Correction to: Scientific Reports https://doi.org/10.1038/s41598-018-20465-3, published online 31 January 2018
This Article contains errors.
The image in Figure 6D shows an incorrect number of independent germ cell samples analyzed in western blots for ERK and pERK. In the revised Figure 6D, the results from the gel shown in Figure 6C, and 3 additional western blots of germ cell lysates from Control (Mgat1[F/F], Mgat1[F/+]:Stra8-iCre or Mgat1[+/+]) and Mgat1 cKO males are included.
As a result, the Figure legend for Figure 6D should read:
“(D) Histogram of the relative ratio of ERK and AKT signaling determined from western blot analyses of germ cell lysates prepared from the number of mice noted in each bar (mean ± SEM; **p < 0.01). Control mice included Mgat1[F/F], Mgat1[F/+]:Stra8-iCre and Mgat1[+/+] 22-day males.”
The correct Figure 6 and its corrected accompanying legend appear below.
Signaling pathways in Mgat1 cKO germ cells at 22 dpp. (A) GSEA analysis showing enrichment of a PDGF_ERK signature in control germ cells. (B) Heat map shows the cluster of DEGs in the PDGF_ERK signaling pathway positively-enriched in control versus Mgat1 cKO germ cells. Arrow identifies PDGFRA as down-regulated in Mgat1 cKO germ cells. (C) Western blot analysis of phosphorylated and unphosphorylated ERK1, ERK2 and AKT in germ cells of Mgat1 cKO compared to control. The gels from which these data were obtained are shown in Supplementary Fig. S7. (D) Histogram of the relative ratio of ERK and AKT signaling determined from western blot analyses of germ cell lysates prepared from the number of mice noted in each bar (mean ± SEM; **p < 0.01). Control mice included Mgat1[F/F], Mgat1[F/+]:Stra8-iCre and Mgat1[+ /+] 22-day males.
Furthermore, some primer sequences are not included in the Methods section, under the subheading ‘Quantitative PCR’. Primer sequences are given in Supplementary Table S4 and as follows:
Acrv, (For) TGAAGTTTCGGGTGACGAAGCAGGT: (Rev) GCTGGGAGTTTTGAGTGGTGCATAC;
Dbil5, (For) GTACAGCTTTTACAAACAGGCCACCC: (Rev) CCACTTTAGCAATGTAGATCCTCATGGC;
Cyp11a1, (For) GTGGACCCCAAGGATGCGTCGATACTCTTC: (Rev) ACCTCTTGGTTTAGGACGATTCGGTC;
Rhox5, (For) TCAAGGAAGACTCGGAAGAACAGCAT: (Rev) CACTATCCTTGTCCCCATCACCCATA;
Actb, (For) CGGTTCCGATGCCCTGAGGCTC: (Rev) TGTCAGCAATGCCTGGGTACATGGTGGT.”
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Biswas, B., Batista, F., Sundaram, S. et al. Author Correction: MGAT1 and Complex N-Glycans Regulate ERK Signaling During Spermatogenesis. Sci Rep 13, 3407 (2023). https://doi.org/10.1038/s41598-023-30418-0
Published:
DOI: https://doi.org/10.1038/s41598-023-30418-0
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
