Abstract
Cigarette smoking greatly promotes the progression of kidney renal clear cell carcinoma (KIRC), however, the underlying molecular events has not been fully established. In this study, RCC cells were exposed to the tobacco specific nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK, nicotine-derived nitrosamine) for 120 days (40 passages), and then the soft agar colony formation, wound healing and transwell assays were used to explore characteristics of RCC cells. RNA-seq was used to explore differentially expressed genes. We found that NNK promoted RCC cell growth and migration in a dose-dependent manner, and RNA-seq explored 14 differentially expressed genes. In TCGA-KIRC cohort, Lasso regression and multivariate COX regression models screened and constructed a five-gene signature containing ANKRD1, CYB5A, ECHDC3, MT1E, and AKT1S1. This novel gene signature significantly associated with TNM stage, invasion depth, metastasis, and tumor grade. Moreover, when compared with individual genes, the gene signature contained a higher hazard ratio and therefore had a more powerful value for the prognosis of KIRC. A nomogram was also developed based on clinical features and the gene signature, which showed good application. Finally, AKT1S1, the most crucial component of the gene signature, was significantly induced after NNK exposure and its related AKT/mTOR signaling pathway was dramatically activated. Our findings supported that NNK exposure would promote the KIRC progression, and the novel cigarette smoke-related five-gene signature might serve as a highly efficient biomarker to identify progression of KIRC patients, AKT1S1 might play an important role in cigarette smoke exposure-induced KIRC progression.
Similar content being viewed by others
Introduction
Kidney and renal pelvis cancer is among the top ten most common cancers in the world, with 65,340 new cases and 14,970 deaths in 2018 in United States1. Renal cell carcinoma (RCC) accounts for ~ 85% of all renal malignancies, and kidney renal clear cell carcinoma (KIRC) arising from the proximal convoluted tubule is the most common and malignant histological subtype and responsible for most of deaths among all the subtypes of RCC2.
The link between cigarette smoking and RCC has been well-established. Active smoking is associated with histological RCC subtype, especially with KIRC3,4. The relative risk of KIRC is not only higher in smokers as compared to non-smokers, but also increased with the cumulative dose and duration of smoking5,6. Moreover, cigarette smoking has an ongoing effect on the progression of KIRC. Studies have validated that tobacco exposure is positively associated with aggressive clinical parameters of KIRC and decreases the cancer-specific survival and overall survival of KIRC patients7,8. However, the underlying molecular events of cigarette smoking on KIRC progression needed a further study.
Cigarette smoke contains numerous mutagens and carcinogens, such as nicotine, nitrosamines, polycyclic aromatic hydrocarbons, aromatic amines, and volatile organic compounds9. Nicotine is a major agent in cigarette smoke, but the carcinogenic effect of nicotine is intensified by converting to nicotine-derived nitrosamines10. 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), the major ingredient and the most potent carcinogen among nicotine-derived nitrosamines, has reported to have relatively high levels in cigarette smoke and the smokers11,12,13,14. In this study, NNK was used to stimulate the RCC cells, and then the RNA-seq was performed in the KIRC cell line to identify the hub genes closely associated with NNK-induced malignancy. Next, the key candidate biomarkers were identified in the KIRC cohort of The Cancer Genome Atlas (TCGA) data. Thereafter, the gene signature was also constructed and its relationship some clinical traits and overall survival of KIRC patients was confirmed. Our work yielded a novel gene signature which was associated with tobacco smoke exposure and can accurately predict its relationship with KIRC progression.
Results
NNK exposure increased growth and migration abilities of RCC cells
The human RCC cell lines 786-O and KETR-3 were continuously exposed to 0.1% DMSO and NNK (0.01 and 0.1 μM) for 120 days (40 passages). Then the results of soft agar colony formation assay revealed that the number of cell colonies had a significant dose-dependent increase after NNK exposure when compared with the 0.1% DMSO control group (Fig. 1A and B). The wound healing assay was performed and showed that long-term NNK exposure significantly promoted KETR-3 and 786-O cell migration ability (Fig. 1C–F). The cell transwell assay also was performed and observed that the number of cell migration was significantly increased in a dose-dependent manner after long-term NNK exposure in both KETR-3 and 786-O cells when compared with the respective 0.1% DMSO controls (Fig. 1G and H).
Identification of cigarette smoke exposure-related genes in RCC cells
We performed the RNA-seq in 0.1% DMSO, 0.01 μM, 0.1 μM NNK treated 786-O cells to explore the potential molecular mechanism in NNK-induced malignancy of RCC cells. The volcano plot identified 389 differentially expressed genes (163 up-regulated and 226 down-regulated genes) in 0.01 μM NNK-exposed group (Supplementary Table S1) and 418 differentially expressed genes (168 up-regulated and 250 down-regulated genes) in 0.1 μM NNK-exposed group (Supplementary Table S2) when compared with 0.1% DMSO group using the criteria of |log2(FC)|≥ 0.585 (Fig. 2A). Among all the differentially expressed genes, we found that eleven genes ANGPTL4, ANKRD12, CYB5A, DCN, ECHDC3, HOXC10, MAGEB2, MT1E, TGM2, TICAM2, ZNF579, and three genes AKT1S1, MAPK14, TEN1 were down-regulated or up-regulated in a NNK dose-dependent way with a cutoff criteria of |log2(FC)|≥ 1 and |log2(FC)(0.1 μM NNK vs. 0.1% DMSO)-log2(FC)(0.01 μM NNK vs. 0.1% DMSO)|≥ 0.1 (Fig. 2B). Real time PCR assay was used to validate the findings of RNA-seq in 786-O cells, our data showed that seven genes ANGPTL4, ANKRD12, CYB5A, ECHDC3, HOXC10, TICAM2 and ZNF579 were significantly down-regulated while AKT1S1 was significantly up-regulated after 0.1 μM NNK stimulation; in addition, two genes MAGEB2 and MT1E were marginally down-regulated in a after NNK exposure (Fig. 2C).
Expression of fourteen cigarette smoke exposure-related genes in KIRC and normal kidney tissues in TCGA-KIRC dataset
To explore the roles of these fourteen genes in KIRC, we evaluated their expression patterns in TCGA-KIRC cohort. As shown in Fig. 3, we found that three cigarette smoke exposure-reduced genes DCN, ECHDC3, MT1E and two cigarette smoke exposure-induced genes AKT1S1, TEN1 were significantly down-regulated and up-regulated in KIRC when compared with the kidney normal tissues, respectively. Studies have reported that active smoking is associated with histological KIRC subtype3,4. Here we found that ECHDC3 expression in KIRC was continuously reduced, while AKT1S1 expression was gradually increased with the elevated malignancy of pathological grades (Supplementary Fig. S1). However, four cigarette smoke exposure-reduced genes ANGPTL4, TGM2, TICAM2, ZNF579, and one cigarette smoke exposure-promoted gene MAPK14 were significantly up-regulated and down-regulated in KIRC when compared with the kidney normal tissues, respectively (Fig. 3). Furthermore, TGM2 and TICAM2 expression in KIRC were gradually increased while MAPK14 expression was gradually decreased with the elevated malignancy of pathological grades (Supplementary Fig. S1). In addition, MAGEB2 had very low expression levels in KIRC and kidney normal tissues.
Prognostic value of individual cigarette smoke exposure-related gene in TCGA-KIRC cohort
Considering the opposite expression patterns in RNA-seq of NNK-stimulated cells and TCGA dataset and low gene expression of MAGEB2 in tissues, subsequently, eight cigarette smoke exposure-related genes ANKRD12, CYB5A, DCN, ECHDC3, HOXC10, MT1E, AKT1S1, TEN1 were selected to determine their prognostic value in TCGA-KIRC cohort. Each gene was classified as low or high expression based on defined cutoff (< or ≥ median of gene expression in cancer tissues). The Kaplan–Meier curves and univariate COX proportional regression models showed that ANKRD12 (HR (95%CI): 0.64 (0.47–0.87)), CYB5A (HR (95%CI): 0.59 (0.43–0.80)), ECHDC3 (HR (95%CI): 0.45 (0.33–0.62)), and HOXC10 (HR (95%CI): 0.64 (0.47–0.87)) had significantly positive while DCN (HR (95%CI): 1.39 (1.03–1.88)) and AKT1S1 (HR (95%CI): 1.98 (1.45–2.71)) had significantly negative relationship with overall survival of KIRC patients (Fig. 4).
Construction and prognostic value of cigarette smoke exposure-related gene signature in TCGA-KIRC cohort
Individual KIRC tissue recently has been identified to have the substantial intratumour heterogeneity, demonstrating that single gene are unlikely to reveal a complete status of KIRC progression15. In addition, studies have found that the gene signature will be better than a single gene to judge prognosis of a variety of tumors16,17,18. Therefore, a single gene was not sufficiently comprehensive and efficient to evaluate the contribution of cigarette smoking to KIRC progression, in this study, the cigarette smoke exposure-related gene signature was produced through integrating multiple candidate genes. Lasso regression analysis was firstly used to avoid over-fitting problems in the gene signature, and five cigarette smoke exposure-related candidate genes ANKRD12, CYB5A, ECHDC3, MT1E, and AKT1S1 were retained when the optimal λ value was achieved (Supplementary Fig. S2A and B). Finally, a cigarette smoke exposure-related five-gene signature was established using the multivariate COX regression model and was digitized into a risk score based on the sum of the product of risk coefficient of each gene and the relevant mRNA expression level (Table 1).
We examined the correlation of the risk score with patients’ clinicopathlogical characteritics, and found that the risk score was significantly higher in advanced TNM stage (III/IV), invasion depth T3/4, lymphatic node metastasis N1, distant metastasis M1 and low pathological grade groups (G3/G4) when compared with early TNM (I/II), T1/2, N0, M0 and high pathological grade groups (G1/G2) (Fig. 5A). The time-dependent ROC curve was used to identify predictive value for KIRC patients’ survival and revealed that the risk score had a larger area under the curve (AUC) than individual genes (Fig. 5B).
Next, patients were classified to low-risk or high-risk group based on the median threshold of the risk score to further explore the prognostic value of the risk score in KIRC (Supplementary Fig. S2C). We found that the number of deaths was significantly much more in the high-risk group than the low-risk group, and survival time of the death sample significantly decreased with the decreasing risk score (Supplementary Fig. S2D). The Kaplan–Meier curve showed that the survival time of patients with high-risk score was significantly shorter than the time of patients with lower-risk score (HR = 2.12, 95%CI: 1.54–2.90) (Fig. 5C). In addition, patients with high-risk score was a significantly adverse prognostic indicator in both early and advanced TNM stages (Supplementary Fig. S3). Multivariate analysis showed that the risk score was an independent prognostic indicator (HR = 1.7, 95%CI: 1.25–2.30) after adjusting with age, sex, tumor TNM stage and grade (Fig. 5D).
Nomogram construction and validation
Based on the multivariate COX proportional regression model (Fig. 5D), the prognostic nomogram was constructed to quantitatively predict the individualized prognostic risk for 1-, 3-, and 5-year overall survival by integrating cigarette smoke exposure-related gene signature risk scores with baseline variables (age and gender) and other independent clinical variables (grade and TNM stage). Each variable was assigned a corresponding point value based on its risk contribution to this model (Fig. 6A). Finally, the calibration curves suggested the agreement between the actual and predicted overall survival. The calibration curve showed that the 1-, 3-, and 5-year overall survival predicted by the nomograms were consistent with actual observations (Fig. 6B–D), indicating that the nomograms performed well.
NNK exposure promoted AKT1S1 expression and activated AKT/mTOR signaling pathways
In this study, we found that AKT1S1 played as the most important component in the cigarette smoke exposure-related gene signature; and studies have showed that AKT1S1 acts an critical role in the intersection of the AKT/mTOR signaling pathways19, therefore, we explored AKT1S1 expression level in Ketr-3 and 786-O cells exposed to 0.1% DMSO and 0.01, 0.1 μM NNK. We found that NNK exposure dramatically up-regulated mRNA levels of AKT1S1 (Fig. 7A), and AKT1S1, p-AKT, p-mTOR protein levels had significant increase after NNK exposure when compared with the 0.1% DMSO control group (Fig. 7B–C). In addition, in order to detect the function and pathways of AKT1S1 in NNK-promoted KIRC progression, we constructed the protein interaction network (PPI network) with the String database (https://string-db.org/) (Supplementary Fig. S4). The results of showed that AKT1S1 was enriched in mTOR signaling pathway with the lowest false discovery rate value in the biological process of Gene Ontology (GO) analysis, and in autophagy pathway with the lowest false discovery rate value in the KEGG analysis.
Discussion
It’s well-known that tumor cells infinite growth and metastasis are the crucial characters of tumor malignant progression20. Epidemiological data have indicated that cigarette smoking is associated with the tumor malignant progression and the poor prognosis of KIRC21,22. In this study, we found that long-term exposure to the major component of cigarette smoke, nicotine-derived NNK, increased the abilities of RCC cells colony formation and migration, which were key events of tumor growth and metastasis. Based on these findings, it was not surprising to see that cigarette smoke enhanced the malignant phenotypes of tumor cells to eventually promote KIRC progression.
There are multiple molecular events that cigarette smoke initiates and promotes the malignancy of RCC. Recently the relevance of cigarette smoke carcinogens with the inactivation of tumor suppressor genes or the activation of oncogenes has been validated for the development and progression of cancer23,24. Thus, further exploration of the molecular events involved in NNK-induced malignancy of RCC cells might provide new biomarkers for progression of KIRC. Here, we performed the genome-wide sequencing to seek potential biomarkers and found fourteen cigarette smoke exposure-related genes showing NNK dose-dependent down-regulation or up-regulation. Moreover, the real time PCR validated the reliability of RNA-seq.
Therefore, we reasonably speculated that cigarette smoke exposure-related genes have broad prospects in progression evaluation of KIRC. Through compared the gene expression patterns in KIRC and normal kidney tissues, we found nine genes were not inconsistent with the findings in RCC cells with NNK exposure. Next, the survival analysis indicated that cigarette smoke exposure-reduced genes ANKRD12, CYB5A, ECHDC3, DCN, HOXC10 and cigarette smoke exposure-promoted gene AKT1S1 showed the positive and negative relationship with overall survival in KIRC, which was accord with some studies that decreased ANKRD12 and CYB5A and increased AKT1S1 expression show a higher frequency of tumor metastasis and are indicators of increased risk of tumor progression25,26,27. Though cigarette smoke exposure-reduced DCN was found to be negative prognostic factor in KIRC, increasing evidences indicate that lack of DCN expression has been regarded as an indicator of tumor metastasis28.
However, cancer heterogeneity leads to unsatisfactory effects of individual genes on the progression judgment in KIRC patients. Therefore, new efforts are urgently required to develop comprehensive estimate for KIRC. Studies have found that the gene signature will be better than a single gene to judge prognosis of a variety of tumors16,17,18. In this study, Lasso regression was used to screen variables to establish the prognostic model to avoid extreme prediction. The new cigarette smoke-related five-gene signature was established using the multivariate COX regression model. To provide a clinically quantitative method for gene signature, we produced a risk score based on risk coefficient of each gene and the relevant mRNA expression level. This scoring approach and its cut-off value have been confirmed to be robust in some cancer-related studies, which may be readily translated to clinical practice29,30,31.
Our data showed that the gene signature with high-risk score was significantly associated with the increased tumor invasion depth, lymphatic node metastasis, and distant metastasis and advanced TNM stage. Using the time-dependent ROC curve, we found that the risk score had a better predictive value than individual genes in KIRC prognosis. More importantly, the risk score significantly stratified patient outcomes and high-risk score was a significantly more unfavorable factor for KIRC prognosis than any single gene, indicating that the risk score had a stronger prognostic power than single genes.
Considering that AKT1S1 was the most important component of the cigarette smoke exposure-related gene signature, here significantly up-regulated AKT1S1 expression was observed after NNK exposure, which was accord with some reports that elevated AKT1S1 expression in cancer cells and could contribute to tumor metastasis27,32. Studies have showed that AKT1S1 is involve in regulating cell growth, cell apoptosis, oxidative stress, autophagy and angiogenesis through various of signaling pathways such as AKT, mTOR, NF-κB and et al.; AKT1S1 phosphorylation state could predict hyperactivation of the AKT/mTOR pathway in multiple cancer cell types19,33. In this study, we found that NNK exposure activated AKT/mTOR signaling pathway. And the protein interaction network (PPI network) showed that the function and pathways of AKT1S1 were mainly enriched in mTOR and autophagy pathway. In addition, studies have identified AKT/mTOR signaling as important dysregulated pathways in KIRC, and some mTOR targeted inhibitors, such as everolimus and temsirolimus, have been validated to contribute to better clinical outcome of metastatic renal cell carcinoma34,35,36. Therefore, our data suggested that the up-regulation of AKT1S1, AKT/mTOR signaling pathway and autophagy might play an important role in cigarette smoke-induced KIRC metastasis and progression (Supplementary Fig. S5).
In summary, NNK exposure promoted the growth and migration abilities of RCC cells. Using RNA-seq, fourteen cigarette smoke exposure-related genes were obtained. The expression patterns showed that nine genes in KIRC when compared with normal kidney tissues were not inconsistent with the findings in RCC cells with NNK exposure, and their prognostic value were further analyzed. Five cigarette smoke-related gene signature was screened and integrated by Lasso regression analysis and multivariate COX regression model. The gene signature was more powerful than any signal gene for predicting the prognosis of KIRC patients. Moreover, NNK exposure-induced AKT1S1 and its related AKT/mTOR signaling pathway might play an important role in cigarette smoking-induced KIRC progression. Therefore, our findings provided a significant mechanistic insight into cigarette smoke-induced KIRC progression and supported that the cigarette smoke-related gene signature might serve as a highly efficient biomarker to identify metastasis and prognosis of KIRC patients.
However, a limitation is the lack of animal models of NNK-promoted KIRC progression and the validation of gene signature expression in NNK-promoted tumor tissues of animal models. In addition, this study is underpowered to assess the role of AKT1S1 and its related AKT/mTOR signaling pathway in NNK exposure-induced KIRC progression unless AKT1S1 inhibitors were used in NNK-stimulated cell and animal models.
Methods
Cell lines and reagent
Human KIRC cell line 786-O and another RCC cell line KETR-3 were purchased from the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). 786-O and KETR-3 cells were separately cultured in RPMI-1640 and DMEM medium supplemented with 10% fetal bovine serum (FBS), 100U/ml penicillin and 100 μg/ml streptomycin. Cells were grown at 37 °C in the presence of 5% CO2 in a humidified incubator. NNK was purchased from Sigma-Aldrich (CAS: 64091-91-4, St Louis, MO,).
Soft agar colony formation assay
The 6-well plates were firstly coated with 0.60% agarose. Then 500 cells per well were plated in triplicate in 1 ml of 0.35% agarose over 0.60% agarose. Cultures were fed every 3 days. At 14 days, the 0.5% NBT was used to dye the colonies. Colonies which were dyed strongly brown were scored as “positive” and colony-forming number in each well was counted by Image J software.
Wound healing assay
Cells were grown to 80% confluence into a 6-well plate in complete medium overnight and converted to serum-free medium for another 12 h at 37 °C and 5% CO2. An injury line was made using a 2-mm-wide plastic pipette tip. Then the wells were rinsed with phosphate-buffered saline and covered with serum-free medium, and the photographs were acquired at 0 h and 24 h, respectively. Then the scratch width of every group at 0 h and 24 h were measured, and migration distance was calculated through subtracting the scratch width at 24 h from the scratch width of 0 h. Finally the relative ratio of migrating distance in NNK groups and DMSO group was calculated.
Transwell assay
The transwell filter inserts with a pore size of 8 μm were used for the cell migration assay. 2 × 104 cells (for 786-O) or 5 × 104 cells (for KETR-3) in serum-free medium were added in the upper chamber, and placed in 24-well plate containing 500 μl complete medium. After 12 h incubation at 37 °C, cells in the upper chamber were carefully removed with a cotton swab and the cells that had traversed the membrane were fixed in methanol, stained with crystal violet (0.04% in water; 100 μl). Then these inserts were placed under the inverted microscope (100 ×), and five fields of each insert were photographed. The crystal violet positive permeating cells of each field were counted by Image J software, and the relative ratio of migrating cells number in NNK groups and DMSO group was calculated.
Transcriptome resequencing and quantitative analysis
Human transcriptome resequencing (Vazyme, China) was used to analyze gene expressions collected from 786-O cells which were exposed 0.1%DMSO, 0.01 μM, 0.1 μM NNK at 40 passages for 120 days. The Cufflinks (cufflinks-2.2.1) was used to perform the quantitative analysis of gene expression.
Western blot analysis
Western blot was carried out as previously reported37. Total cell lysates were prepared with a detergent lysis buffer (#P0013B, Beyotime Biotechnology, China) and the protein concentration was measured with BCA Protein Assay Kit (#P0010, Beyotime Biotechnology, China). Equal amounts of protein from cell lysates were separated by SDS-PAGE, and transferred by electroblotting to a polyvinylidene fluoride membrane. After blocked with 5% nonfat milk in TBST buffer for 2 h, the membranes were cut according to the molecular weight of the antibody specification and the PageRuler™ Prestained Protein Ladder (#26616, Thermo Scientific, USA) on the membrane, then the membranes were incubated with primary antibodies, including anti-AKT1S1 (1:1000; #ab151719, Abcam, USA), anti-AKT (1:1000; #9272, CST, USA), anti-pAKT (1:1000; #4060, CST, USA), anti-mTOR (1:1000; #2972, CST, USA), anti-p-mTOR (1:1000; #5536, CST, USA) and anti-GAPDH (1:1000; #AF1186, Beyotime Biotechnology, China) overnight at 4 °C. Then, the membrane was incubated with anti-rabbit immunoglobulin G conjugated to horseradish peroxidase (1:2000; #A0208, Beyotime Biotechnology, China) for 2 h. The anti-GAPDH was used for the protein loading control. The antigen–antibody complex was detected by an enhanced chemiluminescence system. All the blots were cut prior to hybridization with antibodies during blotting. Moreover, we checked these same molecules in 786-O, Ketr-3 and ACHN cells, and the results showed that the same molecule was displayed at the same location on the membrane and all the molecular weights were consistent with the antibody specifications. In addition, there were few or almost no non-specific bands in all blots. In the supplementary Fig. S6, we provided the images of all blots as they are, with membrane edges visible, all the experiments were repeated three times.
Real-time PCR analysis
Total cell RNA was extracted using TRIzol reagent (#R401-01, Vazyme, China) and the purity was checked by OD260/280 of RNA samples (> 1.8). Real-time PCR was carried out in triplicate with HiScript II one step qRT-PCR SYBR Green Kit (#Q221-01, Vazyme, China) according to the manufactory instruction. GAPDH mRNA was used as an internal control for each sample, and the Ct value for each sample was normalized to GAPDH mRNA. The complementary DNA was amplified with the following primers:
DCN Forward | TCCGCTGTCAATGCCATCTTCG |
DCN Reverse | GCAGGTCTAGCAGAGTTGTGTCAG |
HOXC10 Forward | CCGCCTATCGCCTGGAACAAC |
HOXC10 Reverse | GCAGCAGACATTCTCCTCCTTGAC |
AKT1S1 Forward | GCCGTTGCCTCCACGACATC |
AKT1S1 Reverse | TCATCCTCGTCCTCCTCGTTGTC |
MAPK14 Forward | GGCTCCTGAGATCATGCTGAACTG |
MAPK14 Reverse | AGTCAACAGCTCGGCCATTATGC |
ZNF579 Forward | AAGGCCGAGCAGGAGGAAGAAG |
ZNF579 Reverse | AGGCTGAGTGGTCTTGGCTGTC |
TICAM2 Forward | TCCTGCCCTCTTTCTCTCTCTTGG |
TICAM2 Reverse | CCCCTCTGTTGTATTGCTGTGCTC |
TGM2 Forward | CACCAACAACACCGCTGAGGAG |
TGM2 Reverse | CAGGTTGAGGTTGAGCAGGTACTTG |
MAGEB2 Forward | AACGGCCACACTTACACCTTCATC |
MAGEB2 Reverse | ATCACACCCAGGAGAGGCATCAG |
ANGPTL4 Forward | AGACACAACTCAAGGCTCAGAACAG |
ANGPTL4 Reverse | TCTAGGTGCTTGTGGTCCAGGAG |
CYB5A Forward | TCAGAAGCACAACCACAGCAAGAG |
CYB5A Reverse | AGTTCTCAGTAGCGTCACCTCCAG |
TEN1 Forward | TCCAGCATCAGCAGGACAGAGG |
TEN1 Reverse | TGTTCCAACAAGGGCAGGTTCATC |
MT1E Forward | TCAGGTTGGGAGGGAACTCAAGG |
MT1E Reverse | GAGAGGGAATGACACGGGCAATG |
ECHDC3 Forward | GCTAGGAAGATCGCATCGCTGAG |
ECHDC3 Reverse | CCTGGGAGGTGAGGTAGTAAGCC |
ANKRD12 Forward | CCAGGAAACTCTTGTGCTCAGGATC |
ANKRD12 Reverse | TCTGAAAGTGATTGGCTGGGGAAAG |
GADPH Forward | GCCGGT- GCTGAGTATGTC |
GAPDH Reverse | CTTCTGGGTGGCAGTGAT |
Statistical analysis
All the statistical analyses were performed by R (version 4.0.3) statistical software. The starBase project (http://starbase.sysu.edu.cn/panCancer.php) was used to analyze the gene expression pattern in KIRC and kidney normal tissues. The univariate and multivariate COX proportional regression models were performed to estimate the crude hazard ratios (HRs), adjusted HRs and their 95% confidence intervals (CIs). Lasso regression analysis was used to screen the prognostic genes. Operating characteristic curve (ROC) was used to predict the prognostic value of genes. The Kaplan–Meier method and log-rank test were used to test the differences in survival as a function of time between the low and high risk score groups. The nomogram was developed to predict survival probability, and the fitting degree of the nomogram was evaluated by calibrations. The ANOVA analysis or Student t-test was used to evaluate the significance of quantitative data. P value < 0.05 was deemed statistically significant, and all tests were two sided.
Data availability
The clinical features of KIRC patients can be obtained from TCGA database (https://portal.gdc.cancer.gov/, repository, cases: project (TCGA-KIRC)) and the corresponding RNA-sep data can be obtained downloaded from the UCSC Xena (https://gdc-hub.s3.us-east-1.amazonaws.com/download/TCGA-KIRC.htseq_fpkm.tsv.gz). Z.L. and Y.C. had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. The datasets generated and/or analysed during the current study are available from the corresponding author on reasonable request.
References
Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2018. CA Cancer J Clin. 68, 7–30. https://doi.org/10.3322/caac.21442 (2018).
Chow, W. H., Dong, L. M. & Devesa, S. S. Epidemiology and risk factors for kidney cancer. Nat. Rev. Urol. 7, 245–257. https://doi.org/10.1038/nrurol.2010.46 (2010).
Patel, N. H. et al. Comparative analysis of smoking as a risk factor among renal cell carcinoma histological subtypes. J. Urol. 194, 640–646. https://doi.org/10.1016/j.juro.2015.03.125 (2015).
Kabaria, R., Klaassen, Z. & Terris, M. K. Renal cell carcinoma: links and risks. Int. J. Nephrol. Renovascular Dis. 9, 45–52. https://doi.org/10.2147/IJNRD.S75916 (2016).
Hunt, J. D., van der Hel, O. L., McMillan, G. P., Boffetta, P. & Brennan, P. Renal cell carcinoma in relation to cigarette smoking: meta-analysis of 24 studies. Int. J.Cancer 114, 101–108. https://doi.org/10.1002/ijc.20618 (2005).
van de Pol, J. A. A., George, L., van den Brandt, P. A., Baldewijns, M. & Schouten, L. J. Etiologic heterogeneity of clear-cell and papillary renal cell carcinoma in the Netherlands Cohort Study. Int. J. Cancer https://doi.org/10.1002/ijc.33193 (2020).
Ehdaie, B., Furberg, H., Zabor, E. C., Hakimi, A. A. & Russo, P. Comprehensive assessment of the impact of cigarette smoking on survival of clear cell kidney cancer. J. Urol. 191, 597–602. https://doi.org/10.1016/j.juro.2013.08.081 (2014).
Parker, A. et al. Evaluation of the association of current cigarette smoking and outcome for patients with clear cell renal cell carcinoma. Int. J. Urol. 15, 304–308. https://doi.org/10.1111/j.1442-2042.2008.01994.x (2008).
Rostron, B. L. et al. Associations between biomarkers of exposure and lung cancer risk among exclusive cigarette smokers in the golestan cohort study. Int. J. Environ. Res. Public Health https://doi.org/10.3390/ijerph18147349 (2021).
Sharma, M., Shetty, S. S. & Radhakrishnan, R. Novel pathways and mechanism of nicotine-induced oral carcinogenesis. Recent Pat Anticancer Drug Discov. https://doi.org/10.2174/1574892816666210806161312 (2021).
Crosby, L. et al. Smoke chemistry, in vitro cytotoxicity, and genotoxicity demonstrates enhanced toxicity of cigarillos compared with cigarettes. Toxicol Sci. 180, 122–135. https://doi.org/10.1093/toxsci/kfaa155 (2021).
Lindner, D., Smith, S., Leroy, C. M. & Tricker, A. R. Comparison of exposure to selected cigarette smoke constituents in adult smokers and nonsmokers in a European, multicenter, observational study. Cancer Epidemiol Biomarkers Prev. 20, 1524–1536. https://doi.org/10.1158/1055-9965.EPI-10-1186 (2011).
Konstantinou, E. et al. Tobacco-specific nitrosamines: a literature review. Food Chem Toxicol. 118, 198–203. https://doi.org/10.1016/j.fct.2018.05.008 (2018).
Brunnemann, K. D., Cox, J. E. & Hoffmann, D. Analysis of tobacco-specific N-nitrosamines in indoor air. Carcinogenesis 13, 2415–2418. https://doi.org/10.1093/carcin/13.12.2415 (1992).
Gulati, S. et al. Systematic evaluation of the prognostic impact and intratumour heterogeneity of clear cell renal cell carcinoma biomarkers. Eur. Urol. 66, 936–948. https://doi.org/10.1016/j.eururo.2014.06.053 (2014).
Yao, Y. et al. Prognostic value of novel immune-related genomic biomarkers identified in head and neck squamous cell carcinoma. J. Immunother. Cancer. https://doi.org/10.1136/jitc-2019-000444 (2020).
Gu, L., Liu, Y., Jiang, C., Sun, L. & Zhou, H. Identification and clinical validation of metastasis-associated biomarkers based on large-scale samples in colon-adenocarcinoma. Pharmacol. Res. 160, 105087. https://doi.org/10.1016/j.phrs.2020.105087 (2020).
Liu, H. J. et al. Ferroptosis-related gene signature predicts glioma cell death and glioma patient progression. Front Cell Dev. Biol. 8, 538. https://doi.org/10.3389/fcell.2020.00538 (2020).
Chong, Z. Z. Targeting PRAS40 for multiple diseases. Drug Discov. Today. 21, 1222–1231. https://doi.org/10.1016/j.drudis.2016.04.005 (2016).
Gonzalez Diaz, E. C., Sinha, S., Avedian, R. S. & Yang, F. Tissue-engineered 3D models for elucidating primary and metastatic bone cancer progression. Acta Biomater. 99, 18–32. https://doi.org/10.1016/j.actbio.2019.08.020 (2019).
Sweeney, C. & Farrow, D. C. Differential survival related to smoking among patients with renal cell carcinoma. Epidemiology 11, 344–346 (2000).
Kroeger, N. et al. Smoking negatively impacts renal cell carcinoma overall and cancer-specific survival. Cancer 118, 1795–1802. https://doi.org/10.1002/cncr.26453 (2012).
Li, W. et al. Cigarette smoke enhances initiation and progression of lung cancer by mutating Notch1/2 and dysregulating downstream signaling molecules. Oncotarget 8, 115128–115139. https://doi.org/10.18632/oncotarget.22924 (2017).
Babu, N. et al. miRNA and proteomic dysregulation in non-small cell lung cancer in response to cigarette smoke. Microrna 7, 38–53. https://doi.org/10.2174/2211536607666180103165343 (2018).
Bai, R. et al. Clinical significance of Ankyrin repeat domain 12 expression in colorectal cancer. J. Exp. Clin. Cancer Res. 32, 35. https://doi.org/10.1186/1756-9966-32-35 (2013).
Giovannetti, E. et al. Role of CYB5A in pancreatic cancer prognosis and autophagy modulation. J. Natl. Cancer Inst. 106, djt346. https://doi.org/10.1093/jnci/djt346 (2014).
Wang, C., Chen, Y., Chen, K. & Zhang, L. Long noncoding RNA LINC01134 promotes hepatocellular carcinoma metastasis via activating AKT1S1 and NF-kappaB signaling. Front. Cell Dev. Biol. 8, 429. https://doi.org/10.3389/fcell.2020.00429 (2020).
Sainio, A. O. & Jarvelainen, H. T. Decorin-mediated oncosuppression—a potential future adjuvant therapy for human epithelial cancers. Br. J. Pharmacol. 176, 5–15. https://doi.org/10.1111/bph.14180 (2019).
Wang, C. et al. Prognostic model and nomogram construction based on autophagy signatures in lower grade glioma. J. Cell Physiol. https://doi.org/10.1002/jcp.29837 (2020).
Wallbillich, J. J. et al. Identification of a transcriptomic signature with excellent survival prediction for squamous cell carcinoma of the cervix. Am. J. Cancer Res. 10, 1534–1547 (2020).
Shi, R. et al. Establishment and validation of an individualized cell cycle process-related gene signature to predict cancer-specific survival in patients with bladder cancer. Cancers (Basel). https://doi.org/10.3390/cancers12051146 (2020).
Chen, K., Xu, H. & Zhao, J. Bloom syndrome protein activates AKT and PRAS40 in prostate cancer cells. Oxid. Med. Cell Longev. 2019, 3685817. https://doi.org/10.1155/2019/3685817 (2019).
Zhou, Q., Tang, S., Zhang, X. & Chen, L. Targeting PRAS40: a novel therapeutic strategy for human diseases. J. Drug Target. 29, 703–715. https://doi.org/10.1080/1061186X.2021.1882470 (2021).
Damayanti, N. P. et al. Therapeutic targeting of TFE3/IRS-1/PI3K/mTOR axis in translocation renal cell carcinoma. Clin. Cancer Res. 24, 5977–5989. https://doi.org/10.1158/1078-0432.CCR-18-0269 (2018).
Hsieh, J. J. et al. Genomic biomarkers of a randomized trial comparing first-line everolimus and sunitinib in patients with metastatic renal cell carcinoma. Eur. Urol. 71, 405–414. https://doi.org/10.1016/j.eururo.2016.10.007 (2017).
Saeed, K. et al. Clonal heterogeneity influences drug responsiveness in renal cancer assessed by ex vivo drug testing of multiple patient-derived cancer cells. Int. J. Cancer 144, 1356–1366. https://doi.org/10.1002/ijc.31815 (2019).
Chen, Y. et al. JWA suppresses tumor angiogenesis via Sp1-activated matrix metalloproteinase-2 and its prognostic significance in human gastric cancer. Carcinogenesis 35, 442–451. https://doi.org/10.1093/carcin/bgt311 (2014).
Acknowledgements
We acknowledge the phenomenal contributions of large open access genomic and clinical databases, including The Cancer Genome Atlas and starBase project, who allowed rapid progression in cancer research.
Funding
This work was supported by grants from the National Natural Science Foundation of China (No. 81502772 and 81703207), the China Postdoctoral Science Foundation funded project (No. 2017M611915), the Jiangsu Planned Projects for Postdoctoral Research Funds (No. 1601046B), Training Project for Youth Teams of Science and Technology Innovation at Xuzhou Medical University (TD202008) and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
Author information
Authors and Affiliations
Contributions
Z.L. and Y.C. conceived the project and designed the experiments. Y.H., Q.W., Y.T. and Z.L. conducted the experiments and data acquisition. Y.H. wrote the original draft. Q.W., Z.L. and G.S. assisted in statistical analyses and revised the paper. Y.C. supervised the study, was responsible for project administration and acquired funding. All authors read and approved the final manuscript.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Huang, Y., Wang, Q., Tang, Y. et al. Identification and validation of a cigarette smoke-related five-gene signature as a prognostic biomarker in kidney renal clear cell carcinoma. Sci Rep 12, 2189 (2022). https://doi.org/10.1038/s41598-022-06352-y
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-022-06352-y
This article is cited by
-
Pan-cancer integrated analysis of ANKRD1 expression, prognostic value, and potential implications in cancer
Scientific Reports (2024)
-
Molecular characterization of ANKRD1 in rhabdomyosarcoma cell lines: expression, localization, and proteasomal degradation
Histochemistry and Cell Biology (2024)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.