Introduction

Animals exhibit extreme coat color variation between and within species. The trait is often a target of selection because even small changes in coat color can have significant implications for camouflage, communication, and thermoregulation. More than 100 genes are related to coat color determination1. In vertebrates, melanocortin-1 receptor (MC1R) is among the most well-studied and important coat color genes, with a key role in switching between brown-to-black eumelanin and yellow-to-red pheomelanin.

The MC1R gene encodes a G-protein coupled receptor (GPCR), consisting of an N-terminal domain, seven hydrophobic transmembrane domains, and a carboxy terminal domain2. MC1R is expressed primarily on melanocytes, where it plays a key role in the regulation of melanin pigmentation3. It is activated by the agonist α-melanocyte-stimulating hormone (α-MSH), thereby increasing intracellular cAMP levels via the activation of adenylyl cyclase. As a consequence, there is a switch in production from pheomelanin to eumelanin in melanocytes4. In contrast, the antagonist agouti-signaling protein (ASIP) depresses MC1R activation and promotes phaeomelanin production.

The role of MC1R mutations in coat pigmentation has been studied extensively in domestic and laboratory mammals and birds5. MC1R variants have been functionally characterized in several domestic species and, more recently, in beach mice6 and mammoths7. Several gain-of-function MC1R mutations result in increased eumelanin production in coats (e.g., in chicken, pig, and sheep8,9,10), whereas loss-of-function mutations result in increased pheomelanin production in skin and cause red hair in humans11,12 and white lizards at White Sands13. However, most studies have concentrated on the effects of MC1R within species, and little is known about divergence in MC1R function between closely related species.

Haitina et al. found that in contrast to humans, lemurs, and platyrrhines, MC1R of catarrhines displays strong functional conservation, including dose-dependent α-MSH binding and high basal activity14. In particular, MC1R of M. nemestrina shows dose-dependent α-MSH binding and the highest basal activity in the 9 phylogenetically diverse primate species14. In the genus Macaca, the functional diversity of MC1R is of interest because light–dark coat color variation is a prominent type of phenotypic diversity across species and populations. However, it is not clear whether the functional properties of MC1R are conserved in other Macaca species with prominent coat color variation. Nakayama et al. further detected 28 amino acid substitutions among 18 macaque species. They suggested that 7 amino acid substitutions at evolutionarily conserved sites might influence the function of MC1R in macaques distributed on Sulawesi Island (Sulawesi macaques)15. Notably, distinguished from most macaques, Sulawesi macaques display a conspicuous dark coat color, with variation in darkness and color pattern among species16. Generally, M. nigra, M. nigrescens, M. tonkeana and M. maurus are the species which the color variation is slight among the body parts. In these four species, M. maurus has a lighter color in all body parts. M. tonkeana has clearly defined pale brownish-gray to pale ochraceous-buff in cheek whisker. M. nigra is very dark in all body parts. M. nigrescens is lighter than M. nigra in the back. On the other hand, M. hecki and M. ochreata display wide variation of coat color in body parts. Both M. hecki and M. ochreata are very light in hind-shanks. M. hecki is slight light in the forearm, thigh, and cheek whisker. The back of M. ochreata is very dark, nearly as dark as M. nigra, but the forearm is very light16. In a relatively short period of time, Sulawesi macaques have diversified exponentially into six morphologically distinct species from a common ancestor with M. nemestrina17. The six species are distributed in allopatry on Sulawesi Island (Fig. 1). The evolutionary relationships among these species have been studied by hemoglobin18, RAD-seq19 and mitochondrial DNA analyses (mtDNA)20. Relative to M. nemestrina, an extant ancestor of Sulawesi macaques, darkening of the coat color is thought to have been necessary for the evolution of Sulawesi macaques on Sulawesi Island. Given the lack of predation pressures on Sulawesi macaques, the dark pelage was not likely to function as a form of camouflage; instead, it might be an adaptation to terrestrial living and contribute to thermoregulation16. However, the evolutionary processes and genetic basis of divergence in color are still unclear. In this study, to clarify how color variation was generated and maintained in Sulawesi macaques, we investigated MC1R diversity and its functional characteristics in vitro. We sequenced MC1R of about 10 individuals of each Sulawesi macaque species to evaluate sequence diversity. In addition, we pharmacologically characterized MC1R to examine the influence of genetic variation on biochemical function.

Figure 1
figure 1

Distribution of six allopatric Macaca species on Sulawesi island.

Full size image

Results

Genotyping and selection analysis

We determined the MC1R nucleotide sequences to investigate polymorphisms in six endemic Macaca species on Sulawesi Island. From 51 individuals, we identified 15 alleles based on combination of 26 single-nucleotide polymorphisms (SNPs) (Supplementary Table S1), including 10 previously reported nonsynonymous SNPs15 (Table 1). In particular, each species exhibited distinct fixed amino acids. All 10 nonsynonymous substitutions (P2R, P22L, M38V, G104S, H153P, M199L, C267Y, I293V, E304G, and R306C) were responsible for six species-specific haplotypes. Sulawesi macaques were separated into two clusters, one is the northern cluster, including M. nigra and M. nigrescens, the other one is the southern cluster, including M. hecki, M. tonkeana, M. maurus and M. ochreata (Fig. 2). Ancestral sequences of northern and southern cluster were constructed. Altogether, 9 of the 10 amino acid differences were species-specific, and one amino acid residue (site 38) distinguished M. nigra and M. nigrescens (northern cluster, 38 V) from the other four species (southern cluster, 38 M).

Table 1 Eleven non-synonymous substitutions in Sulwesi macaques and M. nemestrina.
Full size table
Figure 2
figure 2

Haplotype network for MC1R in Sulawesi macaques, M. nemestrina, M. fascularis, and M. mulattta. P. hamadryas was used as the outgroup. Each circle represents a distinct nucleotide haplotype. The size of a circle is proportional to the allele frequency. Each color represents a different species. Every mutation (nucleotide substitution) is shown as a 1-step edge. Line styles indicate the mutation type. Positions of non-synonymous substituions are indicated on the network branches.

Full size image

Each species showed specific nonsynonymous substitutions in a different part of MC1R. In M. hecki, all individuals shared two specific substitutions, C267Y and I293V, located in the third extracellular loop (EL3) and the seventh transmembrane region (TM7) of the receptor, respectively (Fig. 3). In M. nigra, the specific E304G substitution resulted in a change from a negatively charged residue to an uncharged residue in the C terminal domain of the receptor. In M. nigrescens, the P2R substitution resulted in a change from a nonpolar to positively charged residue in the N terminal region of the receptor. In M. tonkeana, the conservative substitution G104S resulted in a change from a nonpolar to polar residue in EL1. M. maurus possessed the most amino acid substitutions, including P22L, H153P, and M199L. SIFT (Sorting Intolerant From Tolerant; ≤ 0.05) and PROVEAN (Protein Variation Effect Analyzer; ≤  − 2.50) analyses consistently showed that five (G104S, H153P, C267Y, E304G, and R306C) of the substitutions occurred at evolutionarily conserved sites and may alter the functional characteristics of the MC1R receptor (Supplementary Table S2), consistent, in part, with previous results15.

Figure 3
figure 3

Schematic transmembrane topology for MC1R of Sulawesi macaques. Ten non-synonymous substitutions are shown. Each color represents a different species. The substitutions outlined in black are deleterious, as predicted by both SIFT and PROVEAN analyses.

Full size image

To detect positive selection in MC1R in Sulawesi macaques, we applied three models using the PAML package: a branch model, site model, and branch-site model. First, using a site model to investigate selection throughout the phylogeny based on RADseq data19, we did not detect sites under positive selection, details seeing in Supplementary Table S3. We further calculated ω values for the lineages with melanism (M. nigra and M. nigrescens), the other four Sulawesi macaques, and M. nemestrina and M. mulatta using a branch model to examine selective constraints on the black coat color lineage. The ω values for the melanism lineage (ω = 0.086) were significantly lower than those for other Sulawesi macaques (ω = 0.968) and the lineage including M. nemestrina and M. mulatta (ω = 0.856) (Supplementary Fig. S1). These results suggested that species with melanism underwent purifying selection. We further examined positively selected codon sites by a branch-site model. The null model was not rejected, and no positively selected sites were found.

Constitutive and α-MSH-induced cAMP production of MC1R variants

The positive control, MC1R of M. nemestrina, exhibited high basal activity and a dose-dependent response to the agonist α-MSH, consistent with the results of Haitina et al.14. The system was further used to evaluate basal cAMP production and agonist-induced cAMP activity by in vitro cAMP assays for all six species-specific MC1R variants of Sulawesi macaques. Except for M. maurus MC1R, basal cAMP levels were markedly lower in cells expressing all variants than in positive control cells expressing M. nemestrina MC1R (Fig. 4).

Figure 4
figure 4

Basal cAMP production of species-specific MC1R variants in Sulawesi macaques. Basal cAMP production was normalized to the maximum cAMP production under activation by 20 µM forskolin. M. nigra, M. ochreata, M. hecki, and M. tonkeana MC1R showed significantly lower basal cAMP production than levels for M. nemestrina and M. maurus (Pairwise t-test with BH correction, P < 0.05). M. nigrescens displayed intermediate basal cAMP production, significantly lower than that of M. nemestrina (Pairwise t-test with BH correction, P < 0.05).

Full size image

MC1R of M. maurus (ΔF/ΔFmax = 0.494 ± 0.028) exhibited comparable high basal cAMP production to that in cells expressing M. nemestrina MC1R (ΔF/ΔFmax = 0.543 ± 0.023). However, MC1R of M. hecki (ΔF/ΔFmax = 0.241 ± 0.020), M. ochreata (ΔF/ΔFmax = 0.204 ± 0.029), M. tonkeana (ΔF/ΔFmax = 0.140 ± 0.025), and M. nigra (ΔF/ΔFmax = 0.182 ± 0.025) exhibited low basal cAMP production, with significantly lower levels than those of cells expressing M. nemestrina and M. maurus MC1R (Table 2). We observed intermediate basal cAMP production in cells expressing M. nigrescens MC1R (ΔF/ΔFmax = 0.374 ± 0.026). These results showed that MC1R exhibits agonist-independent constitutive signaling in most Sulawesi macaques, which is stronger in M. nemestrina and M. maurus than in other Sulawesi macaques (pairwise t-test, P < 0.05, BH-adjusted; Supplementary Table S4).

Table 2 Summary of basal cAMP production and maximun cAMP production.
Full size table

Intracellular cAMP production under various concentrations of α-MSH is presented in Fig. 5. The responses of MC1R to agonist α-MSH differed substantially among species. α-MSH dose-dependently activated MC1R of all species, except for M. hecki MC1R. M. nigra MC1R showed a significantly lower maximal cAMP production than those for MC1R of other species (pairwise t-test, P < 0.05, BH-adjusted; Table 2). The EC50 values were similar for M. maurus (0.663 ± 0.339 nM) and M. nemestrina (0.709 ± 0.363 nM). The EC50 values for MC1R of M. nigrescens (0.968 ± 0.490 nM), M. ochreata (1.125 ± 0.477 nM), M. nigra (1.458 ± 0.803 nM) and M. tonkeana (1.886 ± 0.583 nM) were slightly higher than those of M. nemestrina MC1R (Table 2). Exceptionally, M. hecki MC1R showed cAMP accumulation with 100 nM α-MSH stimulation. Because saturation was not reached, we could not determine the EC50 values (Fig. 5c).

Figure 5
figure 5

Dose–response curve for MC1R of Sulawesi macaques and M. nemestrina. The response of (a) M. nemestrina, M. nigra and M. nigrescens), (b) M. tonkeana and M. maurus, (c) M. hecki, (d) M. ochreata. Each point represents the mean ± standard error of the mean (SEM) determined from at least three independent measurements.

Full size image

To determine the key residues affecting MC1R function, we designed several key mutants of MC1R based on SIFT and PROVEAN analyses. To understand the functional changes in both northern and southern clusters, we constructed vectors of the predicted ancestral northern (G304E mutant of M. nigra) and ancestral southern sequences (S104G mutant of M. tonkeana) and measured cAMP accumulation with/without α-MSH stimulation (Table 2). Both mutants, M. nigra_G304E (Supplementary Fig. S2a) and M. tonkeana_S104G (Supplementary Fig. S2b), showed higher constitutive activation than that of each wild-type protein and had similar sensitivity to α-MSH to that of M. nemestrina (EC50 = 0.485 ± 0.145 nM and 0.696 ± 0.304 nM, respectively). To evaluate the effects of key amino acids on MC1R function, we also tested the Y267C mutant of M. hecki MC1R (Supplementary Fig. S2c). As expected, M. hecki_Y267C MC1R (EC50 = 0.316 ± 0.180 nM) rescued the binding affinity to α-MSH, with significantly higher cAMP production and a left shift of the dose–response curve compared with those of wild-type M. hecki MC1R. Different from the above three mutants, the P153H mutant of M. maurus (EC50 = 1.164 ± 0.306 nM; Supplementary Fig. S2d) had significantly reduced basal cAMP production and a right shift of the dose–response curve compared with those of wild-type M. maurus. These results indicate that species-specific MC1R variants in the six species independently affect either basal activity or agonist-induced responses.

Discussion

We observed that the amino acid sequences of MC1R are conserved within each species (n = 10) and identified fixed species-specific amino acid substitutions in six closely related Macaca species. We further analyzed the functional features of MC1R itself and in response to the agonist α-MSH by a cAMP assay. We found that all six species-specific MC1R variants exhibited divergent basal activity and agonist-induced cAMP performance compared with those of the predicted ancestral sequences of the northern and southern clusters and M. nemestrina MC1R. And we identified the key residues responsible for MC1R function by site-directed mutagenesis.

We observed low nucleotide diversity in MC1R in each species of Sulawesi macaques, with an average of 0.067 × 10–2, which was similar to the estimate for human MC1R in African populations (π = 0.07 × 10−2)21 and three times lower than MC1R diversity in both M. nemestrina (π = 0.21 × 10−2) and M. fascicularis (π = 0.20 × 10−2; Supplemental Table S5). Our results suggested that the low MC1R diversity of M. nigra and M. nigrescens was a consequence of purifying selection for a dark coat color. Purifying selection on MC1R appears to be common in non-human primates22. Moreover, Nakayama and colleagues compared the nucleotide sequences of MC1R in 18 Macaca species and concluded that the gene was under purifying selection in the ancestral lineage of macaques and the silenus group15. In the present study, we verified that the amino acid sequence of MC1R is highly conserved in each Sulawesi macaque based on large population sizes and obtained additional functional information for each haplotype.

Numerous non-synonymous substitutions in MC1R have been identified in mammals. In humans, many loss-of-function variants are associated with red hair color23. Notably, the R151C, R160W, and D294H mutations in MC1R are strongly associated with pale skin and red hair in Eurasians. Opposite to the dark coat color in Sulawesi macaques, we found that basal activity levels of MC1R were dramatically diminished in M. hecki, M. ochreata, M. nigra, and M. tonkeana, resulting from C267Y, R306C, E304G, and G104S mutations, respectively. Exceptionally, M. maurus has the most ancestral coat color (brownish)16. Consistent with this observation, M. maurus MC1R displayed comparable basal activity and agonist-induced activity to those of M. nemestrina MC1R. The increase of constitutive activity in M. maurus can be explained by a change in the secondary structure by the H153P substitution in IL2. Accordingly, the five species-specific mutations (G104S, H153P, C267Y, E304G, and R306C) in Sulawesi macaques identified in the present study independently affected the basal activity of MC1R.

The most influential substitution was C267Y (M. hecki) with respect to agonist binding activity. C267 and C275 form disulfide bonds between TM6 and TM7 affecting the tertiary structure of the receptor24. Single point mutation of C267 to glycine results in a complete loss of NDP-MSH binding. However, the serine mutant retained some agonist binding ability, though weaker than that of the wild-type locus25. Similarly, we found that C267Y exhibited agonist-independent basal activity and a cAMP response to α-MSH with an extremely high threshold (> 100 nM). In humans, the plasma concentration of α-MSH is 21.30 ± 0.63 nM26. Our results suggested that the natural C267 mutant with the hydrophobic residue tyrosine in M. hecki retained low agonist-induced activation; however, activity might be constant under the low concentration of α-MSH in the body.

MC1R EL1 is small compared with most GPCRs and deletions of EL1 resides are associated with melanism in the gray squirrel27, jaguar, and jaguarundi28. In the present study, the G104S variant (M. tonkeana) exhibited decreased basal activity and a slight right-shift in agonist-induced activity. This variant has also been detected in gibbons22 and buffaloes29. Miao et al. speculated that the black coat color is associated with the allele carrying the G104S substitution29, but do they cause melanism is unclear. In silico functional prediction suggested that the G104S substitution is deleterious in buffaloes, and this was further supported by our functional results for the G104S variant in M. tonkeana. Our result suggests that G104S substitution could decrease MC1R activity and hence it is not likely to be causative for the melanism.

It is not clear how these species-specific substitutions in MC1R became fixed in Sulawesi macaques. MC1R acts as a genetic switch that determines whether dark eumelanin or light pheomelanin is produced for the regulation of coat color. Loss-of-function mutations usually lead to lighter, yellowish color, including in humans. In the present study, we found that most species-specific mutations resulted in reducing MC1R activity in vitro. Based on M. nemestrina as the extant ancestor, the predicted ancestral haplotypes of southern and northern clusters showed significantly reduced basal activity, with further reductions occurring independently in M. nigra, M. tonkeana, M. hecki, and M. ochreata (Supplementary Fig. S1). The basal activity and agonist-induced activity evolved independently in each Macaca species on Sulawesi Island, consistent with results for lemurs and platyrrhines14. Haitina et al. suggested catarrhine primates displayed conservation of dose-dependent α-MSH binding and activation, with variation in basal activity. However, we found that C267Y in M. hecki almost led to loss of α-MSH-induced cAMP production. The changes in MC1R function caused by these novel mutations are not simply limited to melanism in coat color in Sulawesi macaques, consistent with the results of Haitina et al.14 and Nakayama et al.15. For example, we did not investigate the promoter region of MC1R or the sequences and expression levels of other pigmentation-related genes (e.g., POMC (proopiomelanocortin) and TYR (Tyrosinase)). Increased levels of α-MSH might lead to increased melanin production in the island population30. The limit of in vitro heterologous expression system using HEK293 cells might be one of the causes for the discrepancy between the protein molecular properties and pigmentation phenotypes in the monkeys. There might be a systematic difference in transfection efficiency, protein localization, dimerization, and internalization in vitro assay system with transient transfection. Further explorations of the expression levels and regulatory regions of MC1R and other pigmentation-related genes in vivo are needed to explain coat color divergence in the Sulawesi macaques.

Sulawesi macaques differ in patterns of unmelanized or light part on the forearm, cheek, upper arm, thighs and hind-shanks. In rhesus macaques, Bradley et al. did not find significant differences in the patterns of gene expression in comparing dark, intermediate and light hair31. Their results suggested the coat color variation from light to dark in rhesus macaques was unlikely to be due to differences in expression levels of key pigmentation genes; MITF (Melanocyte Inducing Transcription Factor), MC1R, MGRN1 (Mahogunin Ring Finger 1), ATRN (Attractin), SLC24A5 (Solute Carrier Family 24), TYRP1(Tyrosinase-related Protein 1) and DCT (Dopachrome-tautomerase)31. Hence, the expression of MC1R might be not causative to fine tuning of pattern difference in the case for Sulawesi macaques. ASIP gene plays a key developmental role in color patterning. Spatio-temporal regulation of ASIP can further modify MC1R activity. Mundy and Kelly suggested that mutations in ASIP coding region were not involved in color changes among closely related primate species32. Allele-specific expression of ASIP in body part has been found to be responsible for color pattern differences in mice33. We speculate that expression and regulatory differences at ASIP might play an important role in pattern variation in Sulawesi macaques. A protein expression analysis would further improve our understanding of variation among species and body parts.

Sulawesi macaques are morphologically differentiated, though individuals with intermediate traits, presumably hybrids, have been reported in the border zone of each species’ distribution34,35,36,37. Gene flow between Sulawesi macaque species has presumed from the intermediate morphological characteristics38. The possibility of gene flow in a hybrid zone is also supported by an analysis of microsatellite markers39. Previous genetic analyses of hemoglobin18 and TAS2R3840 identified shared common haplotypes among Sulawesi macaques; however, we found that MC1R shows species-specific variants, without shared haplotypes. Divergence in MC1R was the greatest between M. maurus and M. nigra, suggesting a high correlation with geographical distance. While the relationship between the protein sequence and coat color phenotype is still unclear, MC1R could be a species-specific marker gene for Sulawesi macaques. In addition to the apparent change-of-function MC1R variants for cAMP production in Sulawesi macaques, MC1R may have other important functions that are unique to each species.

Methods

Study subjects

Six endemic species in the genus Macaca on Sulawesi Island, Indonesia were evaluated, M. tonkeana, M. hecki, M. nigrescens, M. nigra, M. maurus, and M. ochreata. Although some studies have suggested that M. ochreata can be separated into two species, M. ochreata and M. brunnescens, we treat these species as a subspecies of M. ochreata according to the IUCN Red List41. Saliva samples were obtained from 51 captive animals (Supplementary Table S1) collected for a previous study40. The saliva was scrubbed with cotton swabs and samples were stored in 2 mL tubes with 1 mL of lysis buffer consisting of 0.5% sodium dodecyl sulfate, 100 mM ethylenediaminetetraacetic acid, 100 mM Tris–HCl, and 10 mM NaCl at room temperature42. This collection method was approved by the Animal Ethics Commission of the Research and Community Service Institute, Ministry of Research, Technology and Higher Education, Bogor Agricultural University (Permission number no. 35-2016 IPB).

Genotyping of MC1R

MC1R orthologues in M. mulatta, M. nemestrina, and M. fascicularis were sequenced for comparison. Genomic DNAs of Sulawesi macaques and an individual of M. mulatta were extracted from buccal swabs of monkeys using the QIAamp DNA Investigator Kit (Qiagen GmbH, Hilden, Germany). Genomic DNAs of M. nemestrina (N = 10) and M. fascicularis (N = 7) were extracted from blood samples using the DNeasy Blood and Tissue Kit (Qiagen)40.

To amplify and sequence the entire coding region of the MC1R gene, primers (MC1R-F: 5′ ATGAGCTAAGCAGGACACC 3′; MC1R-R: 5′ CAACACCTTCAGAGGTCAGT 3′) were designed using the Primer3Plus website (website: http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). MC1R was amplified using ExTaq DNA Polymerase (Takara Bio Inc., Shiga, Japan) by PCR under the following conditions: initial denaturation at 94 °C for 10 min, 45 cycles of denaturation at 94 °C for 10 s, annealing at 56 °C for 30 s, and extension at 72 °C for 1 min, followed by a final extension at 72 °C for 10 min. PCR products were sequenced using BigDye Terminator v. 3.1 (Applied Biosystems, Carlsbad, CA) and the sequencing products were separated by capillary electrophoresis using a 3130xl Genetic Analyzer (Applied Biosystems).

Reconstruction of MC1R haplotypes and selection analysis

Sequences of intact MC1R of all the samples were aligned using MEGA X. A maximum-likelihood (ML) of the six species was reconstructed with 1000 bootstrap replicates. The ancestral amino acid sequences of each clusters were inferred using ML-based ancestral reconstruction in MEGA X. Multisite haplotypes were reconstructed from sequence data using DnaSP v. 6.12.0343. The genealogical relationships among haplotypes were constructed, rooted with the MC1R sequence of Papio hamadryas (Accession number AY205105.1), using the median-joining algorithm implemented in PopART44. To test for a signal of selection in the partial MC1R gene or lineage, we used the CODEML program in PAML 445. The ratio ω (d N/d S) is a measure of selective pressure, where ω = 1, ω < 1 and ω > 1 correspond to neutral evolution, purifying and positive selection, respectively. Three models, branch, site and branch-site models were used to analyze the selection of MC1R in Sulawesi macaques. The phylogenetic tree was referred to RADseq data in Evans et al.19. Firstly, we used site models (M0: null, M1: nearly neutral selection, M2: positive selection, M3: discrete, M7: beta, and M8: beta and ω > 1) to determine candidates of positively selected sites. Model fit was evaluated using likelihood ratio tests (LRT). Subsequently, to test whether the ω ratio was different among lineages, the melanism lineage (M. nigra and M. nigrescens), the other four species (M. hecki, M. tonkeana, M. maurus, M. ochreata) and the reference branch (M. nemestrina and M. mulatta) were set up and tested by branch model. Additionally, branch-site model was tested to determine whether positive selection occurred on a few sites in a small number of lineages. The Bayes empirical Bayes (BEB) analysis was applied to calculate posterior probabilities of positively selected sites.

Expression vector construction and site-directed mutagenesis

The entire coding region of MC1R was amplified from genomic DNA of M. hecki, M. nigra, M. tonkeana, M. maurus, and M. ochreata and the MC1R gene fragment tagged with a 27 bp Flag-tag at the N-terminal end was inserted into the pcDNA3.3 mammalian expression vector using the pcDNA™3.3-TOPO™ TA Cloning™ Kit (Invitrogen, Carlsbad, CA). The insertion and orientation of the fragment were confirmed by direct sequencing. The vectors for M. nigrescens and M. nemestrina A (38V) were generated from the wild-type M. nigra sequence by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). To identify the key amino acid substitutions, we predicted the functional effect of single amino acid substitutions using the SIFT and PROVEAN algorithms in the PROVEAN web server46. The site-directed mutations in pcDNA3.3 vectors were also generated using the QuikChange Lightning Site-Directed Mutagenesis Kit.

Cell culture

Human embryonic kidney 293T (HEK293T) cells were provided by Dr. Matsunami (Duke University) via Dr. Misaka (The University of Tokyo) for the functional analysis. Cells were cultivated in a 5% CO2 incubator at 37 °C with Dulbecco’s modified Eagle’s medium (Fujifilm Wako Pure Chemical Corporation, Osaka, Japan) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific).

cAMP assay using cultured cells

A cAMP assay was used to evaluate the constitutive activity and α-MSH agonist-induced activity of MC1R variants. In vitro experiments were performed in accordance with the guidelines of Kyoto University. The protocol was approved by the Genetic Research Committee of the Agency for Health, Safety and Environment, Kyoto University to H.I. (no. 151031 and 200101). The constructed MC1R vector was transiently transfected into HEK293T cells using Lipofectamine 2000 (Life Technologies, Inc., Carlsbad, CA). The M. nemestrina (38V) MC1R expression vector was adopted as a positive control and the empty pcDNA3.3 vector was defined as the mock control. Transfections were performed in 96-well plates when cells reached 70–80% confluence. Transfection mixtures were prepared using 1 ng of MC1R vector, 0.3 μL of Lipofectamine 2000, and 10 μL of Opti-MEM per well. The transfection mixtures were preincubated for 20 min at room temperature before their addition to plates. Then, the plates were incubated at 37 °C under 5% CO2 for 24 h. The cAMP assays were performed using the cAMP-Gs Dynamic Kit (Cisbio, Codolet, France). Briefly, on the day of the cAMP assay, α-MSH was diluted with Stimulation Buffer 1 to obtain a final concentration range of 10−12 to 10−7 M. Then, 7500 cells were added to each well of a white-walled 384-well plate and stimulated with different concentrations of α-MSH (Sigma-Aldrich, St. Louis, MO) for 30 min at room temperature. The cells were also stimulated with 20 µM forskolin (final concentration 10 µM; Cisbio) to normalize for cell numbers47. Following the protocol for the cAMP Dynamic Kit, fluorescence signals at 665 and 620 nm were detected using the FlexStation 3 Microplate Reader (Molecular Devices Japan, Inc., Tokyo, Japan). Values are expressed as ΔF (using ratios of 665 nm/620 nm for the assay and 665 nm/620 nm for the mock). Data are expressed as ΔF/ΔFmax48, which is the ratio of the ligand-dependent increase (ΔF) to the maximal production of cAMP under activation by 20 µM forskolin (ΔFmax). ΔF/ΔFmax values were fitted by the function f(x) = min + (max − min)/(1 + (x/EC50)h)), where x is the ligand concentration and h is the Hill coefficient, using the drc package in R49. At least three independent measurements were conducted for each vector. Data are reported as mean values ± standard error of the mean (SEM).