorganism in the response to Toombak use.
While no significant local behaviours were known to otherwise alter the oral microbiome of the participants included in this study, factors such as dietary intake could play an indirect role in the host-oral microbiome connections reflected in this study requiring further research to outline other impingements on the oral microbiome of the Sudanese population.
The results of this study further contribute to a new understanding in OSCC development and its progression amongst smokeless tobacco users worldwide. We have further shown that the microbiome of Toombak related OSCC may be more aggressive resulting in an increased risk of recurrence and metastasis and an overall poorer prognosis.
Data availability
The datasets generated during this study are available by contacting the corresponding author upon reasonable request.
References
Sami, A. et al. The ultra-structural, metabolomic and metagenomic characterisation of the Sudanese smokeless tobacco ‘Toombak’. Toxicol. Rep. 8, 1498–1512 (2021).
Idris, A. M. et al. Unusually high levels of carcinogenic tobacco-specific nitrosamines in Sudan snuff (toombak). Carcinogenesis 12, 1115–1118 (1991).
Torti, S. V., Manz, D. H., Paul, B. T., Blanchette-Farra, N. & Torti, F. M. Iron and cancer. Annu. Rev. Nutr. 38, 97–125 (2018).
Arthur, R. A. et al. Microbiome and oral squamous cell carcinoma: a possible interplay on iron metabolism and its impact on tumor microenvironment. Braz. J. Microbiol. 52, 1287–1302 (2021).
Ahmed, H. G. Aetiology of oral cancer in the Sudan. J. Oral. Maxillofac.Res. 4, e3 (2013).
Sajid, M., Srivastava, S., Joshi, L. & Bharadwaj, M. Impact of smokeless tobacco-associated bacteriome in oral carcinogenesis. Anaerobe 70, 102400 (2021).
Buduneli, N. Environmental factors and periodontal microbiome. Periodontol. 2000(85), 112–125 (2021).
Willis, D., Popovech, M., Gany, F. & Zelikoff, J. toxicology of smokeless tobacco: implications for immune, reproductive, and cardiovascular systems. J. Toxicol. Environ. Health Part B 15, 317–331 (2012).
Alsanosy, R. M. Smokeless tobacco (shammah) in Saudi Arabia: a review of its pattern of use, prevalence, and potential role in oral cancer. Asian Pac. J. Cancer Prev. 15, 6477–6483 (2014).
Ibrahim, S. O. et al. Mutations of the p53 gene in oral squamous-cell carcinomas from sudanese dippers of nitrosamine-rich toombak and non-snuff-dippers from the Sudan and Scandinavia. Int. J. Cancer 81, 527–534 (1999).
Ibrahim, S. O. et al. Expression of keratin 13, 14 and 19 in oral squamous cell carcinomas from Sudanese snuff dippers: lack of association with human papillomavirus infection. APMIS 106, 959–969 (1998).
Saxena, R. et al. Assessing the effect of smokeless tobacco consumption on oral microbiome in healthy and oral cancer patients. Front. Cell. Infect. Microbiol. 12, 20. https://doi.org/10.3389/fcimb.2022.841465 (2022).
Mohamed, N. et al. Analysis of salivary mycobiome in a cohort of oral squamous cell carcinoma patients from Sudan identifies higher salivary carriage of malassezia as an independent and favorable predictor of overall survival. Front. Cell. Infect. Microbiol. 11, 673465 (2021).
Walsh, A. M. et al. Microbial succession and flavor production in the fermented dairy beverage kefir. mSystems 1, e00052 (2016).
Magoč, T. & Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27, 2957–2963 (2011).
Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26, 2460–2461 (2010).
Caporaso, J. G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics 26, 266–267 (2010).
Quast, C. et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 41, D590–D596 (2013).
McGinnis, S. & Madden, T. L. BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 32, W20–W25 (2004).
Callahan, B. J. et al. DADA2: high-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581–583 (2016).
Team, R. C. R: A language and environment for statistical computing. MSOR connections 1. (2014).
Martin, M. CUTADAPT removes adapter sequences from high-throughput sequencing reads. EMBnetjournal 17 (2011).
Dhariwal, A. et al. MicrobiomeAnalyst: a web-based tool for comprehensive statistical, visual and meta-analysis of microbiome data. Nucleic Acids Res. 45, W180–W188 (2017).
Kovács, L. et al. Associations between heart rate variability parameters and housing- and individual-related variables in dairy cows using canonical correspondence analysis. PLoS One 10, e0145313–e0145313 (2015).
Harrandah, A. M., Chukkapalli, S. S., Bhattacharyya, I., Progulske-Fox, A. & Chan, E. K. L. Fusobacteria modulate oral carcinogenesis and promote cancer progression. J. Oral Microbiol. 13, 1849493–1849493 (2020).
Verma, D., Garg, P. K. & Dubey, A. K. Insights into the human oral microbiome. Arch. Microbiol. 200, 525–540 (2018).
Fujiwara, N. et al. Involvement of fusobacterium species in oral cancer progression: a literature review including other types of cancer. Int. J. Mol. Sci. 21, 6207 (2020).
Espinoza, J. L. et al. Supragingival plaque microbiome ecology and functional potential in the context of health and disease. mBio 9, e01631 (2018).
Sami, A. et al. The ultra-structural, metabolomic and metagenomic characterisation of the Sudanese smokeless tobacco “Toombak”. Toxicol. Rep. 8, 1498–1512 (2021).
Rands, C. M. et al. ACI-1 beta-lactamase is widespread across human gut microbiomes in Negativicutes due to transposons harboured by tailed prophages. Environ. Microbiol. 20, 2288–2300 (2018).
Gopinath, D. et al. Salivary bacterial shifts in oral leukoplakia resemble the dysbiotic oral cancer bacteriome. J. Oral Microbiol. 13, 1857998 (2021).
Waite, D. W. et al. Proposal to reclassify the proteobacterial classes Deltaproteobacteria and Oligoflexia, and the phylum Thermodesulfobacteria into four phyla reflecting major functional capabilities. Int. J. Syst. Evol. Microbiol. 70, 5972–6016 (2020).
Campbell, A. et al. Multiple single-cell genomes provide insight into functions of uncultured deltaproteobacteria in the human oral cavity. PLoS One 8, e59361 (2013).
Halboub, E. et al. Tongue microbiome of smokeless tobacco users. BMC Microbiol. 20, 201 (2020).
Hernandez, B. Y. et al. Betel nut chewing, oral premalignant lesions, and the oral microbiome. PLoS One 12, e0172196 (2017).
Chattopadhyay, I., Verma, M. & Panda, M. Role of oral microbiome signatures in diagnosis and prognosis of oral cancer. Technol. Cancer Res. Treat. 18, 1533033819867354–1533033819867354 (2019).
Pushalkar, S. et al. Comparison of oral microbiota in tumor and non-tumor tissues of patients with oral squamous cell carcinoma. BMC Microbiol. 12, 144 (2012).
Ali, M. A. B. M. Isolation and Identification of Some Oral Microorganisms from healthy Sudanese Smokers and Oral Cancer Patients (University of Gezira, UK, 2014).
Okada, N. et al. First reported case of Lachnoanaerobaculum gingivalis bacteremia in an acute myeloid leukemia patient with oral mucositis during high dose chemotherapy. Anaerobe 76, 102610 (2022).
Sawant, S., Dugad, J., Parikh, D., Srinivasan, S. & Singh, H. Identification & correlation of bacterial diversity in oral cancer and long-term tobacco chewers- A case-control pilot study. J. Med. Microbiol. 70 (2021).
Sarkar, A., Stoneking, M. & Nandineni, M. R. Unraveling the human salivary microbiome diversity in Indian populations. PLoS One 12, e0184515 (2017).
Al-Marzooq, F. et al. Supragingival microbiome alternations as a consequence of smoking different tobacco types and its relation to dental caries. Sci. Rep. 12, 1–14 (2022).
Amer, A., Galvin, S., Healy, C. M., Moran, G. P. The microbiome of potentially malignant oral leukoplakia exhibits enrichment for fusobacterium, leptotrichia, campylobacter, and Rothia species. Front. Microbiol. 8 (2017).
Torres, P. J. et al. Characterization of the salivary microbiome in patients with pancreatic cancer. PeerJ. 3, e1373 (2015).
Mougeot, J. C. et al. Haemophilus pittmaniae and Leptotrichia spp. constitute a multi-marker signature in a cohort of human papillomavirus-positive head and neck cancer patients. Front. Microbiol. 12, 794546 (2021).
Al Bataineh, M. T. et al. Revealing oral microbiota composition and functionality associated with heavy cigarette smoking. J. Transl. Med. 18, 421 (2020).
Srivastava, A. et al. Comparative and analytical characterization of the oral bacteriome of smokeless tobacco users with oral squamous cell carcinoma. Appl. Microbiol. Biotechnol. 106, 4115–4128 (2022).
Proctor, D. M. et al. A spatial gradient of bacterial diversity in the human oral cavity shaped by salivary flow. Nat. Commun. 9, 681 (2018).
Magnussen, A. & Parsi, M. A. Aflatoxins, hepatocellular carcinoma and public health. World J. Gastroenterol. 19, 1508–1512 (2013).
Li, Y. et al. Salivary mycobiome dysbiosis and its potential impact on bacteriome shifts and host immunity in oral lichen planus. Int. J. Oral. Sci. 11, 13 (2019).
Pavia, C. S. & Plummer, M. M. Clinical implications of nicotine as an antimicrobial agent and immune modulator. Biomed. Pharmacother. 129, 110404 (2020).
da Costa, K. R., Ferreira, J. C., Komesu, M. C. & Candido, R. C. Candida albicans and Candida tropicalis in oral candidosis: quantitative analysis, exoenzyme activity, and antifungal drug sensitivity. Mycopathologia 167, 73–79 (2009).
Deepa, A., Nair, B. J., Sivakumar, T. & Joseph, A. P. Uncommon opportunistic fungal infections of oral cavity: a review. J. Oral Maxillofac. Pathol. 18, 235–243 (2014).
Sankari, S. L., Mahalakshmi, K. & Kumar, V. N. A comparative study of Candida species diversity among patients with oral squamous cell carcinoma and oral potentially malignant disorders. BMC Res. Notes 13, 488 (2020).
Srivastava, A. et al. Comparative and analytical characterization of the oral bacteriome of smokeless tobacco users with oral squamous cell carcinoma. Appl. Microbiol. Biotechnol. 106(11), 4115–4128. https://doi.org/10.1007/s00253-022-11980-5 (2022).
Laheij, A. M. G. A. et al. Microbial changes in relation to oral mucositis in autologous hematopoietic stem cell transplantation recipients. Sci. Rep. 9, 16929 (2019).
Carolus, H., Van Dyck, K. & Van Dijck, P. Candida albicans and Staphylococcus species: a threatening twosome. Front. Microbiol. https://doi.org/10.3389/fmicb.2019.02162 (2019).
McCormack, M. G. et al. Staphylococcus aureus and the oral cavity: An overlooked source of carriage and infection?. Am. J. Infect. Control 43, 35–37 (2015).
Pasman, R., Krom, B. P., Zaat, S. A. J. & Brul, S. The role of the oral immune system in oropharyngeal candidiasis-facilitated invasion and dissemination of Staphylococcus aureus. Front. Oral. Health 3, 851786 (2022).
Minarovits, J. Anaerobic bacterial communities associated with oral carcinoma: intratumoral, surface-biofilm and salivary microbiota. Anaerobe 68, 102300 (2021).
Rai, A. K. et al. Dysbiosis of salivary microbiome and cytokines influence oral squamous cell carcinoma through inflammation. Arch. Microbiol. 203, 137–152 (2021).
Hettmann, A., Demcsák, A., Decsi, G., Bach, Á., Pálinkó, D., Rovó, L., Nagy, K., Takács, M. & Minarovits, J. Infectious agents associated with head and neck carcinomas. Adv. Microbiol. Infectious Dis. Public Health 63–80 (2015).
Lee, A. et al. Bacterial and salivary biomarkers predict the gingival inflammatory profile. J. Periodontol. 83, 79–89 (2012).
Massoure, P. L. et al. Lethal aortic endocarditis due to Gemella morbillorum in a Djiboutian khat user. Rev. Med. Intern. 31, e7–e9 (2010).
Fowoyo, P. T. & Ogunbanwo, S. T. Virulence and toxigenicity of coagulase-negative staphylococci in Nigerian traditional fermented foods. Can. J. Microbiol. 62, 572–578 (2016).
Bhatt, S., Rajesh, G., Pai, M. B., Rao, A. & Shenoy, R. Effects of refined extracts of smokeless tobacco on Cariogenic microorganisms: an in-vitro study. Int. J. Adv. Res. 2, 847–852 (2014).
Liu, M. et al. Effect of smokeless tobacco products on human oral bacteria growth and viability. Anaerobe 42, 152–161 (2016).
Vishwakarma, A. & Verma, D. Microorganisms: crucial players of smokeless tobacco for several health attributes. Appl. Microbiol. Biotechnol. 105, 6123–6132 (2021).
Sajid, M. et al. Bacteriome of moist smokeless tobacco products consumed in India with emphasis on the predictive functional potential. Front. Microbiol. 12, 784841 (2021).
Mortazavi, H., Baharvand, M. & Khodadoustan, A. Colors in tooth discoloration: a new classification and literature review. Int. J. Clin. Dentistry 7 (2014).
Bernardi, S. et al. Combining culture and culture-independent methods reveals new microbial composition of halitosis patients’ tongue biofilm. MicrobiologyOpen 9, e958 (2020).
Jalali, F. et al. No man’s land: species-specific formation of exclusion zones bordering Actinomyces graevenitzii microcolonies in nanoliter cultures. MicrobiologyOpen 10, e1137 (2021).
Gordon, J. H. et al. Is the oral microbiome associated with blood pressure in older women?. High Blood Pressure Cardiovasc. Prevent. 26, 217–225 (2019).
Perera, M. et al. Inflammatory bacteriome and oral squamous cell carcinoma. J. Dent. Res. 97, 725–732 (2018).
Zhang, W. et al. Salivary microbial dysbiosis is associated with systemic inflammatory markers and predicted oral metabolites in non-small cell lung cancer patients. J. Cancer 10, 1651 (2019).
Schmidt, B. L. et al. Changes in abundance of oral microbiota associated with oral cancer. PLoS One 9, e98741 (2014).
Uehara, O. et al. Alteration of oral flora in betel quid chewers in Sri Lanka. J. Microbiol. Immunol. Infect. 54, 1159–1166 (2021).
Anukam, K. C., Onwuzor, I., Olise, N., Duru, M. & Agbakoba, N. Oral bacteriome compositions identified by 16S rRNA metagenomics in a randomly selected “healthy” Nigerian male and female subjects. Int. J. Res. Rep. Dentistry 1, 1–11 (2018).
Rossmann, S. N. et al. Isolation of <i>Lautropia mirabilis</i> from oral cavities of human immunodeficiency virus-infected children. J. Clin. Microbiol. 36, 1756–1760 (1998).
Yang, Y. et al. Racial differences in the oral microbiome: data from low-income populations of African ancestry and European ancestry. mSystems 4, e00639 (2019).
Downes, J., Hooper, S. J., Wilson, M. J. & Wade, W. G. Prevotella histicola sp. nov., isolated from the human oral cavity. Int. J. Syst. Evol. Microbiol. 58, 1788–1791 (2008).
Acharya, A. et al. Salivary microbiome of an urban Indian cohort and patterns linked to subclinical inflammation. Oral Dis. 23, 926–940 (2017).
Larsen, J. M. The immune response to Prevotella bacteria in chronic inflammatory disease. Immunology 151, 363–374 (2017).
Murugesan, S., Elanbari, M., Bangarusamy, D. K., Terranegra, A. & Al, K. S. Can the salivary microbiome predict cardiovascular diseases? Lessons learned from the Qatari population. Front. Microbiol. 12, 772736 (2021).
Könönen, E. & Gursoy, U. K. Oral Prevotella species and their connection to events of clinical relevance in gastrointestinal and respiratory tracts. Front. Microbiol. 12, 798763 (2021).
Karabudak, S. et al. Analysis of the effect of smoking on the buccal microbiome using next-generation sequencing technology. J. Med. Microbiol. 68, 1148–1158 (2019).
Fteita, D. et al. Quorum sensing molecules regulate epithelial cytokine response and biofilm-related virulence of three Prevotella species. Anaerobe 54, 128–135 (2018).
Jia, Y. J. et al. Association between oral microbiota and cigarette smoking in the Chinese population. Front. Cell Infect. Microbiol. 11, 658203 (2021).
Riggio, M. P. et al. Molecular identification of bacteria on the tongue dorsum of subjects with and without halitosis. Oral Dis. 14, 251–258 (2008).
Saxena, R. et al. Assessing the effect of smokeless tobacco consumption on oral microbiome in healthy and oral cancer patients. Front. Cell Infect. Microbiol. 12, 841465 (2022).
Iwai, T. et al. Oral bacteria in the occluded arteries of patients with Buerger disease. J. Vasc. Surg. 42, 107–115 (2005).
Dahlén, G., Nauclér, C., Nordwall, S. & Suksu-art, N. Oral microflora in betel-chewing adults of the Karen tribe in Thailand. Anaerobe 16, 331–336 (2010).
Mättö, J. et al. Beta-lactamase production in Prevotella intermedia, Prevotella nigrescens, and Prevotella pallens genotypes and in vitro susceptibilities to selected antimicrobial agents. Antimicrob. Agents Chemother. 43, 2383–2388 (1999).
Pompilio, A., Di Bonaventura, G. & Gherardi, G. An overview on Streptococcus bovis/Streptococcus equinus complex isolates: identification to the species/subspecies level and antibiotic resistance. Int. J. Mol. Sci. 20(3), 48 (2019).
Mostefaoui, Y., Bart, C., Frenette, M. & Rouabhia, M. Candida albicans and Streptococcus salivarius modulate IL-6, IL-8, and TNF-α expression and secretion by engineered human oral mucosa cells. Cell. Microbiol. 6, 1085–1096 (2004).
Vellappally, S., Fiala, Z., Šmejkalová, J., Jacob, V. & Shriharsha, P. Influence of tobacco use in dental caries development. Central Eur. J. Public Health 15(3), 116–121. https://doi.org/10.21101/cejph.a3431 (2007).
König, A., Reinert, R. R. & Hakenbeck, R. Streptococcus mitis with unusually high level resistance to β-lactam antibiotics. Microb. Drug Resistance 4, 45–49 (1998).
Mager, D. L. et al. The salivary microbiota as a diagnostic indicator of oral cancer: a descriptive, non-randomized study of cancer-free and oral squamous cell carcinoma subjects. J. Transl. Med. 3, 27 (2005).
Baraniya, D. et al. Screening of health-associated oral bacteria for anticancer properties in vitro. Front. Cell. Infect. Microbiol. 10, 575656 (2020).
Hojo, K. et al. Distribution of salivary Lactobacillus and Bifidobacterium species in periodontal health and disease. Biosci. Biotechnol. Biochem. 71, 152–157 (2007).
Doel, J. J., Benjamin, N., Hector, M. P., Rogers, M. & Allaker, R. P. Evaluation of bacterial nitrate reduction in the human oral cavity. Eur. J. Oral Sci. 113, 14–19 (2005).
McDaniel, S., McDaniel, J., Howard, K. M. & Kingsley, K. Molecular screening and analysis reveal novel oral site-specific locations for the cariogenic pathogen Scardovia wiggsiae. Dentistry J. 9, 73 (2021).
Takahashi, N. et al. Gingival epithelial barrier: regulation by beneficial and harmful microbes. Tissue Barriers 7, e1651158 (2019).
Börnigen, D. et al. Alterations in oral bacterial communities are associated with risk factors for oral and oropharyngeal cancer. Sci. Rep. 7, 17686–17686 (2017).
Lin, C. W. et al. Lozenges with probiotic strains enhance oral immune response and health. Oral Dis. https://doi.org/10.1111/odi.13854 (2021).
Engevik, M. A. et al. Bifidobacterium dentium fortifies the intestinal mucus layer via autophagy and calcium signaling pathways. mBio 10(3), e01087–e01119 (2019).
Grover, H. S. & Luthra, S. Probiotics–the nano soldiers of oral health. J. Indian Acad. Clin. Med. 13, s48–s54 (2011).
Meurman, J. H. Probiotics: Do they have a role in oral medicine and dentistry?. Eur. J. Oral Sci. 113, 188–196 (2005).
Acknowledgements
SFI and APC Microbiome Ireland and ESTHER for funding, and the people who participated in this study.
Author information
Authors and Affiliations
Contributions
A.S. carried out the analysis, interpretation of data, wrote the main manuscript text, and prepared figures. D.P. contributed to the main body of the text and the analysis. C.A.R., C.S., I.E. and R.P.R. made substantial contributions to the conception and design of the work as well as substantively revised it. All authors reviewed the manuscript. All authors have approved the final submitted version.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Sami, A., Elimairi, I., Ryan, C.A. et al. Altered oral microbiome in Sudanese Toombak smokeless tobacco users carries a newly emerging risk of squamous cell carcinoma development and progression. Sci Rep 13, 6645 (2023). https://doi.org/10.1038/s41598-023-32892-y
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-023-32892-y
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
